No. THE Cmmmm Vol. 3, of 269, 21, pp. 1775-1784, 1994 OF ... · PDF filePrecursor Sequence,...

THE JOURNAL OF BIOLZYXCAL C m m m m 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 3, Issue of January 21, pp. 1775-1784, 1994 Printed in U S A

Precursor Sequence, Processing, and Urothelium-specific Expression of a Major 15-kDa Protein Subunit of Asymmetric Unit Membrane*

(Received for publication, April 20, 1993, and in revised form, July 7, 1993)

JW-Hsiang LinS, Xue-Ru WuS, Gert Kreibich9, and I’ung-Tien Suns From the gpithelial Biology Unit, The Ronald 0. Perelman Department of Dermatology, Department of Pharmacology and 4Department of Cell Biology, Kaplan Comprehensive Cancer Center, New York University School of Medicine, New York, New York 10016

” -

The asymmetric unit membrane (AUM) is a highly specialized biomembrane elaborated by terminally differentiated umthelial cells. It contains quasi-crystalline arrays of 12-nm protein particles each of which is composed of six dumbbell-shaped subdomains. In this paper we describe the precursor sequence, processing and in vitro membrane insertion properties of bovine uroplakin 11 (UPII), a 15-kDa major protein component of AUM. The cDNA-deduced amino acid sequence revealed that UPII is synthesized as a precursor protein containing a cleavable signal peptide of -28 amino acids, a long pro-sequence of “59 residues harboring three potential N-glycosylation sites, and the mature polypeptide of 100 residues. In vitro translation of UP11 mRNA demonstrated that UP11 is indeed first synthesized as a 19-kDa precursor, which loses its signal peptide upon insertion into added microsomes; this process is accom- panied by the acquisition of high mannose-type oligo- saccarides giving rise to a 28-kDa precursor which is completely protected from the digestion by exogenous proteases. These results, together with the presence of a stretch of 25 hydrophobic amino acids at the C terminus, suggest that UP11 protein is anchored to the lipid bilayer via its C-terminal membrane-spanning domain with its major N-terminal domain exposed luminally. The formation of the 15-kDa mature UPII requires the removal of the pro-sequence by a furin-like endoprotease. Since only mature UPII devoid of this pro-sequence can interact with 27-kDa uroplakin I, the proteolytic processing of UPII precursor may play an important role in regulating the assembly of AUM. Finally, we showed that genomic sequences cross-hybridizing with bovine Up11 cDNA are present in many mammals suggesting that UP11 performs a highly conserved function in the terminally differentiated cells of mammalian urinary bladder epithelium.

The plasma membrane of urothelium becomes specialized during the terminal stage of cellular differentiation, resulting in the formation of numerous rigid-looking membrane plaques

Grants DK39753 and AR39749. The costs of publication of this article * This work was supported in part by National Institutes of Health

were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted

to the GenBankTMIEMBL Data Bank with accession number(s) L20633. 1 To whom correspondence should be addressed: The Ronald 0. Per-

elman Department of Dermatology, New York University School of Medicine, 566 First Ave., New York, NY 10016. Tel.: 212-263-5685; Fax: 212-263-8561.

that cover the apical surface (Porter, 1963; Porter and Bonne- ville, 1967; Hicks, 1975). Transmission electron microscopy showed that the outer leaflet of such a plaque-forming membrane is almost twice as thick as the inner leaflet (8 versus 4 nm), hence the term “asymmetric unit membrane” (AUM)l (Hicks, 1965; Koss, 1969). Negative staining and freeze-frac- ture studies of purified AUM plaques revealed quasi-crystalline, hexagonal arrays of 12-nm particles arranged in p6 sym- metry with a center-to-center spacing of 16 nm (Hicks and Ketterer, 1969, 1970; Warren and Hicks, 1970; Staehelin et al, 1972; Knutton and Robertson, 1976; Robertson and Vergara, 1980). These particles, which are associated exclusively with the outer leaflet of AUM, can be removed by trypsin leaving behind a smooth and now regular looking 4-nm thick outer leaflet (Caruthers and Bonneville, 1980). These observations suggest that the 12-nm particles contain proteins and are largely responsible for the thickened appearance of outer leaflet in AUM cross sections. Since this membrane specialization is also observed in cytoplasmic fusiform vesicles of superficial urothelial cells, it has been suggested that during bladder dis- tension some of these AUM vesicles may fuse with the luminal membrane, thus contributing to an increased apical surface area. Conversely, during bladder contraction, some of the apical plaques can reform vesicles to be stored in the cytoplasm (Por- ter and Bonneville, 1963; Hicks, 1966; Porter et al . , 1967; Sev- ers and Hicks, 1979; Alroy and Weinstein, 1980). This notion is supported by electrophysiological measurements showing the fluctuation of surface area-related conductance (Lewis and de- Moura, 19841, and by the morphometric quantitation of cytoplasmic vesicles in transmission electron micrographs during the distensiodcontraction cycle of urinary bladder (Minsky and Chlapowski, 1978). It has also been proposed that the proteins of AUM may be involved in stabilizing and strengthening the apical surface of urothelium through their interactions with an underlying cytoskeleton (Staehelin et al . , 1972; Sarikas and Chlapowski, 1986). The quasi-crystalline protein structure of AUM provides an opportunity for studying the detailed molecular basis of this membrane specialization and for analyzing specific steps in the synthesis, processing and assembly of membrane proteins. Moreover, since AUM is a unique differentiation product of bladder epithelium, molecular analysis of its protein constituents may shed light on the mechanisms underlying the regulation of urothelial differentiation.

Although several groups accomplished the partial purifica- tion of AUMs using sucrose density gradient techniques, the

The abbreviations used are: AUM, asymmetric unit membrane; UP, uroplakin; PAGE, polyacrylamide gel electrophoresis; PIPES, 1,4-pi- perazinediethanesulfonic acid; PCR, polymerase chain reaction; ER, endoplasmic reticulum; endo H, endoglycosidase H; kb, kilobase; bp, base pair.

1775

1776 Urothelium-specific Expression of Uroplakin 11

protein composition ofAUM was not established until recently. Earlier analysis of various AUM preparation by SDS-PAGE revealed multiple proteins ranging from 15- to 80-kDa (Ket- terer et al., 1973; Vergara et al., 1974; Caruthers and Bonne- ville, 1977; Stubbs et al., 1979). However, antibodies against these putative AUM constituents were not available, and it was therefore not possible to prove that any of these proteins were AUM-associated in situ. We have recently shown that a mono- clonal antibody, AE31, recognizes a 27-kDa, bovine AUM-associated integral membrane protein, and that this protein co- purifies with two other proteins (15 and 47 kDa) during immunoafhity chromatography (Yu et al., 1990). Moreover, we found that the gradient-purified and morphologically intact bovine AUMs contain the same three proteins (Wu et al., 1990). The availability of milligram quantities of these proteins al- lowed us to raise antibodies to each of them, and to show that they are all AUM-associated in situ. Peptide mapping, partial amino acid sequencing and immunological data established that these three proteins represent distinct molecules. Taken together, these results indicate that AUM contains at least three major proteins, which we named uroplakins I (27 ma) , I1 (15 kDa), and I11 (47 kDa) (Wu et al., 1990; Yu et al., 1990).

There are several important questions that need to be addressed about this group of novel membrane proteins. First, earlier ultrastructural studies indicate that the 12-nm protein particles are associated exclusively with the outer leaflet of AUM, without penetrating to the inner leaflet (Caruthers and Bonneville, 1980; Brisson and Wade, 1983; Taylor and Robert- son, 1984). We have shown, however, that uroplakins cannot be extracted from isolated AUM plaques using buffers of high ionic strength or alkaline pH (Wu et al., 1990), and that affinity- purified UP1 and UPh partition exclusively into the detergent phase after Triton X-114 phase separation (Yu et al., 1990). These results raise the question as to whether uroplakins are integral membrane proteins, with their extracellular domains involved in forming the 12-nm protein particles. Second, argu- ments have been made that AUM proteins are elaborated by the rough endoplasmic reticulum (ER)-Golgi system, while oth- ers proposed that free polysomes are involved (Severs and Hicks, 1979; Alroy et al., 1982; Pauli et al., 1983). The site of synthesis and assembly of the AUM protein components therefore remains unclear. Third and perhaps most importantly, the precursor-product relationship of uroplakins remains unex- plored. For example, we have shown in an earlier pulse-chase experiment that it took 15-30 min for cultured bovine urothelial cells to process and to generate the mature 15-kDa uroplakin I1 (Yu et al., 19901, suggesting that UP11 is first synthesized as a precursor. It will therefore be important to define such a precursor, and to determine the regulation of its processing. To address some of these questions, we have cloned the cDNA

corresponding to the 15-kDa uroplakin I1 and studied UP11 expression as well as processing. Our data demonstrate that the UP11 gene is tightly regulated in a tissue-specific and differentiation-dependent fashion. We found that UP11 is synthesized as a precursor protein of 185 amino acid residues (prepro- UPII), which contains a cleavable signal peptide of 26 residues, followed by a pro-sequence of 59 residues and a polypeptide of 100 residues corresponding to the mature UPII. In vitro translocation studies using dog pancreatic microsomes clearly established that when the newly synthesized prepro-UP11 is inserted into ER, its signal sequence is cleaved and its pro-sequence becomes N-glycosylated, yielding a 28-kDa UP11 precursor. The removal of the pro-sequence involves a furin-like endoprotease that most likely resides in the Golgi apparatus. Since only mature UP11 devoid of the pro-sequence is present in the AUM and can interact in vitro with the 27-kDa uroplakin I, the

proteolytic processing of UP11 precursor may play an important role in regulating the assembly of AUM.

MATERIALS AND METHODS Amino Acid Sequencing-Bovine AUMs were prepared by sucrose

gradient centrifugation and deoxycholate washing (Wu et al., 1990). Uroplakin I1 was purified by SDS-PAGE, and subjected to N-terminal microsequencing. Cyanogen bromide cleavage of purified UP11 was performed according to Lonsdale-Eccles et al. (1981). Tryptic peptides were obtained by in situ digestion of UP11 immobilized on a nitrocellulose filter (Aebersold et al., 1987). The resulting peptides were separated by high performance liquid chromatography on a C18-reverse phase column (Vydac) using a 0 4 0 % acetonitrile gradient in 0.06% trifluoroace- tic acid. N-terminal sequencing was done using an Applied Biosystem (AB11 477A protein sequenator, courtesy of Dr. William Lane of the Harvard Microchemistry Facilities.

Polymerase Chain Reaction (PCR,!-Total cellular RNAs were prepared using a guanidinium thiocyanatelCsC1 centrifugation procedure, and poly(A)+ RNAs were purified using an oligo(dT)-cellulose column (Sambrook et al., 1989). Messenger RNAs from bovine urothelium were reverse-transcribed a t 42 "C for 1 h using avian myeloblastosis virus reverse transcriptase (Promega) in the presence of a (dT),, primer. The reaction mixture was diluted with TE buffer (10 IMI Tris-HC1, pH 8 .0 , l m EDTA) and stored a t -20 "C. For PCR amplification of UP11 cDNA, five degenerate oligodeoxynucleotides were designed based on UP11 peptide sequences (see Fig. 2). The oligonucleotide sequences are as following (N stands for all deoxynucleotides). (a) Sense primer 1 (Sl), a mixture of 5'-CTCTAGA(A/G)CTNGTNTCNGTNGT-3' and 5'-CTC- TAGA(A/G)CTNGTNAG(T/C)G-TNGT-3'; ( b ) antisense primer 1 (ASl), a mixture of 5'-GGTCGACAG(A/G)TANG-ANAT(AJG)TA(A/G)TA-3'

( c ) internal probe, 5'-GA(T/C)TC-(T/C)GG(T/C)TC(T/C)GG(T/C)?T(T/ C)AC(T/C)GT(T/C) AC-3' and 5'-GA(T/C)-AG(T/C)GG(T/C)AG(T/C)G-

Additional XbaI and Sal1 linkers were added to the 5'-ends of the sense and antisense primers, respectively, to facilitate the subcloning of PCR products. PCR was carried out using a mixture of cDNA template, 0.2 m of each dNTP, 50 pmol of each gel-purified primer, and Thermus aquaticus DNA polymerase (Tq polymerase, Perkin-Elmer Cetus), in 10 IMI Tris-HC1, pH 8.3, 50 m KCl, 1.5 m MgCl,, 0.01% gelatin. The thermal cycles were as following: denaturation at 94 "C (3 min for the first cycle and 1 min for all subsequent 30 cycles), annealing at 45 "C (2 min), and extension at 72 "C (5 min fo'; the first cycle and 3 min for subsequent cycles). The PCR products were resolved on a 1.2% agarose gel and blotted onto a nylon filter. The internal probe was end-labeled with [y-32PlATP (3,000 Ci/mmol) using T4 polynucleotide kinase, then hybridized with the above filter a t 42 "C in 6 x SSC, 0.1% sodium pyrophosphate, 0.1% SDS, 0.1% Denhardt's solution, 50 m Tris-HC1, pH 7.5, and 50 pg/ml denatured salmon sperm DNA. The filter was washed in 2 x SSC, 0.1% SDS a t 42 "C twice each for 20 min and exposed to Kodak X-Omat AR film. The PCR products were cut with restriction enzymes XbaI and SaZI, and subcloned into pGEM7Z (Pro- mega). DNA sequencing was done by the dideoxynucleotide chain ter- mination method (Sanger et al., 1977) using a T7 DNA sequenase kit (U. S. Biochemical Corp.).

cDNA Library Screeniw-The UP11 PCR product was labeled with [(r-32P]dCTP and used to screen a A g t l O cDNA library of bovine bladder epithelium. Approximately 4 x lo6 unamplified recombinant phage were plated, lifted onto duplicate nitrocellulose filters, and hybridized with 32P-labeled probe at 65 "C overnight in 6 x SSPE, 5 x Denhardt's solution, 0.1% SDS, and 100 pg/d denatured salmon sperm DNA. These filters were washed sequentially in 2 x SSC, 0.1% SDS at room temperature twice each for 30 min and in 1 x SSC, 0.1% SDS at 65 "C twice each for 20 min, then autoradiographed at -70 "C overnight. The cDNA inserts of positive phage were subcloned into EcoRI-digested pGEM7Z and sequenced. Computer programs used for searching the EMBL/GenBankTM sequence database (release 77) and for secondary structure analysis were from the GCG7 package (University of Wiscon- sin, Madison) and DNA STRIDER (version 1).

Northern Blot Analysis-Twenty micrograms of total RNA were size- fractionated on a 1.2% agarose, formaldehyde gel, and transferred onto a nylon membrane (Hybond, Amersham Corp.). This was probed with a 710-bp BglII-EcoRI DNA fragment of cDNA clone 3 (see "Results") at 42 "C overnight in 50% formamide, 5 x SSPE, 2 x Denhardt's solution, 0.1% SDS, and 50 pg/ml denatured salmon sperm DNA. The membrane was then washed in 1 x SSC, 0.1% SDS at room temperature for 20 min and in 0.2 x SSC, 0.1% SDS at 60 "C twice each for 20 min. After

and 5"GGTCGACAG(A/G)TA(A/G)CT(A/Gm)AT(A/G)-TA(A/G)TA-3',

G(T/C)'IT(T/C)AC(T/C)GT (T/C)AC-3'.

Urothelium-specific Expression of Uroplakin I1 1777

a

a

a

S 1

b. C. mAU

(7.5kD) "C1 "C2

(6.0kD)

1 2 1 0 20 30 4 0 5 0 60 7 0 80 T f m e ( m f n . )

bovine bladder epithelium, and the three uroplakins (I, 11, and 111) were resolved by preparative SDS-PAGE (lane 1 ) . S denotes standard protein FIG. 1. Isolation of CNBr and tryptic peptides of bovine uroplakin II. a, electrophoretic separation of uroplakins. AUMs were purified from

markers with molecular masses of 66, 45, 36, 29, 24, 20, 17, 14, 8.2, 6.2, and 2.5 kDa (marked with dots from top to bottom). UP11 was electrophoretically transferred onto a sheet of PVDF Immobilon and N-terminal sequenced. 6 , CNBr cleavage of UPII. Lanes 1 and 2 show the gel-purified UP11 before and after its cleavage by CNBr, respectively, as resolved on a Tricine SDS-gel. Note the two major fragments, labeled C l (7.5 kDa) and C2 (6.0 m a ) . c, tryptic peptides. UP11 on a preparative SDS-polyacrylamide gel was electrophoretically transferred onto a nitrocellulose paper, and digested in situ with trypsin. The released tryptic fragments were separated by reverse phase HPLC, and the N-terminal sequences of the peptides in the two main peaks, TI and 2 2 , were determined.

autoradiography, the probe was removed by washing (Sambrook et al., 1989) and the membrane rehybridized with a human p-actin cDNA probe.

RNase Protection Assay-A pair of primers was used to generate by PCR a portion of the UP11 cDNA (nucleotide 268-550, see Fig. 5). This fragment was subcloned into pGEM4Z, sequenced, and lineralized with XbaI. In vitro transcription was performed using SP6 RNA polymerase (Ambion) to synthesize an antisense RNA probe uniformly labeled with [u-~~PIUTP. Ten micrograms of total RNA were mixed with the probe, heated a t 85 "C in the hybridization buffer (80% formamide, 40 m~ PIPES, pH 6.7, 0.4 m~ NaCl, and 1 m~ EDTA), and subsequently hybridized overnight at 45 "C. The hybrids were then treated with a mixture of 2 pg/ml of RNase T1 and 40 pg/ml of RNase A for 60 min a t 30 "C, followed by incubation with 0.1 mg/ml proteinase K in 0.5% SDS a t 37 "C for 15 min. After phenollchloroform extraction and ethanol precipitation, the samples were electrophoresed on a 6% polyacrylamide, 8.3 M urea gel followed by autoradiography. The molecular weight markers used were 32P-end-labeled Hinff fragments of pBR322 DNA.

In Vitro IFanslation lIFanslocation Assay-The UP11 cDNA (clone 1; see "Results") in pGEM7Z was used to transcribe a capped mRNA using a Riboprobe Kit (Promega) and m7G(5')ppp(5')G (Pharmacia). Transla- tion was performed in a nuclease-treated reticulocyte lysate (Promega) at 30 "C for 60 min in the presence or absence of canine pancreatic microsomes (Promega) (Yu et al., 1989). In deglycosylation assays, the translation products were boiled in 1% SDS for 3 min, then incubated with 100 mU/ml of endoglycosidase H a t 37 "C for 16-20 h in 150 m~ sodium citrate, pH 6.0, 0.2% SDS, and 2 m~ phenylmethylsulfonyl fluoride. In post-translational assays, microsomes were added after the translation reaction was terminated by puromycin, and the incubation was continued for 60 min. In protease protection assay, the translation/ translocation reaction mixture was supplemented with CaClz and proteinase K to a final concentration of 2 m~ and 100 pg/ml, respectively, then incubated on ice for 60 min. In some cases, Triton X-100 was added to the proteolysis reaction mixture to a final concentration of 0.5%. The proteolysis reaction was terminated by adding 3 m~ phenylmethylsulfonyl fluoride. Labeled translation products were separated on a 14% polyacrylamide gel and detected by autoradiography.

Zkansient Expression in COS Cells-A full-length UP11 cDNA was cloned into pRK5, a mammalian expression vector containing a cytomegalovirus promoter and a SV40 origin of replication (Hu et al., 1992).

Five micrograms of this DNA construct were transfected into 50% con- fluent COS cells in a 10-cm dish using the DEAE-dextran method (Sam- brook et al., 1989). Two days after DNA transfection, cells were lysed and boiled in SDS sample buffer. Aliquots of total cell lysates were analyzed by SDS-PAGE and electroblotted onto a nitrocellulose filter. Blots were blocked with 3% bovine serum albumin in phosphate-buffered saline (pH 7.2) at room temperature for 2 h and then incubated with a primary antibody (no. 044, a rabbit polyclonal antiserum raised against a synthetic UP11 peptide-DSGSGFTVTRLLA; diluted 1500 with phosphate-buffered saline) a t 4 "C overnight. After three washes in phosphate-buffered saline containing 5% "dry milk" and 0.05% Tween-20 (each for 20 min), the filters were incubated with a secondary antibody (peroxidase-conjugated goat anti-rabbit antibody, 1:3,000 di- lution; Bio-Rad) at room temperature for 1 h. The filters were washed three times (20 min each) and finally developed in 3',3'-diaminobenzi- dine and H202.

Southern Blot Analysis of Genomic DNAs-High molecular weight genomic DNAs were isolated from livers of several species by standard methods (Sambrook et al., 1989). Eight micrograms of each DNA were digested with appropriate restriction enzymes at 37 "C for 16 h, size- fractionated on a 0.7% agarose gel, and transferred to a nylon filter (Hybond, Amersham Corp.). Hybridization was carried out using the same probe as described for the Northern blot analysis at 55 "C in 6 x SSC, 5 x Denhardt's solution, 0.5% SDS, and 100 pg/d denatured salmon DNA. The filters were washed in 2 x SSC, 0.1% SDS a t room temperature for 20 min and in 0.2 x SSC, 0.1% SDS at 55 "C twice each for 30 min. The filters were then processed for autoradiography.

RESULTS

Partial Amino Acid Sequences of Uroplakin ZZ-To determine the partial amino acid sequences of UPII, we separated the three major uroplakins of bovine AUM plaques by SDS-PAGE (Fig. l a ) and N-terminal sequenced the 15-kDa Up11 (Fig. 2, sequence 1 ). Cleavage of UP11 with CNBr yielded two peptides ( C l , 7.5 kDa and C2,6.0 kDa; Fig. l b ) both possessing the same N-terminal sequence as the intact UP11 (Fig. 2, sequences 2 and 3 1. To generate internal sequences, we resolved the tryptic peptides of UP11 by high pressure liquid chromatography (Fig. IC), and determined the N-terminal sequences of the two major

1778 Urothelium-specific Expression of Uroplakin II SI

1. NHrUPII E L V S f i S G S G F d R L i A - 2. c1 ELVSVVDSGSGF- 3. c2 ELVSV-

4. TI-a ELVSVVDSGSGFTVT-

5.T1-b ~ L V T K

6. T2-a LIPYS&GTK

PROBE

7.T2-b ES-R rl r 11

As3

FIG. 2. Partial amino acid sequences of bovine uroplakin II. Sequence 1 (NH,-UPII) represents the N-terminal sequence of intact U P 1 1 (Fig. la) . Sequences 2 and 3 are those of the CNBr-generated bands C l (7.5 kDa) and C2 (6.0 m a ) , respectively (Fig. lb); note that they are identical to that of the intact LJF'II. The T1 tryptic peak (Fig. IC) contains two peptide sequences: one of them (TI-a or sequence 4 ) is identical to the N-terminal sequence of intact protein, thus allowing the deduction of the second sequence (TI-b) by subtraction (5). The T2 tryptic peak also yields two sequences, which are tentatively assigned as the "major" (2'2-a; 6) and "minor" ( 2 ' 2 4 ; 7) sequences based on the relative yields of the amino acids. Some of the assignments of the T2-a and T2-b sequences were later found to be erroneous when compared with the cDNA-deduced amino acid sequence; such switches are indicated by two-way arrows. The S1 sequence was used to design a sense primer, and AS1 to AS3 sequences were used to design three antisense primers for PCR (see "Materials and Methods"). The "probe" sequence was used to design an internal oligodeoxynucleotide probe used to iden- tify the UPII-related PCR products by Southern analysis (Fig. 3). Ac- cording to cDNA sequence data, the leucine (L) residue (dotted) toward the end of sequence 1 is actually a serine.

peptide peaks (TI and 2 2 ) . The T1 peak contained a mixture of two sequences. Since one of them (T I -a ) was again identical to the N-terminal sequence of intact molecule (Fig. 2,4), its subtraction from the mixed sequences yielded a new internal sequence (5). The T2 peak also contained two sequences, which we tentatively assigned as being the "major" (T2-a, 6) versus "minor" (2'24, 7) sequences according to the relative yields of individual amino acids during each sequencing cycle (see later).

Molecular Cloning of UPII cDNA-Based on these amino acid sequences, we designed a sense oligodeoxynucleotide primer (Sl) and three antisense primers (AS1-3; see Fig. 2) which were used to perform PC% using bovine bladder uro- thelia1 cDNA as a template (Fig. 3a). One of the primer pairs (Sl/ASl) yielded a 125-base pair (bp) PCR product, which was recognized specifically by an internal oligodeoxynucleotide probe (Figs. 2 and 3a'). We therefore cloned and sequenced this PCR product. The fact that it encodes two of the partial amino acid sequences shown in Fig. 2 (1 and 5) and that it recognizes a 1.2-kb urothelium-specific mRNA in Northern blot (Fig. 3b) demonstrates that it is a partial UP11 cDNA. To isolate full-length UP11 cDNA, we used this cloned PCR

product to screen a bovine urothelial A g t l O cDNA library and obtained four positive clones with different insert sizes (Fig. 4). Sequencing of all these clones established that they represent overlapping clones of the same cDNA. By combining these sequences, we obtained a UP11 cDNA sequence of 1061-bp that contains a single open reading frame of 185 amino acids (Fig. 5). "he predicted 5'-ATG initiation codon (starting at nucleotide 113) lies in a favorable context for eukaryotic translational initiation (Kozak, 1984,1986) and is preceded by an upstream, in-frame stop codon. The 3"untranslated region contains a consensus polyadenylation site (Proudfoot and Brownlee, 1976) and ends with a poly(A) tract. These results, together with fact that the length of the cDNA is almost the same as that of the UP11 mRNA (1061 bp versus -1.2 kb), strongly suggest that our cDNA is nearly full-length.

The protein encoded by Up11 cDNA has a calculated molecular mass of 19,606 daltons. It has a long N-terminal prepro- sequence of 85 amino acid residues preceding the mature 15- kDa UP11 of 100 residues (Fig. 5). Several lines of evidence support the authenticity of this cDNA-predicted amino acid

a. bP

492-

369-

246-

123-

M 1 2 3 1 2 3

c

b. kb

- 7.5 - 4.4

- 2.37

- 1.35

1 2

product of UPII. PCRs were performed using bovine bladder epithe- FIG. 3. Generation of a sequence- and urothelium-specific PCR

lial cDNA as a template. The S1 sense primer was combined with three

3) . Panel a shows the ethidium bromide staining pattern of the PCR different antisense primers: AS1 (lane 1 ), AS2 (lane 2), and AS3 (lane

products. Panel a' shows the hybridization pattern of these products with a 32P-labeled, internal oligodeoxynucleotide probe (see Fig. 2). Note the strong hybridization signal of a 124-bp PCR product (arrow, lane 1 ofpanel a') , which was cloned and sequenced. Panel b, Northern blot showing that this 124-bp PCR product detected a 1.2-kb mRNA (arrow) in bovine bladder epithelium (lane 1 ) but not in esophageal epithelium (lane 2).

sequence. First, its mature region can account for all the known partial amino acid sequences of the purified UP11 polypeptide, including the "corrected" sequences 6 and 7 (Figs. 2 and 5). Second, since the methionine-serine bond is known to be rather resistant to CNBr-cleavage (Stone et al., 1989), the incomplete cleavage of the Met41Ser42 bond could account for the generation of the C1 and C2 CNBr-fragments (Fig. l b ) which share the N-terminal sequence of mature UPII. Consistent with this interpretation, the calculated molecular masses of the two predicted CNBr-fragments (Fig. 6b) are in excellent agreement with those of C1 and C2 peptides as determined by SDS-PAGE. Finally, immunoprecipitation of in vitro translated products of bovine urothelial mRNA (but not esophageal epithelial mRNA) using an antiserum against UP11 yielded a 19-kDa product, which co-migrated on SDS-PAGE with the in vitro transcribed translated product of UP11 cDNA (data not shown; also see later).

UPII Precursor Contains l b o Hydrophobic Domains and Is Endoproteolytically Processed-The deduced amino acid sequence of UP11 cDNA has several interesting features. The hydropathy plot (Fig. 7a) revealed that the UP11 precursor has two stretches of hydrophobic amino acids, one located at the N terminus and the other very near the C terminus. According to the weighted matrix algorithm and the "-1/-3" rule of von Heijne (19861, the former can potentially serve as a signal peptide ("pre-sequence") with the cleavage site located between Ala-60 and Asp-59; Fig. 5). The C-terminally located hydrophobic domain of 25 amino acid residues is long enough to span the lipid bilayer and to serve as a transmembrane domain (Kyte and Doolittle, 1982; Klein et al., 1985). This suggests that UP11 is an integral membrane protein anchored to the plasma membrane at its C terminus with the bulk of the molecule exposed extracellularly. Three potential sites for asparagine-linked oligosaccharides are found in the UP11 precursor, all of which are located in the pro-region (Figs. 5 and 7). This is consistent with the fact that the mature UP11 polypeptide chain is not N-glycosylated, as suggested by its resistance to endoglycosidase H

Urothelium-specific Expression of Uroplakin 11 1779

a. P MATUREPROTEIN 1 S S B , 1oobp I

[Aln U

SP b.

PCR-1 I I I 1 I I 1

I I 1 I I 1 I 1

2

C.

4

b

FIG. 4. Cloning and sequencing strategies of UP11 cDNA. a, schematic representation of UP11 cDNA. The coding region (designated by a box) contains two stretches of hydrophobic amino acids (filled boxes); the first probably constitutes a signal peptide (SP) while the second a

P (PstI), B (BarnHI), S (SrnaI), and Bg (BglII). [Aln denotes a poly(A) tail. 6, relationship among various cDNAclones. PCR-I represents the 124-bp transmembrane domain (2"). The pro-sequence is hatched. The 5'- and 3'-flanking sequences are indicated by thin lines. The restriction sites are

PCR product generated using the SVAS1 combination of primers. This PCR product was used to screen a cDNA library and four independent clones ( 1 4 ) were isolated. c, a summary of the sequencing strategy.

68 GAACACAGCTBBGACCTAGCACCCACCCCAGCTCCCAGCCCAGCGATGGCATCTCCG~GCCTGTGTGGACCTTG 1 G A A T T C T G G A G A A T C C C C A T G G A C G G A G G A G C T T G G T G G G C

- 8 5 1 M A S P W P V W T L

of UPII cDNA and its deduced amino FIG. 5. Deoxynucleotide sequence

acid sequence. The N-terminal amino acid residue of the mature UP11 protein is designated as + I . Its preceding RGRR se-

furin-like enzyme, is bold-faced. The four quence, the putative cleavage site for a

stretches of deduced amino acid residues which match precisely with those shown in Fig. 2 are marked by dashed under- lines. The two major CNBr-cleavage sites giving rise to the C1 and C2 peptides (Fig. lb) are marked by arrows. Three potential N-glycosylation sites, all located in the pro-region, are circled. The N-terminal potential signal sequence and the membrane-anchoring domain near the C terminus are boxed. A 5"upstream stop codon (TAA) and a 3"potential polyadenylation site (AATAAA) are underlined. The accession number of this sequence in G e n B a n k T M is L20633.

143 TCTTGGATCCTGATTCTGCn;GCn;TCCTGG'ITCCCGGGGC~CAGCAGGC~ACTTCAACATCTCAAGCCTCTC~GT - 7 5 S W I L I L L A V L V P G A A A l D F @ I S S L S G

218 C T G C T G T C C C C A G T G A T G A C G G A A A G C C T G C T A G T T G C C T G C C A C A - S O L L S P V M T E S L L V A L P P C H L T G G @ A T

293 CTGAC~TCCGGAGAGCAGGCCAATGACAGCAAAG~GTGAGATCTA~TTCG~GTGCCTCCGTGCCGCGGACGCAGG - 2 5 L T V R R A @ D S K V V R S S F V V P P C R O R R

368 GAGCTGGTGAGCGTGGTGGACAGCGGGTC~GC~CACGGTCACCCGGCTCAGTGCATACCAGGTGAC~CC~

+I "_L_"_S__v__v__O__s_~~~~~"~"~"~"~"~~~~"~ y Q v T N L

+26 _A-_P-_G-_T_K Y-Y_2-S-LL-L2-!L G A s T E s s R L I P . 443 GCACCAGGAACCAAATACTACATTTCCTACCTACC~GTGAC~GGGGGCATCCACCGAGTCCAGCAGAGAAATCCCA

"""""""_ 518 ATGTCCACATTTCCTCGAAGAAGGCAGAATCCA~GGCTGGCAATGGCCCGGACAGGGGCATGGTGGTCA~ + 5 1 - h l S T F P R. R K A E S I G L A * A R T G G V

593 A C G G T G C T G C T C T C G G T C G C T A T G T T C C T G C n ; G T T C ' I Y + 7 6 T V L L S V A M F L L V L G L I I A L A L \ G A R K

743 GCTCTTATCTCCACTGCTGAGAAGACGGCCTGCTCCCAGGCCACAGGCACCAGGC~GGATCCGGCAGTGCCATC 668 TGAGGAGGACAGCCCCGGGGAGCAGGCAGCAAGTCCAGCAAGTCCAGGGCACTGTC~~TTCTCAGCCC~GGCTCTGCGTCT

818 A C C T C C C C T C C C T T C T C C A C T A C A G C C C T C T C C T C C A T C C G G C C 893 C A A C A C T C C C T A T T A C T G C C C T C A C C C C A C T C C T G T C A G ~ T T G G ~ ~ ~ C C A T ~ C A C C T C ~ T A A C C G C T

10 43 AAAAAAAAAAAAAAAAAAA 968 CTACCCCTGACAGACAGGAATTT?TCCCCTCCCCCAGTGAA~AGCCCCTAC~GCCTGATGCCACGTTCCTAGC

and N-glycanase F (data not shown). An important feature of the pro-region of UP11 is that it ends with a "RGRR" tribasic sequence. This sequence matches perfectly with the consensus substrate motif of furin-like endoproteases (Barr, 1991; Steiner et al., 1992). The extracellular domain of the mature UP11 polypeptide has an unusually high content of serine and threo- nine (25%), and the N-terminal half of this domain is predicted to form @-sheets (Fig. 7b). Interestingly, the calculated PI (10.8) of the mature UP11 is much higher than those of the other two uroplakin molecules (6.1 for UP1 and 4.7 for UPIII) (Wu and Sun, 1993): which is consistent with our previous isoelectric focusing studies on purified uroplakins (Yu et al., 1990).

UPII Message Is Urothelium-specific-!Ib determine the tissue distribution of UP11 mRNA, we performed Northern blot analysis. A single UP11 mRNA species of 1.2 kb was detected in bladder epithelium, but not in other tissues including several stratified epithelia (snout and esophagus) and simple epithelia (liver, lung, intestine, and kidney; Fig. 8a) . This tissue specificity is maintained in cultured cells, since a messenger RNA of the same size was detected only in cultured bovine urothelial cells, but not in cultured epidermal cells or kidney epithelial

a J. Yu, J.-H. Lin, X.-R. Wu, and T.-T. Sun, manuscript in preparation.

a. Mature UPll 'CNBr CNBr

b. Fragments Tl-8 , TL-a , T1 a, ,X?+, , , ,

I T@c + 4 CNBr-C1 (7.5kD) I 1 CNBr-C2 (6.0kD)

D1 At4 C. Known sequence (Fig. 2) e-

FIG. 6. Schematic diagram showing the relationship among various UPII peptides. Panel a shows the mature UP11 protein in which the putative transmembrane domain is represented by a filled box. Potential cleavage sites for trypsin and CNBr are represented by short and long arrows, respectively; two other CNBr-cleavage sites located in the transmembrane domain are not shown. *CNBr indicates a Met-Ser site which is inefficiently cleaved. Cleavage of Up11 at this site generates the 6.0-kDa C1 peptide, while failure of its cleavage gives rise to the 7.5-kDa C2 peptide. Panel b shows the predicted tryptic and CNBr fragments; most of them have actually been isolated and sequenced. Panel c indicates the positions of all the known UPII-peptide sequences. pl -7 correspond to the peptides listed in Fig. 2.

1780 Urothelium-specific Expression of Uroplakin 11

A

a. Hydrophobicity

-1-

-80 -40 + I +40 +80 A

b. Predicted structure T: M n n n A A

a: - P: - n

FIG. 7. Hydropathy plot and predicted secondary structure of UPII. a, Hydrophobicity plot using a scanning window size of 11 amino acid residues. (Similar results were obtained with a window size of 19 amino acids; Kyte and Doolittle (1982l) A schematic representation of the UPII coding region is shown on top tu facilitate the alignment of various panels. Three N-glycosylation sites are marked by open circles, and the N terminus of mature U P 1 1 is indicated by a closed arrowhead. The numbers at the bottom mark the positions of amino acid residues as shown in Fig. 5 . The sequences in the putative signal peptide and C-terminal transmembrane domain have an average hydrophobicity score of >1.7. b, predicted secondary structure of U P 1 1 based on the method of Garnier et al. (1978). T, CY, and j3 denote the predicted @-turn, a-helix, and Bsheet structures, respectively. Note that the mature U P 1 1 protein contains a relatively high proportion of predicted j3-sheet structures and that a predicted &turn coincides with the tribasic cleavage motif RGRR located at the end of the pro-sequence.

cells (Fig. 8b). To exclude the possibility that UP11 mRNA may be present in low abundance in non-urothelial cells, we performed ribonuclease protection assays. Again, the UP11 mRNA was found to be urothelium-specific, as judged by the specific protection of a 283-bp fragment of the probe (Fig. &). This urothelium-specific distribution of UP11 message is consistent with our immunofluorescence studies demonstrating that UP11 protein is detectable only in the superficial cells of urinary tract epithelia (Wu et al. (1990) and data not shown). Therefore, at both protein and mRNA levels, UP11 expression appears to be restricted to differentiated urothelial cells.

Membrane Insertion and Topology of UPII-As mentioned earlier, the UP11 precursor contains a putative signal peptide and three potential N-glycosylation sites. To examine whether these elements are functional and to determine the membrane topology of UPII, we transcribed the UP11 cDNA and performed translatiodtranslocation assays in the presence of canine pancreatic microsomes (Fig. 9). As expected from the amino acid sequence deduced from UPII cDNA, the primary translation product had an apparent molecular mass of 19-kDa (lane 1 ) . The co-translational addition of microsomes to the translation system resulted in the formation of a slower migrating protein of 28 kDa (lane 2) which, unlike the 19-kDa band, was completely protected from proteolytic digestion (compare lanes 6 and 7). However, solubilization of the microsomal vesicles with a detergent abolished this protection (lane 8), demonstrating that this protected UP11 product is not intrinsically resistant to protease digestion, and that the integrity of microsomal membrane is responsible for this protection. Moreover, endo H treat- ment of the SDS-solubilized 28-kDa protein converted it to a polypeptide of 18 kDa (instead of 19 kDa; compare lanes 3, 4, and 5), suggesting that the former is N-glycosylated and that its N-terminal signal peptide must have been cleaved. Post- translational addition of microsomes failed to generate the N-

glycosylated 28-kDa species indicating that the insertion into the microsomes occurs only co-translationally (lanes 9). As expected, this translation product, which was not translocated, remained sensitive to proteinase K (lane IO). Finally, we con- structed a UP11 mutant which lacked the N-terminal30-amino acid residues. This truncated UP11 failed to insert into microsomes (data not shown), indicating that the N-terminal signal sequence is required for the insertion. Taken together, these data strongly support the view that UP11 is synthesized as a N-glycosylated precursor in the ER, and that the bulk of the polypeptide chain faces the lumen of microsomal vesicles and is therefore protected from added proteases.

Expression of UPII in Dansfected COS Cells-To further characterize the precursors of UPII, we cloned the full-length UP11 cDNA into the expression vector pRK5, which contains a strong cytomegalovirus promoter and a SV40 origin of replication (Hu et al., 1992). Two days after transfecting COS cells with this construct we resolved the expressed proteins by SDS- PAGE and identified UPII-related proteins by immunoblotting using an antiserum raised against a synthetic peptide (DSGSGFTVTRLLA) corresponding to the N-terminal region of mature UP11 protein. As shown in Fig. loa, the transfected COS cells expressed two major proteins: a 18-kDa UP11 precursor and an N-glycosylated 28-kDa form. The 28-kDa polypeptide was endo H-sensitive (Fig. lob), like the in vitro translatedtranslocated species (Fig. 9). These results clearly show that the 28-kDa protein contains high mannose type oligosaccharides that are co-translationally added in the ER to the newly synthesized UP11 polypeptide. Two minor bands (-23 and -26 kDa) represent most likely pro-UP11 polypeptides containing one or two high mannose oligosaccharides. Since all these polypeptides (18, 23, 26, and 28 kDa) are recognized by an antiserum against a segment of the mature UPII, but are larger in size, they are clearly UP11 precursors. Inter- estingly, as was the case for the microsomal experiment (Fig. 91, the mature 15-kDa polypeptide was not formed in these transfected cells (Fig. lOa, lane I ; see "Discussion").

UPII Is Encoded by a Single Copy Gene and Is Highly Con- served-To determine the copy number of UPII-related genes, we digested bovine genomic DNA with different restriction enzymes and probed these DNA fragments with UP11 cDNA. In most cases, only one restriction fragment was detected (Fig. 11) indicating that UPII is probably encoded by a single copy gene. This conclusion is consistent with our recent finding that a single UP11 gene was localized on bovine chromosome 15 (Ryan et al., 1993). In another experiment, we showed that the same UP11 cDNA probe strongly cross-hybridized with the genomic DNAs from human, cow, sheep, dog, rat, and mouse (Fig. 121, suggesting an evolutionary conservation of UP11 sequence.

DISCUSSION

In this report we describe the cloning and characterization of cDNAs encoding a 15-kDa integral membrane protein, uroplakin 11, which is a unique differentiation product of urinary bladder epithelium. Like uroplakins I and 111, UP11 is a major protein component of the asymmetric unit membrane plaques that cover the luminal surface of terminally differentiated uro- thelia1 cells (Wu et al., 1990; Yu et al., 1990). The cDNA-deduced amino acid sequence revealed that UP11 is first synthesized as a 19-kDa precursor containing a cleavable signal peptide of 26-amino acid residues, a long pro-sequence of 59 residues, and a mature UP11 of 100 residues. The authenticity of our Up11 cDNA and its deduced amino acid sequence is supported by the fact that it can account for all known partial amino acid sequences of purified UP11 (Fig. 5), for the CNBr- and trypsin-cleavage patterns of UP11 (Figs. 5 and 6) , and for the sizes of UP11 primary translation product and its various

Urothelium-specific Expression of Uroplakin 11 1781

a. m 114 m I

I I 1 2 3 4 5 6 7 8 9 1 0

C. 5' ..,-,.. 3

e 3 0 2 nt j( K 2 8 3 ntJ(

1 2 3 4 M P 1 2 3 4 5 FIG. 8. Urothelium-specific distribution of UP11 messenger RNA. Panel a , shows a Northern blot analysis of RNAs from different bovine

tissues. Total RNAs (20 pg) from bladder epithelium (lane 1 ), esophageal epithelium (2), snout epithelium (3), kidney (4 ) , intestinal epithelium (5) . liver (6), lung (7), heart (8), brain (9), and prostate (10) were separated on a 1.2% agarose formaldehyde gel, transferred onto a nylon filter, and hybridized with a UP11 cDNA probe (21). f i r autoradiography, the blot was washed and rehybridized with a p-actin probe (A). Panel b shows the Northern blot of RNAs from cultured cells, including bovine urothelial cells (lane 11, human bladder carcinoma cell line RT4 (2), human epidermal keratinocytes (3). and human kidney 293 cell line (4 ) . The molecular sizes marked on the right side are 1.77, 1.52, 1.28,0.78, and 0.53 (kb, from top to bottom). Panel c shows an RNase protection assay. A302-bp antisense riboprobe (P) encompassing a part of UP11 coding region was hybridized with total RNAs of bovine bladder epithelium (lane 1 ), esophageal epithelium (2 ), lung (3). and brain ( 4 ) ; tRNA served as a negatlve control (lane 5). Perfect annealing of UP11 mRNA with the riboprobe results in the protection of a 283-bp fragment. M denotes the size markers, which are 517606, 396, 344, 298, and 220/221 bp in length (from top to bottom).

l l + ( 1 2 3 4 5 6 7 8 9 1 0 kD

- 2% ~

2 ' 9 -1%

- 15

" + - + - + + + + p " " + + + - + EH - - + + " " _ T X - - - - "

I +, I- -, C.T. P.T.

FIG. 9. Insertion of the in v i t r o transcribedtranslated UP11 into microsomal vesicles. Full-length UP11 mRNA was generated by the in vitro transcription of a UP11 cDNA cloned into a pGEM7Z vector, and was translated in a reticulocyte lysate (lanes I and 2) . Transloca- tion assays were carried out by adding canine pancreatic microsomes (M) co-translationally (C.T.; lanes 2.4, 7, and 8 ) or post-translationally (PT; lanes 9 and IO). Samples were analyzed by SDS-PAGE, either directly (lanes 1,2 , and 9 ) or after various treatments including endoglycosidase H (EM, lanes 3 , 4 , and 5), proteinase K (P; lanes 6, 7, and 10). or proteinase K plus detergent solubilization (0.5% Triton X-100, W, lane 8 ) as indicated. The sample in lane 5 is a mixture of those of lanes 3 and 4. Lanes 3 , 4 , 5 , 9 , and 10 were exposed for a shorter time than other lanes. Note the complete conversion of the 19-kDa primary translation product (upper arrowhead) by the microsomes to a 28-kDa glycosylated form. Also note that deglycosylation of this 28-kDa species revealed a 18-kDa core proteins (lower arrowhead), which migrates slightly faster than the 19-kDa primary translation product suggesting the removal of the signal peptide.

processed forms (Figs. 9 and 10). Computer search of the EMBUGenJ3ankTM database showed that UP11 has no signifi- cant sequence similarity with any known proteins.

Uroplakin ZZ Has a Cleavable Signal Peptide-The N terminus of the UP11 precursor contains a cleavable signal peptide (boxed in Fig. 5) of 26 largely hydrophobic amino acids. Starting from the putative cleavage site, both the -1 and -3 positions are occupied by alanine thus fulfilling the "-1/-3" rule which states that the side chains of the amino acids in these two

p-UPII'f

1 2 3 4 7:'r p-UPII**

p-UPII'f

p-UPII -b rq -19 -

m-UP11 "15 -

- - 1 2 3 4 1 2 1 2

e

l-

COS cells. a , COS cells transfected with either the pRK5-UP11 (lane I FIG. 10. Detection of several UPII precursors in transfected

and 4 ) or with the pRK5 vector only (lane 3) were lysed in SDS-sample buffer, and aliquots of the lysates were resolved by SDS-PAGE. The mature purified AUM plaques were served as a reference (lane 2). UPII-related proteins were detected by immunoblotting using an antiserum raised against a UPII peptide; the immunodetection was done in the absence (lanes 1-3) or presence (lane 4 ) of a neutralizing amount of the peptide antigen. Note the detection of a fully glycosylated UP11 precursor (p-UPZI**; 28 ma), two partially glycosylated ones (p-UPII*; 25 and 23 m a ) , and an unglycosylated core protein (p-UPIk 18 kDa). All these bands are immunologically related to, but larger than, the mature UP11 (m-UPII). b, the 28-kDa UP11 precursor protein contains high mannose-type N-linked oligosaccharides. The cell lysates from UP11 cDNA-transfected COS cells were treated with (lane 2) or without

Note that deglycosylation with endo H quantitatively converted the (lane I ) endoglycosidase H, then analyzed by immunoblotting as above.

28-kDa precursor (large arrow) to the 18-kDa p-UP11 (small arrow).

positions have to be small (von Heijne, 1986, 1988). The -5 position is occupied by a proline which is known to be over- represented in positions -6 to -4 and may favor the cleavage reaction. The +1 position, which is usually occupied by a charged or polar residue, contains an aspartic acid. Although these considerations strongly suggest that the signal peptide is cleaved atAla-60-Asp-50, additional data are needed to confirm this prediction. Regardless of the precise site of cleavage, the functionality of this signal peptide is shown by the fact that the primary translation product of Up11 can insert efficiently in vitro into dog pancreatic microsomes, but deletion of the first 30 amino acid residues abolishes this insertion. Moreover, our in vitro translocation data indicate that this signal peptide is most

1782 Urothelium-specific Expression of Uroplakin II

1 2 3 4 5 6 7 8 9 1 0 FIG. 11. Southern analysis suggests that UPII is encoded by a

single-copy gene. High molecular weight bovine genomic DNA was

PstI, ( 3 ) XbaI, ( 4 ) XhoI, (5) Sad, (6) SaZI, (7) KpnI, (8) EcoRV, (9) digested with various restriction enzymes including (lane I ) EcoRI, (2)

EcoRI + XbaI, and (IO) EcoRI + XhoI. The DNA fragments were size- fractionated on an agarose gel and hybridized under stringent conditions with 32P-labeled Up11 cDNA. Note that in nearly all digestions only one UPII-related DNA fragment was detected.

kb

-23.0

- 9.4

- 6.5

- 4.4

- 2.3

1 2 3 4 5 6 FIG. 12. Detection of UPII-related genomic sequences in diffep

ent mammals. Genomic DNAs from cattle (lane 1 ), human (2), sheep ( 3 ) , dog ( 4 ) , rat (5), and mouse ( 6 ) were digested with EcoRI analyzed by Southern blot using a bovine UP11 cDNA as a probe (see "Materials and Methods"). Note the detection of UPII-related sequences in all mammalian genomic DNAs tested.

likely cleaved upon the translocation of UP11 into the ER lumen (Fig. 91, suggesting that it is a good substrate for signal pepti- dase.

Glycosylated Pro-sequence of UPII May Play a Role in Regu- lating AUM Assembly-A unique feature of UP11 is that, in addition to having a pre-sequence (the signal peptide), it also contains a long pro-sequence of 59 amino acid residues. In contrast, there is no evidence that the 27-kDa uroplakin I and 47-kDa uroplakin I11 contain pro-regions (Wu and Sun, 1993h2 This rather long UP11 pro-sequence contains three potential

N-glycosylation sites, a t least some of which are known to be glycosylated resulting in a shift in the electrophoretic mobility corresponding to up to 10 kDa (Figs. 9 and lob). Although the function of this pro-sequence is unknown, we have shown pre- viously that only the mature 15-kDa UP11 is present in AUM plaques (Wu et al., 1990) and has the ability to associate in uitro with the 27-kDa uroplakin I (the AE31 antigen) (Yu et al., 1990). This suggests that the pro-sequence of UP11 may be involved in preventing the interaction or oligomerization of the UP11 precursor with itself andor with other uroplakins. If such interactions occur precociously, they can result in the deleteri- ous formation of highly insoluble protein aggregates in the rough ER or in the Golgi apparatus.

It is noteworthy that the pro-sequence of UP11 ends with RGRR, which precedes immediately the known N terminus of the mature UPII. This sequence fits perfectly the consensus substrate site (Arg-X-Lydkg-kg) of furin-like endoproteases (Roebroek et al., 1986; Barr, 1991; Hosaka et al., 19911, and it is located in a predicted p-turn (Fig. 76) which may enhance its accessibility to the enzyme. This type of endoprotease is known to be involved in cleaving the pro-sequence of a large number of protein precursors including peptide hormones, viral envelope proteins, and membrane proteins (Barr, 1991; Hosaka et al., 1991; Steiner et al., 1992), and it has been localized in the Golgi apparatus of many cells (Bresnahan et al., 1990; Misumi et al., 1991). Although such a localization implies that the cleavage of UP11 pro-sequence occurs in the Golgi apparatus, we cannot rule out the possible involvement of a specific endoprotease that functions in post-Golgi vesicles.

Although cultured bovine urothelial cells can process the UP11 precursor to yield the 15-kDa mature protein (Yu et al., 19901, the proteolytic removal of the pro-sequence did not occur under two experimental conditions. The insertion of in uitro translated UP11 into dog pancreatic microsomes resulted in the formation of a 28-kDa N-glycosylated precursor (Fig. 9). The failure to further process this 28-kDa protein by the microsomes is perhaps not surprising because furin-like endoproteases are known to exist in Golgi apparatus but not in the rough ER. It is less clear why this endoproteolytic processing also did not function in COS cells transfected with UP11 cDNA (Fig. loa). It does not seem to be due to a lack of furin-like enzymes in these cells because, in a control co-transfection experiment (data not shown), COS cells were found to be able to process efficiently a receptor protein tyrosine phosphatase K whose pro- sequence also contains a similar cleavage motif (Jiang et al., 1993). I t is also unlikely to be due to the overexpression of UP11 that overwhelmed the furin system, since UP11 expressed at a low level in transiently transfected HeLa or Madin-Darby canine kidney cells was also arrested a t the stage of a 28-kDa glycoprotein precursor (data not shown). Since the assembly of protein complexes usually occurs in the ER, the absence of uroplakins I and I11 may prevent the uroplakin I1 from leaving the ER (see, e.g. Bonifacino et al. (19891, Claudio et al. (19891, and Hurtley and Helenius (1989)). This interpretation is supported by the fact that the 28-kDa UP11 precursor remains endo-H-sensitive (Fig. lob), as may be expected for the ER-type oligosaccharides. We plan to test this hypothesis by co-transfecting COS cells with cDNAs encoding UP11 plus one or both of the other two uroplakins to determine whether this will result in the proper processing of pro-UPII.

Correlation between UPII Topology and the Thickened Outer Leaflet of AUM-The deduced amino acid sequence of UP11 cDNA reveals a stretch of 25 hydrophobic amino acids located close to its C terminus, that may provide a membrane anchor. This feature, however, raises the possibility that the mature UP11 is attached to the membrane via glycosylphosphatidylinositol (Ferguson and Williams, 1988; Low, 1989; Cross, 1990).

Urothelium-specific Expression of Uroplakin I1 1783 Such a modification can account for the hydrophobicity of UPII, and can potentially serve as a dominant signal for targeting the molecule to the apical epithelial surface (Lisanti and Rod- riguez-Boulan, 1990). Our experimental evidence suggests, however, that the C-terminal hydrophobic domain of UP11 is retained as a membrane-anchoring element because metabolic labeling of cultured bovine urothelial cells with L3H]ethanol- amine did not label the mature 15-kDa UPII, and that UP11 located on the luminal surface of cultured bovine urothelial cells cannot be released by glycosylphosphatidylinositol-specific phospholipase C (data not shown).

Our results therefore strongly suggest that UP11 molecule is anchored to the lipid bilayer via its C-terminal transmembrane domain, while the major, largely hydrophilic (N-terminal) domain is exposed on the extracellular face of the urothelium. Such a type I (NexJCcw) configuration is supported by several lines of evidence. Ultrastructural localization studies indicate that all the UP11 epitopes recognized by our polyclonal antibodies are on the extracellular side of apical AUM (Wu et al., 1990). Such a topology is also consistent with our finding that the insertion of UP11 into dog pancreatic microsomes results in its complete protection from proteolytic digestion, suggesting that the bulk of its sequence faces the lumen of microsomal vesicles (Fig. 9). Moreover, the UP11 precursor is heavily N- glycosylated (Figs. 9 and 10). Given the fact that all the N- glycosylation sites are located in the N-terminal pro-sequence region of UP11 (Fig. 7) and that the transfer of high mannose oligosaccharides to asparagine residues occurs exclusively in the lumen of ER (Hirschberg and Snider, 19871, the N-glycosylated pro-sequence region of UP11 must be located in the lumen. Finally, the cleavage of pro-sequence at the RGRR site most likely involves a furin-like endoprotease. Since furin is localized in the lumen of Golgi apparatus, this strongly suggests that the N-terminal domain of the mature UP11 faces the lumen of endomembrane system and later becomes exposed extracellularly on the cell surface.

As predicted by the algorithms of both Gamier et al. (1978) (Fig. 76) and Chou and Fasman (19781, the N-terminal portion of mature UP11 is enriched in p-sheet structures, which could potentially influence the tertiary structure as well as the oligomerization of uroplakin I1 (Varghese et al., 1983; Gennis, 1989; Cowan et al., 1992).

It has been shown that the thickened appearance of the outer leaflet ofAUM is due to the 12-nm protein particles (Caruthers and Bonneville, 1980). In this regard, it is interesting that UP11 has an extremely high extracellular/intracellular mass ratio. This feature is shared by the other two major AUM proteins, i.e. the uroplakins I and I11 (Wu and Sun, 1993).' Such an asymmetrical mass distribution of all three major AUM proteins could be responsible for the asymmetrical appearance of the two leaflets of AUM.

Synthesis and Processing of UPZZ-Although it has been proposed that the assembly of AUM plaques occurs in the Golgi apparatus (Hicks, 1966, 1975; Koss, 1969), it has also been suggested that this step occurs in the post-Golgi fusiform vesicles involving the free polysomes found in close proximity to the Golgi apparatus and these vesicles (Severs and Hicks, 1979; Alroy et al., 1982). Therefore, the precise location and the mechanisms ofAUM assembly remain controversial. Our study on the synthesis and processing of UP11 clearly shows that (i) this major protein component ofAUM plaques has a functional signal peptide which is cleaved when the UP11 precursor is inserted into the rough ER, (ii) it adopts a type I configuration (NexJCcw) and the luminally located pro-sequence is N-glycosylated, and (iii) the removal of the UP11 pro-sequence may involve a furin-like endoprotease of the Golgi apparatus. Taken together, these results demonstrate that UP11 is synthesized by

membrane-bound polysomes and is processed via the endomembrane system. Our results, of course, cannot exclude the possible involvement of some post-Golgi events, such as the synthesis of other minor AUM protein components by free polysomes or the interactions between AUM plaques and the cytoskeleton, in regulating certain later steps of AUM assembly.

Bladder-specific and Differentiation-dependent Expression of UPZZ Gene-Although the detailed function of UP11 is unknown, its tissue specificity and its evolutionary conservation indicate that it is a functionally important component of the terminally differentiated cells of mammalian urothelium, most likely through its involvement in the formation of AUM plaques. Our observation that only the mature UP11 is present in AUM and can associate in vitro with other uroplakins suggests that UP11 processing is a key step in regulating AUM assembly. "he availability of UP11 cDNA and genomic clones, the establishment of a well differentiated cell culture system capable of synthesizing and processing all three uroplakins (Surya et al., 1990; Wu et al., 1990; Yu et al., 1990), and the tissue-specific and differentiation-dependent expression of UP11 make this highly conserved AUM protein an important model system for studying urothelial-specific gene expression as well as the molecular basis for the differentiation-dependent regulation of membrane assembly.

AcknowZedgments-Our sincere thanks go to William Lane of the Harvard Microchemistry Facility for his expert assistance in generating the partial amino acid sequences. We also thank Jun Yu, Michael O'Guin, and Pamela Cowin for stimulating discussions and critical reading of the manuscript. Finally, we thank Irwin M. Freedberg and Pablo Morales for their continued interest and support.

REFERENCES

Aebersold, R. H., Leavitt, J., Daavefra, R. A., Hood, L. E., and Kent, S . B. H. (1987)

Alruy, J., and Weinstein, R. S . (1980)Anat. Rec. 197, 7-3 Alroy, J., Merk, F. B., Morre, J., and Weinstein, R. S . (1982) Anat. Rec. 203,

Barr, P. J. (1991) Cell 66.1-3 Bonifacino, J. S., Suzuki, C. K., Lippinocott-Schwartz, J. , Weissman, A. M., and

Bresnahan, P. A,, Leduc, R., Thomas, L., Thorner, J., Gibson, H. L., Brake, A. J.,

Brisson, A,, and Wade, R. H. (1983) J. Mol. Biol. 166,21-36 Caruthers, J. S. , and Bonneville, M. A. (1977) J. Cell Biol. 73, 382-399 Caruthers, J. S . , and Bonneville, M. A. (1980) J. Ultrastruct. Res. 71,28%302 Chou, P. Y., and Fasman, G. D. (1978)Adu. Enzymol. 47,45148 Claudia, T., Paulson, H. L., Green, W. N., Ross, A. F., Hartman, D. S. , and Hayden.

Cowan, S . W., Schirmer, T., Rummel, G., Steiert, M., Ghosh, R., Pauptit, R. A..

Cross, G. A. M. (1990)Annu. Reu. Cell Biol. 6, 1-39 Ferguson, M. A. J., and Williams, A. F. (1988) Annu. Reu. Biochern. 57, 285320 Gamier, J., Osguthorpe, D. J., and Robson, B. (1978) J. Mol. Biol. 120, 97-120 Gennis, R. B. (1989) Biomernbrane: Molecular Structure and Function, Springer-

Hicks, R. M. (1965) J. Cell Biol. 26, 25-48

Hicks, R. M. (1975) Biol. Rev. 50, 21-6 Hicks, R. M. (1966) J. Cell Biol. 3 0 , 6 2 3 4 3

Hicks, R. M., and Ketterer, B. (1969) Nature 224, 1304-1305 Hicks, R. M., and Ketterer, B. (1970) J. Cell Biol. 45, 542-553

Hosaka, M., Nagahama, M., Kim, W.-S., Watanbe, T., Hatauzawa, K., Ikemizu, J., Hirschberg, C. B., and Snider, M. D. (1987)Annu. Reu. Biochem., 58, 6 3 4 7

Murakami, K., and Nakayama, K. (1991) J. Biol. Chem. 286, 12127-12130 Hu, P., Margolis, B., Skolnik, E. Y., Lammers, R., Ullrich, A., and Schlessinger, J.

(1992) Mol. Cell. Biol. 12, 981-990 Hurtley, S . M., and Helenius, A. (1989) Annu. Reu. Cell Biol. 5, 227307 Xiang, Y.-P., Wang, H., D'Eustachio, P., Musacchio, J. M., Schlessinger, J. , and Sap,

Ketterer, B., Hicks, R. M., Christodoulides, L., and Beale, D. (1973) Biochim.

Knutton, S. , and Robertson, J. D. (1976) J. Cell Sci. 22,355370 Klein, P., Kanehisa, M., and DeLisi, C. (1985)Biochim. Biophys. Acta 815,46&476

Koas, L. G. (1969) Lab. Inuest. 21, 154-168 Kozak, M. (1984) Nucleic Acids Res. 12, 857-872 Kozak, M. (1986) Cell 44,283-292 Kyte, J., and Doolittle, R. F, (1982) J. Mol. B i d . 157, 105-132 Lewis, S . A., and deMoura, J. L. C. (1984) J. Membr: Biol. 82, 123-136 Lisanti, M. P., and Rodriguez-Boulan, E. (1990) 2hd-s Biochern. Sci. 15, 113-118 Lonsdale-Eccles, J. D., Lynley, A. M., and Dale, B. A. (1981) Biochern. J. 197,

Low, M. G. (1989) Biochim. Biophys. Acta 988,427454

Pmc. Natl. Acad. Sci. U. S. A 84, 697M974

429-440

Klausner, R. D. (1989) J. Cell Biol. 109,7%83

Barr, P. J. , and Thomas, G. (1990) J. Cell Biol. 111, 2851-2859

D. (1989) J. Cell Biol. 108, 2277-2290

Jansonius, J. N., and Rosenbusch, J. P. (1992) Nature 358,727-733

Verlag, New York

J. (1993) Mol. Cell Biol., 13, 2942-2951

Biophys. Acta 311, 180-190

591-597

1784 Urothelium-specific Expression of Uroplakin II Minsky, B. D., and Chlapowski, F. J. (1978) J. Cell Biol. 77,685497 Misumi, Y., Oda, K., Fujiwara, T., Takami, N., Tashiro, K, and Ikehara, Y. (1991)

Pauli, B. U., J. Alroy and Weinstein, R. S . (1983) in The Pathology of Bladder J. Biol. Chem. 268,16954-16959

FL Cancer (Bryan, G. T., and Cohen, S. M., eds) pp. 42-140, CRC Press, Boca Raton,

Porter, K. R., and M. A. Bonneville (1963) An Introduction to the Fine Structure of Cells and ?Issues, Lea & Febiger, New York

Porter, K. R., Kenyon, K., and Badenhausen, S . (1967) Protoplasma 69, 263-274 Pmudfoot, N. J., and G. B. Brownlee (1976) Nature 269,211-214 Robertson, J. D., and Vergara, J. (1980) J. Cell Biol. 86, 514-528 Roebroek, A. J. M., Schalken, J. A,, Leunissen, J. A. M., Onnekink, C., Bloemers,

Ryan, A. M.. Womack, J. E., Yu, J., Lin, J.-H., Wu, X.-R., Sun, T.-T., Clarke, V., and H. P. J., and Van de Ven, W. J. M. (1986) EMBO J. 6,2197-2202

Sambmk, J., Fritach, E. F., and Maniatis, T. (1989) Molecular Cloning: A Labo- D'Eustachio, P. (1993) Mamm. Genome, in press

mtory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S . A. 74, 5463-5467

Sarikas, S . N., and Chlapowski, F. J. (1986) Cell nssue Res. 248, 109-117 Severs, N. J., and Hicks, R. M. (1979) J. Ultrastruct. Res. 69,279-296 Staehelin, L. A,, Chlapowski, F. J., and Bonneville, M. A. (1972) J. Cell Biol. 5S,

Steiner, D. F., Smeekens, S . P., Ohagi, S., and Chan, S . J. (1992) J. Biol. Chem. 267, 73-91

Stone, k. L., Lopresti, M. B., Williams, N. D., Crawford, J. M., DeAngelis, R., and 23435-23438

Williams, K. R. (1989) in Zkchniques in Protein Chemistry (Hugli, T., ed) pp. 377391, Academic Press, New York

Stubbs, C. D., Ketterer, B., and Hicks, R. M. (1979) Biochim. Biophys. Acta 668,

Surya, B., Yu, J., Manabe, M., and Sun, T.-T. (1990) J. Cell Sei. 97, 419432 Taylor, K. A,, and Robertson, J. D. (1984) J. Ultrastruct. Res. 87.23-30 Varghese, J. N., Laver, W. G., and Colman, P. M. (1983) Nature 303,35-40 Vergara, J., Zambrano, F., Robertson, J. D., and Elrod, H. (1974) J. Cell Biol. 61,

von Heijne, G. (1986) Nucleic Acids Res. 14,4683-4690 von Heijne, G. (1988) Biochim. Biophys. Acta 947,307433 Warren, R. C., and Hicks, R. M. (1970) Nature 227,280-1 Wu, X-R., and Sun, T.-T. (1993) J. Cell Sei., 106,3143 Wu, X.-R., Manabe, M., Yu, J., and Sun, T.-T. (1990) J. BioZ. Chem. 265, 19170-

Yu, J., Manabe, M. Wu, X-R., Xu, C., Surya, B., and Sun, T.-T. (1990) J. Cell Biol.

Yu, Y., Zhang, Y., Sabatini, D. D., and Kreibich, G. (1989) Proc. Natl. Acad. Sci.

sa72

83-94

19179

111, 1207-1216

U. S. A. 86,9931-9935

No. THE Cmmmm Vol. 3, of 269, 21, pp. 1775-1784, 1994 OF ... · PDF filePrecursor Sequence,...

Documents

Transcript of No. THE Cmmmm Vol. 3, of 269, 21, pp. 1775-1784, 1994 OF ... · PDF filePrecursor Sequence,...