Nirali K Patel, Nutan Prakash V* PRINCIPLE AND TOOLS FOR PRIMER...
Transcript of Nirali K Patel, Nutan Prakash V* PRINCIPLE AND TOOLS FOR PRIMER...
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Nirali K Patel, Nutan Prakash V* Department of Biotechnology, Shree M & N Virani
Science College, Rajkot
Abstract
Bioinformatics has become an essential
tool not only for biological database but also for
applied research in biotechnology and biomedical
sciences. Optimal primer sequence and appropriate
primer concentration are essential for maximal
specificity and efficiency of PCR. Selection of
oligonucleotide primers is useful for polymerase
chain reaction (PCR), Oligo hybridization and
DNA sequencing. Proper primer design is actually
one of the most important steps in successful DNA
PRINCIPLE AND
TOOLS FOR PRIMER
DESIGN specific amplification. Primer-dimer formation can
become competitive enough to suppress PCR
reaction and product formation. There are several
online tools and server help to serving molecular
biologist design effective PCR primers. This
review intends to provide information to choosing
the most efficient way to design a new specific-
primer by applying current publicly available
bioinformatics tools, and server. Also, the aim here
is to provide essential information and principle for
the primer design and use of primers.
sequencing and PCR reaction. A poorly designed Key words: PCR primer, primer design,
primer can result in little or no product due to non-
INTRODUCTION
Primer design is the one of the best application
bioinformatics tool, server sequence. The programs for PCR primer
design play the central role in PCR reaction,
in bioinformatics. Bioinformatics is an and DNA sequencing. Primer is very essential
interdisciplinary research area, which may be
broadly defined as the combination of
for successful molecular experiment. There are
several parameters essential for successful
biological and computational sciences (Singh primer design. These parameters are
and Kumar, 2001). Primer is small mentioned under the title principle for primer
oligonucleotide sequence. Selection of design.
oligonucleotide primers is often critical for the
overall successes of polymerase chain reaction
(PCR), and DNA sequencing. PCR is a
technique that is used to amplify a sample of
DNA from miniscule amount of DNA (ex.,
DNA from a crime scene, archaeological
samples, organisms that can’t be cultured).The
manual selection of optimal PCR primer set is
Primer
A primer is a short oligonucleotide which is
the reverse complement of a region of a DNA
template. It would anneal to a DNA strand to
facilitate the amplification of the targeted
DNA sequence. There are a mainly two types
of primer use in PCR forward primer and
tedious process and not efficient. Thus, reveres primer. But in case of DNA
various bioinformatics programs are available sequencing only forward primer is use (1).
for selection of primer pairs from a template
79
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Fig 1: primer and template.
TYPES OF PRIMER:
Universal Primer
Primers can be designed to amplify only one
product in general but Primers can also be
designed to amplify multiple products. We call
5.Matching forward and reverse primers to
find the best pair.
6.Ensure uniqueness in all template sequences. Guessmer
In some cases, DNA sequences are either
such primers “universal primers”. PCR unavailable or difficult to align. Then, a
primers are used to amplify the 16SrRNA gene
providing the phylogenetic information, the
most common universal primer pair was
devised by Weisburg et al.(3)
Semi-Universal Primers
Primers can be designed to amplify only a
subset of template sequences from a large
group of similar sequences. For example,
design primer to amplify HPV type 1 and type
single/group of related proteins can be back
translated into nucleotide sequences that will
be used as template to design primers/probes.
We call such primers “Guessmer”. Oligo dT Primers
Oligo d (T) 12-18 is the classic primer mix
used to prime synthesis of the first strand
cDNA by reverse transcriptase using poly A+
mRNA as a template
6 genes, but not other types.
Degenerate primers
Strategy:
1.Align all types of HPV genes.
2.Identify a subset of genes that are more
similar to each other than to other subsets. In
this case, type 1 and type 6.
3.Find the 5’ and 3’ regions that are conserved
between type 1 and type 6, but are variable in
other types.
Sometimes degenerate primers are used. These
are actually mixtures of similar, but not
identical primers. They may be convenient if
the same gene is to be amplified from different
organisms, as the genes themselves are
probably similar but not identical. The other
use for degenerate primers is when primer
design is based on protein sequence.
4.Design forward primers from the 5’ region
and reverse primers from the 3’ region.
80
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
length of the primer, its melting temperature,
Specific primer
Specific primer is primer which design for
specific target gene. Like, primer 3 is software
which design primer for particular target gene
sequences. Primer3 is simplest and most
popular software for specific primer design.
PRENCIPLE FOR PRIMER DESIGN
The most critical parameter for successful
PCR is the design of Primers. A poorly
designed primer can result in a PCR reaction
that will not work. The primer sequence
determines several parameters such as the
its annealing temperature and ultimately the
yield. A poorly designed primer can result in
little or no product due to non-specific
amplification and/or primer-dimer formation,
which can become competitive enough to
suppress product formation. This review note
is provided to give rules that should be taken
into account when designing primers for PCR.
The sequences of the primers used for PCR
amplification can have a major effect on the
specificity and sensitivity of the reaction. See
the table which providing parameter for primer
designing.
Character
parameter
1
2
3
4
Specificity Stability Compatibility Other Recommendation
Uniqueness
Primer length
GC content
Internal stability
Melting temperature
Annealing temperature
GC clamp
Primer pair matching
3’-End Sequence
Secondary structure
Amplicon Length
concentration of primer
Avoid Cross homology:
1. SPECIFICITY
As mentioned above, primer specificity is at
least partly dependent on primer length. It is
found that there are many more unique 24
bases Oligo than 15 bases Oligo. However,
primers must be chosen so that they have a
unique sequence within the template DNA that
is to be amplified.
A. Uniqueness
There shall be one and only one target site in
the template DNA where the primer binds,
81
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
which means the primer sequence shall be
unique in the template DNA. A primer
result in a smear on amplification of genomic
DNA.
designed with a highly repetitive sequence will
TemplateDNA,
5’...TCAACTTAGCATGATCGGGTA...GTAGCAGTTGACTGTACAACTCAG CAA...3’
3’GTTGAATCGT 5’ 3’CATCGTCAACTGAC5’ ‘3’GTTGA TCGT5’
A
Primer candidate 1 5’-TGCTAAGTTG-3’ NOT UNIQUE
Primer candidate 2 5’-CAGTCAACTGCTAC-3 UNIQUE!
B. Primer Length
Primer length is one of the important
parameter for successes of PCR reaction. The
specificity is controlled by length of primer
and annealing temperature of PCR reaction.
Primer between 18-35 nucleotides is very
specific for PCR. Primers with long runs of a
calculation. In general shorter the primer more
quickly it will anneal to target DNA (2).Since
both specificity and the temperature and time
of annealing are at least partly dependent on
primer length, this parameter is critical for
successful PCR (Wu et al., 1991). Primers
longer than 30 bases do not demonstrate
single base should generally be avoided. higher specificity. Additionally, long
Primer with longer sequences posses extra Amplicon are more likely to
information and also disturb in Tm value
cross-hybridize with other primers and
sequences in the reaction mixture, and this can
terminate the DNA polymerization
Fig 2: primer length
GC% is an important characteristic of DNA.
C. GC Content Primers should have a GC contents between
82
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
50 and 60 percent. GC contents, melting
temperature and annealing temperature are
strictly dependent on one another. The
100%Poly G’s or C’s can result in non-
specific annealing. GC-content of primers is
used to predict their annealing temperature to
GC pair is bound by three hydrogen bonds.
The presence of G or C bases at the 3′ end of
primers (GC clamp) helps to promote correct
binding at the 3′ end due to the stronger
hydrogen bonding of G and C bases.
GC% = (G + C) / length of sequence *
the template DNA. A higher GC-content level
indicates a higher melting temperature as The
Fig 3: G-C bond
D. Internal stability
Internal stability is calculated with entropy
To minimize false priming, it’s critical that the
stability at 5’ end be high and the stability at
values of neighbor nucleotides. Usually, we
draw a graph of ∆G for all nucleotides of the
3’ end be relatively low. The
stability is ∆
internal
primers. This is known as the stability profile.
Fig 4: internal stability
2. STABILITY
The primer should have stable 5’ end and an
unstable 3’ end. Stretches of A and T are also
to be avoided as these will open up stretches of
the primer- template complex. “G” or “C” is
desirable at the 3’ end. This GC clamp reduces
83
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
spurious secondary bands. Stability of primer
T m. The melting temperature of nucleic acid
depended on Melting temperature and duplex is increases as the length and GC
annealing temperature also. Determine the �G
of the last 5 bases at 3' end and 5’ end. An
unstable 3' end (less negative �G) will result
in less false priming, stable 5' end (more
negative �G) will result in more efficient and
specific bonding to the template.
content increases. A simple formula for
calculation of the (T m) is: Tm = 2(A+T) + 4(G+C).
B. Annealing temperature:
The annealing temperature (T a) chosen for a
A. Melting Temperature (Tm) PCR depends directly on length and
The melting temperature (T m) is the composition of the primer(s). Generally, an
temperature at which one-half of a particular
DNA duplex will dissociate and become single
strand DNA. The optimal melting temperature
for primers generally lies in the range of 52-
annealing temperature about 5°C below the
lowest T m of the pair of primers is used. Too
high T a will produce insufficient primer-
template hybridization resulting in low PCR
580C. Both the forward and reverse product yield. Too low T a may possibly lead
oligonucleotide primers should be designed to non-specific products caused by a high
such that they have similar melting number of base pair mismatches. The optimal
temperatures. A good approximant working
value can be calculated using the formula of
Wallace et al (1979).The stability of a primer-
annealing temperature for any given primer
pair on a particular target can be calculated as
follows:
template DNA duplex can be measured by its
Ta Opt = 0.3 x(Tm of primer) + 0.7 x(Tm of product) – 25
Fig 5: primer anneal with target sequences
= 0.3 x(T m of primer) + 0.7 x(T m of product) - 25
84
Atmiya Spandan Vol.1, Iss.1, 2013
C. GC Clamp:
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
B. 3’-End Sequence:
The presence of G or C bases within the last
five bases from the 3' end of primers (GC
clamp) helps promote specific binding at the 3'
end due to the stronger bonding of G and C
bases. More than 3 G's or C's should be
avoided in the last 5 bases at the 3' end of the
primer. Several studies have indicated that a
GC-clamp as short as 25bp would be sufficient
It is well established that the 3’ terminal
position in PCR primers is essential for the
control of miss-priming (Kwok et al., 1990).
Primers should be “stickier” on their 5’ end
than on their 3’ ends. A “sticky” 3’ end as
indicated by a high G C content could
potentially anneal at multiple sites on the
template DNA. A “G” or “C” is desirable at
in DGGE. [Denaturing gradient gel the 3’ end but the first part of this rule should
electrophoresis] is one of the most powerful
methods for mutation detection currently
available] this may be true for AT-rich
fragments, but for a GC-rich sequence the
difference in T m with a GC-clamp might
become too small.
3. COMPATIBILITY
A. Primer Pair Matching
Primers work in pairs – forward primer and
reverse primer. Since they are used in the same
PCR reaction, it shall be ensured that the PCR
condition is suitable for both of them. One
critical feature is their annealing temperatures,
which shall be compatible with each other.
apply. This GC clamp reduces spurious
secondary bands (Sheffield et al., 1989).
C. Secondary structure
Presence of the primer secondary structures
produced by intermolecular or intramolecular
interactions can lead to poor or no yield of the
product. They adversely affect primer template
annealing and thus the amplification. They
greatly reduce the availability of primers to the
reaction.
Hairpins: It is formed by intramolecular
interaction within the primer and should be
avoided. Optimally a 3' end hairpin with a ∆G
of -2 kcal/mol and an internal hairpin with a
∆G of -3 kcal/mol is tolerated generally.
The maximum difference allowed is 3 °C. The
closer their T anneal are the better.
Fig 5: hair pin
∆G definition: the Gibbs Free Energy G is the
measure of the amount of work that can be
extracted from a process operating at a
constant pressure. It is the measure of the
spontaneity of the reaction. The stability of
hairpin is commonly represented by its ∆G
value, the energy required to break the
secondary structure. Larger negative value for
∆G indicates stable, undesirable hairpins.
Presence of hairpins at the 3' end most
adversely affects the reaction.
∆G = ∆H – T∆S 85
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
dimer with a ∆G of -6 kcal/mol is tolerated
Self Dimer: A primer self-dimer is formed by
intermolecular interactions between the two
(same sense) primers, where the primer is
homologous to itself. Generally a large amount
generally. Cross Dimer: Primer cross dimers are formed
by intermolecular interaction between sense
of primers are used in PCR compared to the and antisense primers, where they are
amount of target gene. When primers form
intermolecular dimers much more readily than
hybridizing to target DNA, they reduce the
product yield. Optimally a 3' end self dimer
homologous. Optimally a 3' end cross dimer
with a ∆G of -5 kcal/mol and an internal cross
dimer with a ∆G of -6 kcal/mol is tolerated
generally.
with a ∆G of -5 kcal/mol and an internal self
Fig 6: cross dimer.
To improve specificity of the primers it is
4. OTHER RECOMMENDATION
A. Concentration
necessary to avoid regions of homology.
Primers designed for a sequence must not
The concentration of primer in amplification amplify other genes in the mixture.
reaction should be between 0.1 and 0.5 mM.
B. Amplicon Length:
The forward primer and the reverse primer
should be between 300 and 2,000 base pairs
apart. In general, primers distanced < 2000
bases apart are used. This allows for sufficient
Commonly, primers are designed and then
Blasted to test the specificity. Our products
offer a better alternative. You can avoid
regions of cross homology while designing
primers. You can BLAST the templates
against the appropriate non-redundant database
and the software will interpret the results. It
amplification of the target region. This will identify regions significant cross
distance determines how big the band will be
in your gel. Larger bands are easier to see. If
they are too close, the amplified region the
product will be too small and run off the gel
and if they are too big. The product will not
make it out of the well
Product length = (Position of antisense
homologies in each template and avoid them
during primer search. TOOLS FOR PRIMER DESIGN
The use of software in biological applications
has given a new dimension the field of
bioinformatics. There are a numerous web-
primer - Position of sense primer) + 1. based resources and different programs
available for primer design. These are (I)
C. Avoid Cross homology Primer design web servers for PCR (II) Tool
86
NO TOOL NAME FUNCTION
1. AntiSense
Design
Design antisense primers at IDT.
2. AutoPrime Designs primers that are specific for expressed sequences (mRNA).
3. BatchPrimer3 High throughput web application for PCR and sequencing primer design.
4. CODEHOP Consensus Degenerate Hybrid Oligonucleotide Primers.
5. Exonprimer Design primers for the amplification of exons with intronic primers.
6. Genefisher Interactive PCR primer design.
7. MEDUSA A tool for automatic selection and visual assessment of PCR primer pairs
(Karolinska).
8. Methprimer Design primers for methylation PCR.
9. mPrimer3 modified Primer3.
10. MutScreener Design primers for mutation screening (by PCR direct sequencing).
11. NetPrimer Free primer design service of Premier Biosoft.
12. Oligodb A web based system for interactive design of oligo DNA for transcription
profiling (hybridization) of human genes.
13. Osprey Oligonucleotide Design Software for Sequencing and Gene Expression.
14. PCR suite A collection of programs to search overlapping primers, genomic primers for
exon amplification, SNP and cDNA flanking primers.
15. PRIDE The less automated web version of PRIDE (a.o. 50-70 mer oligo design).
16. Primaclade A web based application that accepts a multiple species nucleotide alignment
file as input and identifies a set of PCR primers that will bind across the
alignment.
17. Primer3 A common used software for designing primers.
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
for primer properties calculation (III) Useful
Biosystems,
Molecular
Biology
Insights,
site for PCR reaction setup. These are listed PREMIER Biosoft International,
below in (Tables 1, 2, and 3). These all web- IntelliGenetics Inc., Hitachi Inc., DNA Star,
based resources are very essential for Advanced American Biotechnology and
molecular biologist. There is different Imaging. Some scientists have also developed
software freely and commercially available for
local installation. These are listed below in
(Table 4 and 5). Companies engaged in
biosoftware development include: Alkami
algorithms and computer programs for various
purposes of primer design (Rychlik and
Rhoades, 1989; Lowe et al., 1990; Lucas et al.,
1991; O'Hara and Venezia, 1991; Tamura et)
Table 1 Primer design web servers for PCR.
87
NO TOOL NAME FUNCTION
18. Primer3Plus Use primer3 to pick primers for specific tasks.
19. PrimerQuest Primer design at IDT.
20. Primer
Generator
Automated generator of primers for site directed mutagenesis.
21. PrimerStation Multiplex human PCR primer design site.
22. PrimerX Automated design of primers for site directed mutagenesis.
23. Primique Automatic design of specific PCR primers for each sequence in a family.
24. Primo Unique Primo Unique finds multiple primer pairs, each uniquely amplify one gene in a
family.
25. ProbeWiz
Server
The CBS Probe Wiz WWW server predicts optimal PCR primer pairs for
generation of probes for cDNA arrays.
26. PUNS Primer Uni Gene Selectivity Testing compares primer sequences against the
both the genome and transcriptome to assess the potential for multiple
amplicons .
27. RNAi Design Design primers for RNAi at IDT.
28. ROSO Software to design optimized oligonucleotide probes (size over 25 nucleotides)
for microarrays.
29. SNPbox A modular software package that automates the design of PCR primers for
large scale amplification and sequencing projects.
30. SOP3 Selection of Oligonucleotide Primers for PCR and Pyrosequencing .
31. SPADS Specific Primers & Amplicon Design Software for amplification of individual
members of gene families.
NO NAME FUNCTION
1 AutoDimer Rapid screen of previously selected multiplex PCR primers for primer.
dimer and hairpin interactions in short DNA oligomers (< 30 nucleotides) .
2 MultiPLX 2.0 Tool to analyze PCR primer compatibility and automatically finding
optimal multiplexing (grouping) solution.
3 OligoAnalyzer
3.0
Generates Tm, free energy, molecular weight and hairpin and dimer
formation structures.
5 OligoTM 1.0 Program for calculation oligo melting temperature and GC content.
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Table 2 Primer property calculators
86
NO SOFTWARE
NAME
FUNCTION
1 Amplify A freeware Macintosh program for simulating and testing
polymerase chain reactions (PCRs).
2 AmplifX Software to test, manage and design your primers for Macintosh and
Windows.
3 Fast PCR PCR primer design, DNA and protein tools, repeats and own
database searches
4 MEDUSA A tool for automatic selection and visual assessment of PCR primer
pairs (Karolinska)
5 MethylPrimer
Express
Free Applied Biosystems software to design high quality PCR
primers for methylation mapping experiments.
6 MutaPrimer Designs primers for Stratagene's QuikChange site directed
mutagenesis kits.
7 OligoPicker OligoPicker picks specific oligos by skipping regions with
contiguous bases common in other sequences. In addition, oligo
specificity is double checked by NCBI BLAST.
8 PRIMEGENS PRIMEGENS (PRIMEr Design Using GEN Specific Fragments) is a
computer program to select gene specific fragments and then design
primer pairs using Primer3 for PCR amplifications.
9 PrimerD The primerD program implements a novel algorithm for the design
of unique degenerate primer pairs.
10 Primer3 A common used software for designing primers for microarray
construction.
11 mPrimer3 Modified Primer3
NO NAME FUNCTION
1 Optimase Protocolwriter Design PCR protocol
2 Optimase MasterMixCalculator Design PCR protocol
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Table 3 Online site available for PCR setup
Table 4 PCR Primer design software for local installation free available.
87
NO SOFTWARE
NAME
FUNCTION
1 AlleleID For real time PCR based pathogen detection and bacterial identification.
TaqMan probe design supported.
2 Beacon Designer Real time PCR primer and probe design for single tube and multiplex
PCR assays.
3 OligoChecker An oligo database program which quickly checks which oligos available
in a lab can be used on a given template.
4 PRIDEand
GenomePRIDE
(a.o. 50- 70 me oligo design)
Atmiya Spandan Vol.1, Iss.1, 2013
Table 5 Commercial packages
Computer-Aided Primer Design
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Primer design is an art, in silico primer
designing done by using various computer
tools.
Primer3 software
It is software developed by Rozen and
Skaletsky (2000). It is freely available on
Internet
(http://frodo.wi.mit.edu/cgibin/primer3/primer
3.cgi). This software is provided by the
Whitehead Institute “as is” and any express or
Design a pair of primers for sequence
“NM_203378” in NCBI GenBank, so that the
coding sequence of human myoglobin will be
amplified using PCR reaction. We design
specific primer for “NM_203378” gene by
using primer3 software. It design only one
specific primer pair from the sequences.See
example, Step 1: download target sequence form
NCBI in fast format. See here the sequence
of “NM_203378” gene is given.
implied warranties, including, but not limited >gi|44955887|ref|NM_203378.1| Homo
to, the implied warranties of merchantability
and fitness for a particular purpose are
disclaimed. Primer3 is widely used program
sapiens myoglobin (MB), transcript variant 3,
mRNA
AATGGCACCTGCCCTAAAATAGCTTCC
for designing PCR (Polymerase Chain CATGTGAGGGCTAGAGAAAGGAAAAG
Reaction) primers. Primer3 can also design
hybridization probes and sequencing primers.
It is a tool for automated primer generation
according to thermodynamic, primer size, and
product size restrictions
ATTAGACCCTCCCTGGATGAGAGAGAG
AAAGTGAAGGAGGGCAGGGGAGGGGG
ACAGCGAGCCATTGAGCGATCTTTGTC
AAGCATCCCAGAAGACTGCGCCATGGG
GCTCAGCGACGGGGAATGGCAGTTGGT
88
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
GCTGAACGTCTGGGGGAAGGTGGAGGC
TGACATCCCAGGCCATGGGCAGGAAGT
CCTCATCAGGCTCTTTAAGGGTCACCC
AGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGAT
GAAGGCGTCTGAGGACTTAAAGAAGCA
TGGTGCCACCGTGCTCACCGCCCTGGG
TGGCATCCTTAAGAAGAAGGGGCATCA
TGAGGCAGAGATTAAGCCCCTGGCACA
GTCGCATGCCACCAAGCACAAGATCCC
CGTGAAGTACCTGGAGTTCATCTCGGA
ATGCATCATCCAGGTTCTGCAGAGCAA
GCATCCCGGGGACTTTGGTGCTGATGC
CCAGGGGGCCATGAACAAGGCCCTGGA
GCTGTTCCGGAAGGACATGGCCTCCAA
CTACAAGGAGCTGGGCTTCCAGGGCTA
GGCCCCTGCCGCTCCCACCCCCACCCA
TCTGGGCCCCGGGTTCAAGAGAGAGCG
GGGTCTGATCTCGTGTAGCCATATAGA
GTTTGCTTCTGAGTGTCTGCTTTGTTTA
GTAGAGGTGGGCAGGAGGAGCTGAGG
GGCTGGGGCTGGGGTGTTGAAGTTGGC
TTTGCATGCCCAGCGATGCGCCTCCCTG
TGGGATGTCATCACCCTGGGAACCGGG
AGTGGCCCTTGGCTCACTGTGTTCTGCA
TGGTTTGGATCTGAATTAATTGTCCTTT
CTTCTAAATAACCGAACTTCTTCCAACC
TCCAAACTGGCTGTAACCCCAAATCCA
AGCCATTACACACCTGACAGTAGCAAT
TGTCTGATTAATCACTGGCCCCTTGAAG
ACAGCAGAATGTCCCTTTGCAATGAGG
AGGAGATCTGGGCTGGGCGGGCCAGCT
GGGGAAGCATTTGACTATCTGGAACTT
GTGTGTGCCTCCTCAGGTATGGCAGTG
ACTCACCTGGTTTTAATAAAACAACCT
GCAACATCTCA
Step2: now online available primer3 server is used for design a primer
Step 3: paste the sequences and click on pick primers see arrow in give image, after few minutes
it give result in another window.
89
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Step 4: see the result it give left primer and right primer respectively known as a forward
primer and reverse primer.
GENEFISHER2 SOFTWARE
Gene fisher 2 software design universal
best software because it done multiple
primer. Gene fisher2 software is one of the sequences analysis steps along with it
90
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
facilitates manual parameter setting for primer
design. It helps in rapid universal primer
design. Here, we take same gene, Design a
pair of primers for sequence “NM_203378” in
NCBI GenBank.
After the end of process it gives list of primer
pair. It helps to design universal primer from
the many sequences. It also helps in multiple
sequences analysis.
Step 1: download target sequence form
NCBI in fast format. See here the sequence
of “NM_203378” gene is given.
>gi|44955887|ref|NM_203378.1| Homo
sapiens myoglobin (MB), transcript variant 3,
mRNA
AATGGCACCTGCCCTAAAATAGCTTCC
CATGTGAGGGCTAGAGAAAGGAAAAG
ATTAGACCCTCCCTGGATGAGAGAGAG
AAAGTGAAGGAGGGCAGGGGAGGGGG
ACAGCGAGCCATTGAGCGATCTTTGTC
AAGCATCCCAGAAGACTGCGCCATGGG
GCTCAGCGACGGGGAATGGCAGTTGGT
GCTGAACGTCTGGGGGAAGGTGGAGGC
TGACATCCCAGGCCATGGGCAGGAAGT
CCTCATCAGGCTCTTTAAGGGTCACCC
AGAGACTCTGGAGAAGTTTGACAAGTT
CAAGCACCTGAAGTCAGAGGACGAGAT
GAAGGCGTCTGAGGACTTAAAGAAGCA
TGGTGCCACCGTGCTCACCGCCCTGGG
TGGCATCCTTAAGAAGAAGGGGCATCA
TGAGGCAGAGATTAAGCCCCTGGCACA
GTCGCATGCCACCAAGCACAAGATCCC
CGTGAAGTACCTGGAGTTCATCTCGGA
ATGCATCATCCAGGTTCTGCAGAGCAA
GCATCCCGGGGACTTTGGTGCTGATGC
CCAGGGGGCCATGAACAAGGCCCTGGA
GCTGTTCCGGAAGGACATGGCCTCCAA
CTACAAGGAGCTGGGCTTCCAGGGCTA
GGCCCCTGCCGCTCCCACCCCCACCCA
TCTGGGCCCCGGGTTCAAGAGAGAGCG
GGGTCTGATCTCGTGTAGCCATATAGA
GTTTGCTTCTGAGTGTCTGCTTTGTTTA
GTAGAGGTGGGCAGGAGGAGCTGAGG
GGCTGGGGCTGGGGTGTTGAAGTTGGC
TTTGCATGCCCAGCGATGCGCCTCCCTG
TGGGATGTCATCACCCTGGGAACCGGG
AGTGGCCCTTGGCTCACTGTGTTCTGCA
TGGTTTGGATCTGAATTAATTGTCCTTT
CTTCTAAATAACCGAACTTCTTCCAACC
TCCAAACTGGCTGTAACCCCAAATCCA
AGCCATTACACACCTGACAGTAGCAAT
TGTCTGATTAATCACTGGCCCCTTGAAG
ACAGCAGAATGTCCCTTTGCAATGAGG
AGGAGATCTGGGCTGGGCGGGCCAGCT
GGGGAAGCATTTGACTATCTGGAACTT
GTGTGTGCCTCCTCAGGTATGGCAGTG
ACTCACCTGGTTTTAATAAAACAACCT
GCAACATCTCA
91
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Step2: now online available primer3 server is used for design a primer
Step3: upload sequences in the box and click on submit button.
92
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
Step4: after submission of sequences, one window is open in which click on “calculate primer”
button.
Step5: it gives list of possible primer.
93
Atmiya Spandan Vol.1, Iss.1, 2013
CONCLUSION
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
sequences held in gene databases are practical
The heart of PCR lies in the design of the two
oligonucleotide primers. It is very essential
that accuracy is taken in the design of primers
for PCR. Several basic parameters including
the length of the primer, %GC content and the
3' sequence, Tm value need to be optimized
for successful PCR. Now all of these
parameters can be easily optimized with the
help of computer programs. The increasing use
of information from the internet and the
REFERENCES
1. Garg N, Punthir S, Prakash A and Kumar A.
April 2008. Primer Designing for Dreb1A, A
Cold Induced Gene. Journal of Proteomics &
starting points when designing primers and
reaction conditions for the PCR. A number of
software packages such as Oligo, Primer etc.
have allowed the process of primer design to
be less troublesome. It is also possible to
include more than one set of primers in a PCR.
All these information related to the software,
online tool, sites for primer properties
calculation, are useful for successful primer
design and PCR reaction. 5. Kamel A. Abd- lsalam.2003.Bioinformatic tools
and guideline for PCR primer design. African J
Biotechnol.2 (5): 91-95.find article online.
6. Lowe T, Sharefkin J, Yang SQ, Dieffenbach
CW A computer program for selection of
Bioinformatics -Open Access. Vol.1find article oligonucleotide primers for
online . polymerasechain.1990. NucleicAcids.18.1757-
2. Ahsen N, Wittwer C T, and schu E.1956–1961
(2001) .Molecular Diagnostics Oligonucleotide
Melting Temperatures under PCRConditions:
1761. find Article online
7. ChavalI S, Mahajan A, Tabassuml R, Maiti S,
and Bharadwaj D. Oligonucleotide properties
Nearest-Neighbor Corrections forMg21, determination and primer
Deoxynucleotide Triphosphate, and Dimethyl
Sulfoxide Concentrations with Comparison to
designing.2005.Bioinformatics.21.3918–
3925.find article online.
Alternative Empirical Formulas. Clinical 8. .C W Dieffenbach, T M Lowe and G S Dveksler.
Chemistry.vol47:issue11.find article. online
3. W G Weisburg, S M Barns, D A Pelletier and D
J Lane 16S ribosomal DNA amplification for
phylogenetic study; Journal of Bacteriology.
General concepts for PCR primer design
Genome Research.1993 3: S30.find article
online. 9. Lowe T, Sharefkin J, Yang SQ, Dieffenbach CW
1991 January; 173(2): 697-703 find article A computer program for selection of
online. oligonucleotide primers for
4. Mehta N, Raikwar A, Chauhan P and Kushwaha
S. Primer design and analysis of Klebsiella
polymerasechain.1990.
1761. find Article online
NucleicAcids.18.1757-
granulomatis strain K22-14 16S rRNA gene. 10. ChavalI S, Mahajan A, Tabassuml R,
Research Journal of Pharmaceutical, Biological Maiti S, and Bharadwaj D. Oligonucleotide
and Chemical Sciences. properties determination and primer
designing.2005.Bioinformatics.21.3918–
3925.find article online.
94
Atmiya Spandan Vol.1, Iss.1, 2013
[BIOLOGICAL SCIENCES ] Principles and tools for primer design
11.
.C W Dieffenbach, T M Lowe and G S
vitro. Nucleic Acids Res 18 (21): 6409–12. find
Dveksler. General concepts for PCR primer article online. design Genome Research.1993 3: S30.find article 18. Vallone, P. M., and J. M. Butler. 2004.
online. AutoDimer: A screening tool for primer-dimer
12. Lowe T, Sharefkin J, Yang SQ, and hairpin structures. Biotechniques 37 (2):
Dieffenbach CW (1990). A computer program
for selection of oligonucleotide primers for
polymerase chain reaction. Nucleic Acids Res.
226–31. find article online.
BIBLIOGRAPHY
18: 1757-1761. 1. http://www.accessexcellence.org/AB/GG/poly 13. Rychlik, W., W. J. Spencer, and R. E. merase.html
Rhoads. 1990. Optimization of the annealing 2. http://www.accessexcellence.org/AB/BC/Kary temperature for DNA amplification in _B_Mullis.html vitro. Nucleic Acids Res 18 (21): 6409–12. find
article online. 3. http://bioweb.uwlax.edu/GenWeb/Molecular/S
eq_Anal/Primer_Design/primer_design.htm 14. O'Hara PJ, Venezia D (1991). 4. http://www.karymullis.com/
PRIMEGEN: a tool for designing primers from
multiple alignments. CABIOS 7: 533-534.
5. http://www.bioteach.ubc.ca/MolecularBiology/ PolymeraseChainReaction/
15. Lucas K, Busch M, Mossinger S, 6. http://www.emblheidelberg.de/ExternalInfo/ge Thompson JA (1991). An improved erlof/draft_frames/flowchart/clopcr_strategy/pr microcomputer program for finding gene or gene imer_design.html family-specific 7. http://www.ncbi.nlm.nih.gov/Class/NAWBIS/
16. Vallone, P. M., and J. M. Butler. 2004. Modules/DNA/dna9.html AutoDimer: A screening tool for primer-dimer
and hairpin structures. Biotechniques 37 (2):
226–31. find article online.
8. 9.
http://www.dnalc.org/shockwave/pcranwhole.h tml http://www.alumni.ca/~leema3m/bghtml
17. Rychlik, W., W. J. Spencer, and R. E. 10. http://marvin.ibest.uidaho.edu/~heckendo/CS5 Rhoads. 1990. Optimization of the annealing 04/Students/P/waltari.pdf temperature for DNA amplification in 11. http://www.nfstc.org/pdi/Subject04/pdi_s04_m
01_02_c.htm
95