OEB 192 – 08.11.03 Mutation rate & population size I.

11
OEB 192 – 08.11.0 Mutation rate & population size I.

  • date post

    21-Dec-2015

  • Category

    Documents

  • view

    219

  • download

    3

TAGS:

Transcript of OEB 192 – 08.11.03 Mutation rate & population size I.

Page 1: OEB 192 – 08.11.03 Mutation rate & population size I.

OEB 192 – 08.11.03

Mutation rate & population size I.

Page 2: OEB 192 – 08.11.03 Mutation rate & population size I.
Page 3: OEB 192 – 08.11.03 Mutation rate & population size I.
Page 4: OEB 192 – 08.11.03 Mutation rate & population size I.

Error catastrophe

Page 5: OEB 192 – 08.11.03 Mutation rate & population size I.
Page 6: OEB 192 – 08.11.03 Mutation rate & population size I.
Page 7: OEB 192 – 08.11.03 Mutation rate & population size I.
Page 8: OEB 192 – 08.11.03 Mutation rate & population size I.

R.A. Fisher, 1930. “The Genetical Theory of Natural Selection”, p.76

Page 9: OEB 192 – 08.11.03 Mutation rate & population size I.
Page 10: OEB 192 – 08.11.03 Mutation rate & population size I.

Wednesday (11/3): Mutation rate & population size II.

Page 11: OEB 192 – 08.11.03 Mutation rate & population size I.

Upcoming talks

Friday, 11/7

"Genomic studies of adaptive evolution in defined environments“

David GreshamPrinceton (Botstein lab)3:00 pm (Bauer Forum)Room 425, Northwest Building

“The role of neutrality in molecular evolution: Novel variations of an old theme”

Peter SchusterUniversity of Vienna & President of the Austrian Academy of Sciences 4:00 pmOne Brattle Square, 6th floor, room 616Directions: http://www.ped.fas.harvard.edu/location/walking.html

http://www.ped.fas.harvard.edu/location/walking.html

Oeb presentation kismihok

Oeb presentation kismihok

Service & Parts Manual · Service & Parts Manual Convotherm Combination Oven-Steamer MODELS: Electric 10.10 and 6.20 OEB-10.10 OES-10.10 OEB-6.20 …

Service & Parts Manual · Service & Parts Manual Convotherm Combination Oven-Steamer MODELS: Electric 10.10 and 6.20 OEB-10.10 OES-10.10 OEB-6.20 …

EMB 500 OEB Report Final

EMB 500 OEB Report Final

OEB 192 – 10.11.01 Genetic & physiological basis of adaptation (Goddard et al., 2005. Nature) (Cooper, 2007. PLoS Biol.)

OEB 192 – 10.11.01 Genetic & physiological basis of adaptation (Goddard et al., 2005. Nature) (Cooper, 2007. PLoS Biol.)

OEB ETC III 2_15

OEB ETC III 2_15

Enwin OEB Application

Enwin OEB Application

OEB Student Survival Guide - marlin

OEB Student Survival Guide - marlin

OEB 192 – 08.09.24 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

OEB 192 – 08.09.24 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

EASA OEB report

EASA OEB report

OEB 192 – 08.11.17 Physiological basis of adaptation.

OEB 192 – 08.11.17 Physiological basis of adaptation.

OEB Post-conference Report 2014

OEB Post-conference Report 2014

OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

OEB 192 – 11.10.17 Dynamics of adaptation. (Miki Lee, Nigel Delaney, Maryska Kaczmarek, Lewis Ward) In humidified, 30 °C room: 48-well plates Plate-shaking.

OEB 192 – 11.10.17 Dynamics of adaptation. (Miki Lee, Nigel Delaney, Maryska Kaczmarek, Lewis Ward) In humidified, 30 °C room: 48-well plates Plate-shaking.

OEB 192 – 09.11.09 Optimality & evolution of networks.

OEB 192 – 09.11.09 Optimality & evolution of networks.

An example story OEB 192 10.09.01 (Nature 394:69-72)

An example story OEB 192 10.09.01 (Nature 394:69-72)

Operating, Installation, and Service Manual · CV Plus 3423400 OES OEB 06.10 OES OEB 10.10 CV Plus 3423401 OES OEB 06.20 OES OEB 10.20 CV Plus 3423402 OES OEB 20.10 CV Plus 3423403

Operating, Installation, and Service Manual · CV Plus 3423400 OES OEB 06.10 OES OEB 10.10 CV Plus 3423401 OES OEB 06.20 OES OEB 10.20 CV Plus 3423402 OES OEB 20.10 CV Plus 3423403

Crj Oeb Report

Crj Oeb Report

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

Catalogo oeb

Catalogo oeb

OEB 192 – 10.11.10 Phenotypic diversity & epigenetics.

OEB 192 – 10.11.10 Phenotypic diversity & epigenetics.