Occurrence of Leptospira sp. in environmental water samples from ...
-
Upload
nguyendang -
Category
Documents
-
view
212 -
download
0
Transcript of Occurrence of Leptospira sp. in environmental water samples from ...
Occurrence of Leptospira sp. in environmental water samples from Wind Cave, Bau,
Sarawak.
Irwin Emmanuel Ak Robin Jeli
Bachelor of Science with Honours
(Biotechnology Resource)
2013
Faculty of Resource Science and Technology
i
ACKNOWLEGDEMENT
Much appreciation goes to my respected supervisor, Prof. Dr. Kasing Apun and my co-
supervisor, Dr Lesley Maurice Bilung, who give me guidance, inspirations, and invaluable
support throughout this project. Your sacrifices, understanding and total care are very much
appreciated. May God continually bless you all!
My sincere thanks go to my dearest family; papa, mama, and my lovely sisters, Bella and Nini,
you are always my inspiration. Thank you for all the supports and prayers in every aspect of my
study. Especially to my parents who provides moral and financial supports to me in completing
this project. My deepest gratitude goes to my friends that I have known in Shalom Church and
CLC; Rizoh, Karyn, Eric, Ben, Joshua Baru, Haider, Mas, Gary, and many more for the
understanding, care and support in prayer. My appreciation also goes to all my coursemates and
UNIMAS friends; Delstein, Allysya, Ikwan, Nazriman, Hashim, Shafillah, Bam and others. I
sincerely thank you all for the love, friendship and care that we have shared. Also my thanks
goes to all Master students in the microbiology lab especially Yong Sy Foo for his help and
guidance in completing this project. Lastly, to all staffs of the Faculty of Resource Science and
Technology and the kind-hearted people of UNIMAS, I truly appreciated your presence.
I would like to thank God for the wisdom and strength that He gave me in the completion of this
project. I acknowledge His gift for this life and the promises that He made with me to help me in
my studies until now. Thank you so much God. You are my everything!
ii
DECLARATION
The work in this thesis, to the best of my knowledge and belief, original and my own work,
except as acknowledged in the text. I hereby declare that no portion of this thesis has been
submitted in support of an application for another degree of qualification of this or any other
university or institution of higher learning.
Irwin Emmanuel Ak Robin Jeli
Date:
iii
TABLE OF CONTENT
Acknowledgement ……………………………………………………………………………… I
Declaration ……………………………………………………………………………………… II
Table of Contents ………………………………………………………………………………. III
List of Abbreviations …………………………………………………………………………... IV
List of Tables and Figures ……………………………………………………………………… V
Abstract ………………………………………………………………………………………….. 1
1.0 Introduction ………………………………………………………………………………….. 2
2.0 Literature Review 2.1 Leptospira species …………………………………………………………………… 4 2.1.1 Morphology of Leptospira ………………………………………………… 4 2.1.2 Physiology, Metabolism and Growth of Leptospira ………………………. 5 2.2 The Genus of Leptospira ……………………………………………………………. 6 2.2.1 Serological Classification …………………………………………………. 6 2.2.2 Genotypic Classification …………………………………………………... 6 2.3 Molecular Biology of Leptospira …………………………………………………… 8 2.4 Epidemiology ………………………………………………………………………... 8 2.5 Ecology of Leptospira ………………………………………….………………...…. 9
2.6 Polymerase Chain Reaction (PCR) ……………………………………………….... 10
3.0 Materials and Methods 3.1 Sample Collection ………………………………………………………………….. 11 3.2 Culturing and Detection of Leptospira …………………………………………….. 11 3.3 Genomic DNA extraction for PCR ……………………………………………….... 12 3.4 PCR amplification of LipL32 gene ……………………………………………….... 13 3.5 Agarose Gel Electrophoresi ……………………………………………………...… 14
4.0 Results ………………………………………………………………………….…………... 15
5.0 Discussion ………………………………………………………………………………….. 20
6.0 Conclusion …………………………………………………………………………………. 23
References ……………………………………………………………………………………… 24
iv
LIST OF ABBREVIATIONS
oC - degree Celsius
sec - second
min - minute
ml - millilitre
m - micrometre
Bp - base pair
kb - kilo base pairs
% - percentage
ddH2O - double-distilled water
rpm - revolution per minute
DNA - Deoxyribonucleic Acid
PCR - Polymerase Chain Reaction
EMJH - Ellinghausen-McCullough as modified by Johnson and Harris medium
L.interrogans - Leptospira interrogans
L.biflexa - Leptospira biflexa
v
LIST OF TABLES
Table 1 - Genomic species of Leptospira and distribution of serogroups ……………….. 7
Table 2 - Summary of detection of LipL32 gene via PCR ……………………………….. 17
Table 3 - Summary of observation under dark field microscope ………………………… 18
LIST OF FIGURES
Figure 1 - Structure of a leptospires showing the surface layer (SL), outer membrane (OM),
cytoplasmic membrane (CM) and flagellum (F) with its insertion point (I) …… 5
Figure 2 - Observation under dark field microscope for water samples (sample C3) collected
from stream inside the cave……………………………………………………..... 15
Figure 3 - Observation under dark field microscope for water samples (sample C1) collected
from stagnant water inside the cave……………………………………………… 16
Figure 4 - Observation under dark field microscope for water samples (sample R3) collected
from outside the cave…………………………………………………………….. 16
Figure 5 - Agarose gel electrophoresis of PCR product shows detection of leptospires in
environmental water samples collected from Wind Cave, Bau…………………. 19
1
Occurrence of Leptospira sp. in environmental water samples from Wind Cave, Bau, Sarawak.
Irwin Emmanuel Ak Robin Jeli
Faculty of Resource Science and Technology UNIMAS
ABSTRACT
The genus Leptospira is composed of tightly coiled spirochetes that exist in two groups which are pathogenic strains
and saprophytic strains. The pathogenic strains caused Leptospirosis, the most widespread zoonotic disease which is
also known as the rat urine’s disease. The saprophytic strains are usually found on surface water meanwhile the
pathogenic strains requires animal host to survive. The aim of this research is determine the occurrence of
Leptospira sp. isolated from environmental water samples collected from Wind Cave, Bau. A total of 17 water
samples were collected from the sampling site. The samples were cultured in EMJH medium for 30 days and were
observed under dark field microscope for the presence of Leptospira. No observation of leptospires was detected.
Six samples were selected for comparison purposes. Further confirmation was done by utilizing polymerase chain
reaction targeting the LipL32 gene. The findings reported that LipL32 gene was successfully amplified by PCR in
three of the samples. Therefore, the use of PCR by targeting the LipL32 gene is more reliable compared to direct
observation under dark field microscope in detecting Leptopsira in environmental water.
Key words: Leptospira sp., lepstopsirosis, occurrences, environmental water samples, LipL32 gene
ABSTRAK
Genus Leptospira terdiri daripada Spirochetes yang bergelung ketat dan wujud dalam dua kumpulan iaitu
kumpulan patogenik dan saprofitik. Kumpulan patogenik menyebabkan Leptospirosis yang juga dikenali sebagai
penyakit kencing tikus. Kumpulan saprofitik ditemui pada permukaan air dan kumpulan patogenik memerlukan hos
haiwan untuk terus hidup. Tujuan kajian ini adalah untuk mengesan Leptospira sp. yang diasingkan daripada
sampel air diambil dari sekitar Gua Angin, Bau. Sebanyak 17 sampel air telah diambil dari tapak persampelan.
Sampel-sampel tersebut dikulturkan dalam medium EMJH selama 30 hari dan diperhatikan di bawah mikroskop
medan gelap untuk mengesan kehadiran Leptospira. Tiada pemerhatian leptospira dikesan. Enam sampel terdiri
telah dipilih untuk tujuan perbandingan. Pengesahan lanjut dilakukan dengan menggunakan PCR yang
mensasarkan gen LipL32. Hasil kajian melaporkan bahawa LipL32 gen telah berjaya dikesan oleh PCR dalam tiga
sampel. Oleh itu, penggunaan PCR dengan mensasarkan gen LipL32 adalah lebih dipercayai berbanding dengan
pemerhatian langsung di bawah mikroskop medan gelap dalam mengesan Leptopsira dalam air alam sekitar.
Kata kunci: Leptospira sp., leptospirosis, kejadian, sampel air, LipL32 gen.
2
1.0 INTRODUCTION
Leptospira genus are obligatory aerobic, tightly coiled bacteria which are motile with the aid
of two perisplamic flagella attached to either end of the body (Gillespie, 1994). These bacteria
can be found within their hosts which are usually small mammals such as rats and dogs. They
also can be found in rivers or ground contaminated with the urine or faeces of its host. There are
two types of species in Leptospira genus which are Leptospira interrogans and Leptospira
biflexa. The pathogenic strains of L. interrogans caused leptospirosis, the acute febrile disease in
humans (Galloway and Levett, 2008). Meanwhile, L. biflexa contain only the saprophytic strains.
In addition, there are several hundred of serovars has been classified under both of these species.
More than 200 Leptospira interrogans serovars have been identified as pathogenic and over 60
as non-pathogenic, which are Leptospira biflexa (Jyothi et al., 2004). Leptospires can survive for
a long period of time in the environment under favourable condition (Ridzlan et al., 2010).
According to Levett (2001), leptospires can survive in warm, moist soil and in water for weeks to
months.
Leptospirosis or known as the Rat’s Urine Disease is a re-emerging infection in Malaysia.
Rat’s Urine disease is caused by the pathogenic strain of Leptsopira interrogans. Due to its
ability to infect a wide range of animals, mainly mammalian species, it is presumed to be the
most widespread zoonotic disease in the world (Gussenhoven et al., 1997) According to
Mohamed-Hassan (2012), rats are considered as one of the most important sources of
leptospirosis in Malaysia. Therefore, human can be infected through direct or indirect contact
with the infected rats’s urine. The survivability of pathogenic leptospires in the environment can
lead to a high incident of leptospirosis. For example, the Segama River was found to be the
primary source of infection that caused an outbreak of acute febrile illness among the athletes
3
participating in the Eco-Challenge located in Sabah (Sejvar et al., 2003). Another case of
leptospirosis in Malaysia involves the death of a trainee in the The National Service programme
at Terkok Camp in Sungai Siput (Shannon, 2012).
The factors affecting the occurrence of Leptospira in the environmental water are not fully
understood. This is due to limited understanding of their ecology in the environment. There are
possibilities of different occurrence of Leptopsira strains isolated from slow- moving water and
stagnant water. The prevalence of Leptospira strains isolated from each type of water samples
can be influenced by a few factors such as temperature and pH. In addition, in the present study
molecular technique based on PCR was be used to detect the leptopspiral DNA in the isolated
water samples.
To date, little information is still known on the distribution of Leptospira in the
environment. Thus the emphasis of this research project was to study the occurrence of
Leptospira collected from environmental water samples. The objectives of this study were to:
i. Determine the occurrence and distribution of Leptospira sp. isolated from the
environmental water samples collected from Wind Cave, Bau.
ii. Detect leptospiral DNA in the environmental water samples collected from Wind
Cave, Bau, by using molecular technique-based PCR.
4
2.0 LITERATURE REVIEW
2.1 Leptospira species
2.1.1 Morphology of Leptospira
The general characteristic of Leptospira are obligate aerobic, tightly coiled, 6-20 µm long and
0.1 µm wide with hooked ends. An earlier study conducted by Hovind-Hougen (1986), shows
the three major structural component of the Leptospira cell by using electron microscopy. The
three structural components are an outer envelope, two perisplasmic flagella or axial filaments
and a protoplasmic cylinder. Leptospires have a double membrane structure that consists of
cytoplasmic membrane and peptidoglycan cell wall which are overlain by an outer membrane
(Haake, 2000). Both cytoplasmic membrane and peptidoglycan cell wall are underneath the outer
envelope. The two perisplamic flagella which are attached to either end of the body are important
for the motility of leptospires (Gillespie, 1994). In addition, the structure of the flagellar proteins
is complex (Trueba et al., 1992). The protoplasmic cylinder is the cylindrical cell body of the
leptopspire which consist of cytoplasm component such as nuclear material and ribosomes
(Faine et al., 1999). Leptospires can only be observed under dark-field microscopy when
unstained. However, all leptospires are morphologically indistinguishable and can only differ in
their mode of living.
5
Figure 1: Structure of a leptospires showing the surface layer (SL), outer membrane (OM), cytoplasmic membrane (CM) and flagellum (F) with its insertion point (I). (Hovind-Hougen, 1986).
2.1.2 Physiology, Metabolism and Growth of Leptospira
According to Levett (2001), leptospires shows two different forms of movement; translational
and non-translational. These movements are associated with the movement of the perisplasmic
flagella. There are three possible ways of these flagella movement; central axis rotation, straight
end progressive movement and circular motion (Bharti et al., 2003). Leptospires can be stained
using carbol fuchsin counterstain (Levett, 2001). According to Bharti et al. (2003), leptospires
exhibit features of both Gram-positive and Gram-negative bacteria. However, its
lipopolysaccharide has the same composition of those found in other gram-negative bacteria but
has lower endotoxic activity (Levett, 2001). Growth of leptospires is often slow on primary
isolation. The oleic acid-albumin medium EMJH are the most widely used medium in culturing
leptospira. The leptospires have an optimum growth temperature of 28 to 30 oC and produce
both catalase and oxidase (Levett, 2001).
6
2.2 The Genus of Leptospira
Leptospira genus is tightly coiled spirochetes that belong to the leptospiraceae family.
Leptospira exist in two groups depending to their modes of living which are the pathogenic
parasitic and the free-living saprophytes. For examples, the pathogenic parasitic include
Leptospira interrogans and the saprophytes include Leptospira biflexa. Leptospira interrogans
was named by Stimson, a scientist that discovered clumps of spirochetes with hooked ends in the
kidney of a patient who died of yellow fever (Stimson, 1907). There are two ways of classifying
the leptospires; serological and genotypic classification.
2.2.1 Serological Classification
The first ways is the classical classification which based on serological characteristic. Based on
this classification, leptospires can be divided into the pathogenic strain Leptospira interrogans
and the saprophytic strain Leptospira biflexa. According to Levett (2001), L.biflexa can be
differentiated from L.interrogans by its ability to grow at 13oC and in the presence of 8-
azaguanine and by the failure of L.biflexa to form spherical cells in 1 M NaCl. Based on
serological analysis, there are around 200 studied serovars (Lim et al., 2011). More than 200
Leptospira interrogans serovars have been identified as pathogenic and over 60 as non-
pathogenic, which are Leptospira biflexa (Jyothi et al., 2004). There are varieties of serological
test have been used to identify serovars. The two common methods used are microscopic
agglutination test (MAT) and enzyme-linked immunosorbent assay (ELISA).
2.2.2 Genotypic Classification
The second method is by genotypic classification. All serovars of both L.biflexa and
L.interrogans are included in this classification. Genotypic classification of Leptospira is based
7
on DNA relatedness and DNA hybridisation. DNA hybridization studies led to the definition of
10 genomospecies of Leptospira which is defined as being at least 70% DNA related (Levett,
2001). Multilocus enzyme electrophoresis data provide supports for genotypic classification, but,
recent studies suggest that further revisions for the taxonomic are needed (Levett, 2001).
Table 1: Genomic species of Leptospira and distribution of serogroups (Levett, 2001).
Genomic species Serogroup L. alexanderi Canicola, Icterohaemorrhagiae, Javanica, Lyme, Manhao, Panama,
Shermani, Tarassovi
L. biflexa Andamana, Semaranga L. borpetersenii Australis, Autumnalis, Ballum, Bataviae, Celledoni, Hebdomadis,
Javanica, Mini, Pyrogenes, Sejroe, Tarassovi
L. fainei Hurstbridge L. inadai Canicola, Icterohaemorrhagiae, Javanica, Lyme, Manhao, Panama,
Shermani, Tarassovi
L. interrogans Australis, Autumnalis, Bataviae, Canicola, Djasiman, Grippotyphosa, Hebdomadis, Icterohaemorrhagiae, Louisiana, Mini, Pomona, Pyrogenes, Ranarum, Sarmin, Sejroe
L. kirscheri Australis, Autumnalis, Bataviae, Canicola, Cynopteri, Djasiman, Grippotyphosa, Hebdomadis, Icterohaemorrhagiae, Pomona
L. meyeri Javanica, Mini, Ranarum, Sejroe, Semaranga L. noguchii Australis, Autumnalis, Bataviae, Djasiman, Louisiana, Panama,
Ponoma, Pyrogenes, Shermani, Tarassovi
L. santarosai Autumnalis, Bataviae, Cynopteri, Grippotyphosa, Hebdomadis, Javanica, Mini, Pomona, Pyrogenes, Sarmin, Sejroe, Shermani, Tarassovi
L. wolbachii Codice L. weilii Celledoni, Hebdomadis, Icterohaemorrhagiae, Javanica, Manhao,
Mini, Pyrogenes, Sarmin, Sejroe, Tarassovi
8
2.3 Molecular Biology of Leptospira
Leptopsires are phylogenetically related to other spirochetes. According to Bharti et al. (2003),
the leptospiral genome is more than four times the number predicted for the other sequenced
spirochetes, namely Treponema spp and Borrelia spp. This information indicates that Leptospira
are able to live within diverse environments; in animal host or freely in the environment. The
entire sequence of leptospiral genome has already been established (Ren et al., 2003). It is
approximately 5000 kb in size and comprised of two sections, a 4400-kb chromosome and a
smaller 350-kb chromosome. Techniques for genetic manipulation of leptospires have been
developed to aid in the studies of pathogenesis, virulence factors and basic cell biological studies
of the organism. (Levett, 2001; Bharti et al., 2003). Understanding of the Leptopira genomes
will give an insight of the pathogenesis of the bacteria. Many leptospiral genes have been cloned
and analysed such as rRNA, outer membrane proteins and lipopolysaccharides (Bharti et al.,
2003). For examples, the LipL32 genes of Leptospira interrogans are used as indicator or primer
in PCR-based DNA sequencing technique for detecting Leptospira in patients (Ram et al., 2011).
Distinct DNA profiles generated by a molecular technique known as pulsed-field gel
electrophoresis (PFGE) allowed a more accurate and efficient identification of the leptopspires.
2.4 Epidemiology
Leptospirosis is the infectious disease caused by the pathogenic strain of Leptospira interrogans.
It is presumed to be the most widespread and important zoonotic disease in the world
(Gussenhoven et al., 1997). This is because leptospirosis can infect a wide range of animals,
mainly mammalian species. Leptospirosis involves infected domestic animals and wildlife
9
where human can be infected through direct or indirect contact with their urine. In humans, the
usual portal of entry is through abrasions or cuts in the skin or via the conjunctiva. Most
leptospirosis infection occurs higher in warm climate countries than in temperate countries.
Leptospirosis symptoms range from fever to respiratory difficulties, and in a more severe
conditions, jaundice, renal failure and meningitis.
The treatment of leptospirosis depends on the severity and duration of symptoms at the time of
presentation. Vaccination has been introduced but its effect is limited because its only can
produce immunity towards homologous serovars or antigenically similar serovars only (Levett,
2001). Based on a study conducted by Naigowit et al. (2007), leptospirosis has become a major
public health problem in Thailand where the annual number of reported cases has been
increasing since 1996. Leptospirosis also becomes a public health concern in Malaysia. An
outbreak of acute febrile illness was reported among the athletes participating in the Eco-
Challenge located in Sabah, and the Segama River was found to be the primary source of
infection (Sejvar et al., 2000). Another 46 cases were identified in an outbreak in Kampung
Kabatu, Beaufort, Sabah, which was associated with swimming in a creek near an oil palm
plantation (Kaoay et al., 2004). Recent case of leptospirosis involves the death of a trainee in The
National Service programme at Terkok camp in Sungai Siput (Shannon, 2012).
2.5 Ecology of Leptospira
Leptospires can be found in variety of places depending to their modes of living. The saprophytic
leptospires such as L. biflexa can be found in the environment such as surface waters and do not
requires hosts because they only feed on organic matter in water. However, the pathogenic
10
leptopsires need a host for survival and reproduction. The natural carriers for various pathogenic
serovars are rodents and domestic animals such as dogs, pigs and cattles (Priya et al., 2007).
Rodents are the main source of spirochetes that are transmitted to humans. The bacteria are
maintained in nature by chronic infection of the renal tubules of maintenance hosts which will be
shed via urine into the environment and survive under suitable moist conditions (Monahan et al.,
2008). Leptopsires grows optimally in fresh water, damp soil or mud in temperatures of between
28oC and 30oC. The ecology of leptospirosis is complex due to the interaction between humans,
animal reservoirs, leptospires and the environment they coexist (Lau et al., 2010). For example,
heavy rainfall and flooding increase the risk of leptospirosis by bringing bacteria and their
animal host into closer contact with humans.
2.6 Polymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR) is a molecular technique which amplifies a single sequence of
DNA or more which will generate magnitudes of copies of the targeted sequences. The
sensitivity and specificity of a PCR assay is dependent on target genes, primer sequences, PCR
techniques, DNA extraction protocols and PCR product detection methods (Yamamoto, 2002).
The technique depend on thermal cycling which consist of cycles of repeated heating and cooling
of the reaction for DNA melting and enzymatic replication of the DNA. There are many type of
PCR. For examples, Multiplex PCR, RT-PCR, Hot start PCR, Nested PCR, Quantitative PCR
and many more. PCR are often used for detecting bacteria from environmental samples due to its
sensitivity. PCR methods for detection of Leptospira in different fresh clinical specimens are
sensitive, specific and rapid (Letocart et al., 1997). PCR also can be used to detect leptospiral
DNA in bovine urine (Baquero et al., 2010).
11
3.0 MATERIALS AND METHODS
3.1 Sample Collection
The fieldwork sampling was conducted on 28 January 2013 at Wind Cave, Bau. This location
was chosen because of the higher possibility of detecting Leptospira due to the abundance of its
animal host such as bats and rats. Water samples were collected from stagnant water and slow-
moving water (streams) using sterile 50 ml Falcon tubes and directly kept inside the container to
preserve the sample (Ridzlan et al., 2010). A total of 17 water samples were collected during the
fieldwork and 1 sample was taken per sampling site. Fourteen water samples were collected
outside the cave. The samples comprised of 2 samples from stagnant water and 12 samples from
the river beside the cave. The stagnant water was located near the river. The samples were taken
at 5 main points in the river. Each point consists of 3 locations which were at both river bed and
at the centre of the river. Meanwhile only 3 samples were collected inside the cave which
comprised of a sample from small streams and 2 samples from stagnant water. The small
amounts of samples were collected due to safety reasons such as slippery surfaces and
unreachable places in the cave.
3.2 Culturing and Detection of Leptospira
The methods for culturing and detection of Leptospira are based on Ridzlan et al. (2010). The
water samples (50 ml each) were passed through sterile 0.22 µm pore size membrane filter and 2
ml of the filtrate from each sample was inoculated into the modified EMJH medium. The EMJH
medium was prepared a day before the fieldwork sampling. The EMJH medium was prepared by
mixing EMJH medium powder (0.575 g) with distilled water (225 ml). The mixture then was
12
autoclaved. The EMJH medium was also mixed with Leptospira enrichment media (50 ml) to
enhance the growth of the Leptospira. The cultures were then incubated aerobically in the dark at
room temperature for 30 days. Later, the cultures were observed at 40x magnification under a
dark-field microscope (Olympus Compound Microscope BX51) after 30 days. Leptospires have
a hook-like end, thin and motile. However, leptopsires were not detected in all of the samples.
Six samples comprised of 3 samples each from outside and inside the cave were chosen for
comparison purposes. These samples were subjected to further confirmation via molecular
method, PCR.
3.3 Genomic DNA Extraction for PCR
Six samples were chosen for genomic extraction for PCR. These 6 samples consist of 3 samples
each from outside and inside the cave were for comparison purposes. The genomic DNA
extraction methods were based on the QIAamp DNA Mini and Blood Mini Handbook (2012).
The extraction was done by using an extraction kit (QIAamp DNA Mini kit). Firstly, 1 ml of the
bacterial culture was pipetted into a 1.5 ml microcentrifuge tube. The sample was then
centrifuged for 5 min at 7500 rpm. The supernatant was discarded and 200 µL of buffer AL and
20 µL of Proteinase K were added to the pellet. The mixtures were incubated for 10 min at 60oC.
Secondly, 200 µL of ethanol (100%) was added to the mixture and it was mixed by pulse-
vortexing for 15 sec. Next, the mixture was carefully applied to the QIAamp Mini spin column
(in a 2 ml collection tube) and the cap was closed. The column was then centrifuged for 1 min at
8000 rpm. The column was placed in a new 2 ml collection tube and the tube containing the
filtrate was discarded. Next, 500 µL of buffer AW1 was added to the column and the cap was
closed. The column was then centrifuged for 1 min at 8000 rpm. The column was placed in a
13
new 2 ml collection tube and the tube containing the filtrate was discarded. After that, 500 µL of
buffer AW2 was added to the column and cap was closed. The column was then centrifuged for
1 min at 8000 rpm. Subsequently, the column was placed in a clean 2 ml collection tube and
centrifuged for 3 min at 8000 rpm. Next, the column was transferred to a new 1.5
microcentrifuge tube. After that, 200 µL of buffer AE was added to the column. Subsequently,
the column was incubated at room temperature for 1 min. After that, the column was centrifuged
for 1 min at 8000 rpm. Finally, the sample was stored in ice (at 4oC) for the next step which is
PCR.
3.4 PCR amplification of LipL32 gene
The primer used in the amplification of LipL32 gene which encodes the outer membrane
lipoprotein LipL32 was used based on a study conducted by Ahmed et al. (2006). The forward
and the reverse primer of LipL32 used are shown below;
Forward primer: 5’ ATCTCCGTTGCACTCTTTGC 3’
Reverse primer: 5’ ACCATCATCATCATCGTCCA 3’
The PCR amplification method was based on Vital-Brazil et al. (2010). The PCR amplification
was performed in a final reaction volume of 25 µL. All reactions contained 12.5 µL of PCR
Master Mix (QIAGEN), 2 µL of the primer, 6 µL of DNA and 4.5 µL of ddH2O. PCR
amplification was performed using the following conditions: one denaturation cycle at 95oC for 5
14
min, 35 cycles of denaturation at 95oC for 1 min, annealing at 55oC for 30 sec and extension at
72oC for 1 min and a final extension at 72oC for 7 min.
3.5 Agarose Gel Electrophoresis
The amplified product undergoes gel electrophoresis on a 2% agarose gel. The agarose gel was
stained with ethidium bromide. The gel was then observed under UV light. The size of the DNA
band was estimated using a 100-bp ladder. The negative control used was only consisted of
DNA-free ddH2O.
15
4.0 RESULTS
All of the total 17 samples collected did not showed the presence of Leptospira when observed
under a dark field microscope. This was due to no observation of main morphology of
Leptospira sp. such as hook-like end, thin and motility. Since all of these characteristics did not
illustrated during the observation, the cultures are assumed as negative as shown in Figures 2 to
4. Six samples comprised of 3 samples each from outside and inside the cave were chosen for
comparison purposes and further confirmation test.
Figure 2. Observation under dark field microscope for water samples (sample C3) collected from stream inside the cave. No spiral-shaped organisms were observed.
16
Figure 3. Observation under dark field microscope for water samples (sample C1) collected from stagnant water inside the cave. No spiral-shaped organisms were observed.
Figure 4. Observation under dark field microscope for water samples (sample R3) collected from outside the cave. No spiral-shaped organisms were observed.
17
The samples were then subjected to molecular techniques which is PCR for further confirmation.
The primer used in the PCR is specifically to amplify the LipL32 gene which can be found in the
outer membrane of leptospires. Six samples were chosen for PCR analysis for the purposes of
further confirmation. These six samples comprises of the 3 samples from inside the cave which
were sample C1, C2 and C3 and another three samples collected outside of the cave which were
sample R1, R3 and R12 as shown in Table 2. These 6 samples were chosen to compare the
occurrence of Leptospira inside and outside the cave. Figure 5 displays the agarose gel
electrophoresis of PCR product of the 6 chosen samples. Based on Figure 5, only samples
collected from inside the cave showed DNA band. The size of the DNA bands is estimated using
a 100 bp ladder. The size of the PCR product shown in lane 4, 5 and 6 are estimated at around
400 to 500 bp. In addition, the negative control only consists of DNA-free ddH2O (lane 7). Table
3 shows the summary of observation made under dark field microscope.
Table 2. Summary of detection of LipL32 gene via PCR.
No Sample No Source Detection of LipL32 gene using PCR
1 C1 Inside cave; stagnant water Positive 2 C2 Inside cave; stagnant water Positive 3 C4 Inside cave; small stream Positive 4 R1 Outside cave; stagnant water
near the river Negative
5 R3 Outside cave; in river (near river bed).
Negative
6 R12 Outside cave; in river (near river bed).
Negative
18
Table 3. Summary of observation under dark field microscope.
No Sample No. Source Morphological observation
(under dark field microscope)
1 C1 Inside cave; stagnant
water None
2 C2 Inside cave; stagnant water
None
3 C3 Inside cave; small stream None 4 R1 Outside cave; stagnant
water near the river None
5 R2 Outside cave; stagnant water near the river
None
6 R3 (Point 1) Outside cave; in river (near river bed).
None
7 R4 Outside cave; in river (centre)
None
8 R5 Outside cave; in river (near opposite river bed)
None
9 R6 (Point 2) Outside cave; in river (near river bed).
None
10 R7 Outside cave; in river (centre)
None
11 R8 Outside cave; in river (near opposite river bed)
None
12 R9 (Point 3) Outside cave; in river (near river bed).
None
13 R10 Outside cave; in river (centre)
None
14 R11 Outside cave; in river (near opposite river bed)
None
15 R12 (Point 4) Outside cave; in river (near river bed).
None
16 R13 Outside cave; in river (centre)
None
17 R14 Outside cave; in river (near opposite river bed)
None