NIPT inservice talk May 2015
-
Upload
kathryn-murray -
Category
Documents
-
view
45 -
download
2
Transcript of NIPT inservice talk May 2015
![Page 1: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/1.jpg)
Kathryn Murray, MS, CGC Center for Genetics
May 2015
541-349-7600
NIPT The Present and Future of Prenatal Diagnosis
![Page 2: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/2.jpg)
Some slides used with permission from:
• Verinata Laboratory
• Sequenom Laboratory
• Natara Laboratory
• Charlotte Clausen, MD
![Page 3: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/3.jpg)
Disclosure
Lecturer for Myriad Genetics regarding
Inherited Cancer Syndromes
I have no affiliation with any company
mentioned during this presentation
![Page 4: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/4.jpg)
Objectives
Describe the different techniques used to
evaluate fetal DNA in the maternal serum.
Identify appropriate candidates for non
invasive prenatal testing(NIPT).
Understand the benefits and limitations of
NIPT.
![Page 5: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/5.jpg)
PRESENTATION-0029 vB
ACOG Committee Opinion on NIPT
“Cell free fetal DNA appears to be the most effective screening test for aneuploidy in high risk
women… is one option that can be used as a primary screening test in women at increased risk of
aneuploidy”
“[NIPT] should be an informed patient choice after pretest counseling”
“[NIPT] should not be offered to low-risk women or women with multiple gestations”
“A patient with a positive test result should be referred for genetic counseling and should be
offered invasive prenatal diagnosis for confirmation of test results.”
Also supporting NIPT for high risk pregnancies:
5
![Page 6: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/6.jpg)
PRESENTATION-0029 vB
ACOG Practice Advisory on
Cell-Free DNA Screening
• April 2015: Committee opinion is being re-
evaluated based on extending testing to low risk
women.
• In response to additional publications - Large
Meta analysis & large study in low risk women.
![Page 7: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/7.jpg)
PRESENTATION-0029 vB
Glossary of Abbreviations
Abbreviation Meaning
NGS Next Generation Sequencing
MPS Massively Parallel Sequencing
NCV Normalized Chromosome Value
NIPT
NIPS
Noninvasive Prenatal Testing
Noninvasive Prenatal Screening
cfDNA Cell Free DNA
ART Assisted Reproductive Technology
SAFeR™ Selective Algorithm for Fetal Results
CPM Confined Placental Mosaicism
7
![Page 8: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/8.jpg)
History of antenatal testing 1966- amniocentesis
1970’s- age alone
1980’s
– AFP
– Triple screen- 72% detection 5% False positive
– Quad screen- 79% detection 5% False positive
– Penta screen- 83% detection 5% False positive
1980’s- CVS
1990’s –
– First Trimester screen- 80-85% 5% False positive
– Sequential screen 90-94% detection 3-5% FP
2010’s- Non-invasive prenatal diagnosis(placental fetal DNA)
![Page 9: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/9.jpg)
PRESENTATION-0029 vB
Prenatal Prevalence of Chromosomal
Abnormalities
53%
13%
5%
8%
5%
16%
Percent of Reported Chromosome Abnormalities
T21
T18
T13
45,X
Sex trisomy
Other rare
9
Data adapted from Wellesley, D, et al., Rare chromosome abnormalities, prevalence and prenatal diagnosis rates from population-based
congenital anomaly registers in Europe. Eur J of Hum Gen, 11 January 2012.
Four major
fetal trisomies
![Page 10: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/10.jpg)
Screening Tests
Definition – a test applied to an asymptomatic population in order to classify them with respect to their likelihood of having a specific condition
The difference between screening and diagnostic tests:
1. Screening tests give a risk for a condition
MSAFP, Multiple Marker Screen, Ultrasound for Down Syndrome
2. Diagnostic tests give a definitive result as to the presence or absence of a condition
Amniocentesis, Ultrasound for spina bifida
![Page 11: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/11.jpg)
PRESENTATION-0029 vB Reference: ACOG Practice Bulletin, Number 77, Jan 2007
Numerous Options with Variable
Performance
11
FASTER Trial Malone et al, NEJM, 2005
Modeled predicted performance
Cuckle et al, Semin Perinatol, 2005
![Page 12: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/12.jpg)
PRESENTATION-0029 vB
What are the Goals of NIPT?
12
Goals of
NIPT
Reduce exposure of fetus to
risk
Reduce false
positives
Enable a high
detection rate
Testing that can easily be offered to all
pregnant women*
*When data supports testing in all patients, instead
of only high risk patients.
![Page 13: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/13.jpg)
Technology Behind NIPT
![Page 14: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/14.jpg)
Circulating Cell Free Fetal DNA
1997 article by Lo in Lancet
– Lo YM, Corbetta N, Chamberlin PF et al. Presence of fetal DNA in
maternal plasma and serum. Lancet 1997;350: 485-487.
Based on previous findings of tumor DNA present in
patients with cancer
30 pregnant women with male fetuses
Serum and plasma analyzed
70 – 80% detection rate
Lo et al. Presence of fetal DNA in maternal plasma and serum. Lancet 1997
![Page 15: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/15.jpg)
PRESENTATION-0029 vB
Two Sources of Fetal DNA
Cell-free DNA (cfDNA)
– 2–20% of total cfDNA is fetal
– Requires DNA isolation and counting
– Counting method developed by Dr. Stephen Quake, Stanford University
Fetal cells
– 1 in a billion of total cell population
– Require isolation via mechanical and/or biochemical means
15
![Page 16: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/16.jpg)
Circulating Cell Free (ccff) Fetal
Source of ccff is thought to be from placental cells through breakdown of fetal cells in circulation
Circulating fetal DNA thought to comprise 3 – 6% of all DNA in circulating maternal plasma. Now it’s known to range from 3 – 40%, with an average of about 10%
Detection starting at as early as 5 weeks. Consistently seen at 10 weeks
Little risk of interference of ccf from previous pregnancies
Half-life of ccff is 15 minutes and is undetectable within 2 hours postpartum
Ehrich et al. Noninvasive detection of fetal T21 by sequencing of DNA in maternal blood. AJOG 2011
![Page 17: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/17.jpg)
Noninvasive Aneuploidy Detection
Aneuploidy detection is much more
challenging
– Single nucleotide polymorphisms
– DNA methylation (silencing)
– Fetal mRNA
![Page 18: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/18.jpg)
Cell-free fetal DNA
2007 Digital PCR
– Lo YM, Lun F, Chan KC, et al. Digital PCR for the
molecular detection of fetal chromosomal aneuploidy
2008 detection of Trisomy 21
– Chiu RW, Chan KC, Gao Y, et al. Noninvasive prenatal
diagnosis of fetal chromosomal aneuploidy by massively
parallel genomic sequencing of DNA in maternal plasma.
Proc Natl Acad Sci USA 2008;105:20458-20463
– Fan HC, Blumenfeld YJ, Chitkara U, Hudgins L, Quake
SR. Noninvasive diagnosis of fetal aneuploidy by shotgun
sequencing DNA from maternal blood. Proc Natl Acad Sci
USA 2008;105:16266-16271
![Page 19: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/19.jpg)
PRESENTATION-0029 vB
Massively Parallel Sequencing (MPS)
Method of analysis for verifi® prenatal test
19
Extract and Prepare
cfDNA Next-Gen Sequencing 1 2
![Page 20: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/20.jpg)
~10% of the DNA fragments in a pregnant
woman’s blood are from the fetus ( )
~90% are from the mother ( )
Schematic of DNA Fragments Isolated
From Maternal Plasma Containing Maternal
DNA and Euploid Fetal DNA
Schematic of DNA Fragments Isolated
From Maternal Plasma Containing Maternal
DNA, Fetal DNA and Extra Fragments of Chromosome 21
Contributed by a Fetal Trisomy 21
Euploid Fetus Fetus with Trisomy 21
Principles of Fetal Trisomy 21 Testing From a
Maternal Blood Sample Using DNA Sequencing
![Page 21: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/21.jpg)
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
Principles of Fetal Trisomy 21 Testing From a
Maternal Blood Sample Using DNA Sequencing
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21
GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
Sequencing tells you which
chromosome the ccf fragment
comes from
TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y
![Page 22: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/22.jpg)
Principles of Fetal Trisomy 21 Detection Using DNA
Sequencing
DNA MPS* does not differentiate which fragments come from the mother
and which from the fetus.
Unaffected Fetus Fetus with Trisomy 21
The quantitative over-representation
of Trisomy 21 fragments in an
affected pregnancy is significant
and can be measured with high
precision.
* MPS - Massively Parallel Sequencing
![Page 23: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/23.jpg)
“Counting Method” ofNIPT
23
2 ways to sequence
using cfDNA
Massively Parallel
Sequencing Targeted Sequencing
3 ways to analyze
Normalized
Chromosome Value
(NCV)
Estimate risk using
combination of
sequence data and
other factors
Z-Score
![Page 24: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/24.jpg)
NIPT Laboratories: Shifting Rapidly
Sequenom MaterniT21plus – launched 10/2011
Illumina (formally known as Verinata)
– Verifi - launched 3/2012
Skins: Counsyl Laboratory and Illumina.
LabCorp: developed test based on Verinata
bioinfomatics – InfomaSeq.
Ariosa Harmony – launched 6/2012 - To be bought by Roche soon.
Natera- data published in 2015.
![Page 25: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/25.jpg)
NIPT Laboratories: Shifting Rapidly
Ariosa will be changing their methodology from a
counting method of targeted sequencing to a
microarray testing method.
December 2014, it was announced that Illumina
and Sequenom will pool intellectual property
including patents. Illumina will have exclusive worldwide
rights to use IP to develop and sell IVD kits for NIPT. Illumina
will pay Sequenom 50 million upfront with additional payments.
Two companies outside of USA: PGI & Berry Genomics.
![Page 26: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/26.jpg)
Technology
Natera Verinata Natera
SNP technology Massively parallel
shotgun
sequencing
(MPSS)
SNP technology
Sequenom Verinata Ariosa
Massively parallel
shotgun
sequencing
(MPSS)
Massively parallel
shotgun
sequencing
(MPSS)
Digital analysis of
selected regions
(DANSR)
(soon to change to a
microarray method)
![Page 27: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/27.jpg)
Data Slides discussing the original
published papers of the primary 4
NIPT companies in the US are
included in the end of the lecture
slide set.
![Page 28: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/28.jpg)
Natera (SNP)
Technology based on Parental SupportTM
– Targeted sequencing approach measuring SNP’s, then incorporates
high fidelity parental allelic information and crossover frequency data
to model a set of hypothesis(monosomy, disomy and trisomy). Gives
maximum likelihood estimation.
![Page 29: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/29.jpg)
Addressing Unmet Needs in Prenatal Testing
• Develop a method for non-invasive detection of fetal aneuploidy that:
– Can test chromosomes 13,18, 21, X, and Y
– Performs equally well across all chromosomes
– Produces reliable results at low fetal fractions as early as 9 weeks gestation
– Sensitivity and specificity >99%
29
![Page 30: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/30.jpg)
How does Natera NIPT work?
Maternal blood
Buffy coat = Maternal DNA
Plasma = Maternal + Fetal DNA
SNP Sequencing
SNP Sequencing
Maternal Genotype
Maternal + Fetal Genotype
Target Fetal DNA
Signal
Fetal Genotype
A simplification of Natera’s non-invasive prenatal aneuploidy test
30
![Page 31: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/31.jpg)
NATUS – Next Generation Aneuploidy Testing Using SNPs
Data from Human Genome Project (HapMap)
High Throughput DNA Measurements on Mom & Dad
Noisy WGA Single Cell DNA Measurements
31
SNP targeted sequencing data From Mom (buffy coat) +/- Dad
+
Data from Human Genome Project (HapMap)
NATUS Algorithm
+
SNP targeted sequencing data from Fetal/Mat DNA mixture (plasma)
MLE technique selects hypothesis with the highest
confidence
Multiple hypotheses for each chromosome
Compare each sub-hypotheses to Fetal/Maternal DNA data
RESULT: •High Accuracy across chrom 13, 18, 21, X, Y • Calculated accuracy for each result
Sub-hypotheses with different crossover points
![Page 32: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/32.jpg)
Differences Panorama
– Distinguishes fetal chromosomes from maternal chromosomes.
– Can detect triploidy.
– Lags significantly behind others regarding published data.
– Very excited and very different technology.
– Cannot be used with egg donors.
– In other applications, they have experience with single gene disorders (i.e. preimplantation genetic diagnosis).
32
![Page 33: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/33.jpg)
Cost
![Page 34: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/34.jpg)
2012
![Page 35: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/35.jpg)
PRESENTATION-0029 vB
Future Directions for NIPT with MPS
Expanding patient eligibility: – Multiple gestations
– General population testing
Expanding menu content: – Other whole chromosome
aneuploidy
– Mosaic conditions (fetus, placenta, patient)
– Sub-chromosomal copy number variations
– Single gene disorders
MPS has potential for expanded use in prenatal testing
35
![Page 36: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/36.jpg)
Meta Analysis of NIPT (Feb 2015; handout)
37 Relevant studies.
5 had data from the general population (i.e. low
risk population).
Most were retrospective (stored samples with known
outcomes) or prospective (using high risk pregnancies
undergoing invasive testing).
Risks of bias thoroughly discussed.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 37: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/37.jpg)
Meta Analysis of NIPT (Performance of Screening for Aneuploidies)
Trisomy 21
– Unaffected = 21608; Affected = 1051.
– Detection rate = 99%.
– False Positive rate = 0.1%.
– Heterogeneity between studies was low.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 38: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/38.jpg)
Meta Analysis of NIPT (Performance of Screening for Aneuploidies)
Trisomy 18 & 13
– Unaffected = 21608
Affected + 18 = 389; +13 = 139.
– Detection rates
+ 18 = 96%; +13 = 91%.
– Combined (13 & 18) False Positive rate = 0.26%.
– FPR all 3 trisomies (21, 18 13) = 0.35% (4 fold increase).
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 39: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/39.jpg)
Meta Analysis of NIPT (Performance of Screening for Aneuploidies)
Sex Chromosome aneuploidies
– Affected 177 monosomy X + other (56) = 233.
– Detection rates 90% & 93% respectively.
– Combined FPR = 0.37%.
– Failure to provide a result – higher FPR.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 40: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/40.jpg)
Meta Analysis of NIPT (Performance of Screening for Aneuploidies)
Twin pregnancies
– Di/di twins: each fetus can contribute different amounts of
cfDNA, as much as 2 fold. The aneuploid fetus may have too low
of fetal fraction for detection.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 41: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/41.jpg)
Meta Analysis of NIPT (Clinical implications)
For singleton pregnancies, NIPT is superior to
all other methods.
Limitations for wide spread use:
– High Cost.
– Failure to provide a result.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 42: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/42.jpg)
Meta Analysis of NIPT (Clinical implications)
Contingent screening:
– Very High detection rate.
– Very low invasive testing rate.
– Considerably lower cost.
– For NIPT with a “no result call”, could rely on
biochemical screening to make invasive testing
decision.
– Still have the first trimester ultrasound with NT.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 43: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/43.jpg)
Meta Analysis of NIPT (Clinical implications)
Trisomy 18 & 13:
– Performance may be worse that Sequential
screening.
– Detection rates are similar.
– However, it may be lower if “No Calls” are
considered.
– Screening for all three aneuploidies increase the
FPR.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 44: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/44.jpg)
Meta Analysis of NIPT (Clinical implications)
Sex Chromosome aneuploidy:
– Questions whether it should be included.
Milder phenotype.
Higher failure rate – no result.
Lower detection rate.
Higher FPR.
Higher fetal mosaicism.
Detection of maternal sex chromosome aneuploidy.
Inclusion with DS screening increase FPR 8 fold to
0.72%.
Gil M.M. Ultrasound Obstet Gynecol 2015
![Page 45: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/45.jpg)
Nuchal translucency ultrasound Correct gestation age
Early diagnosis of fetal malformation
Diagnosis of multifetal gestation and
chorionicity
Can see cystic hygroma: 50% aneuploidy
– Most are T21 or Monosomy X,
– but there are rare, yet significant, other
chromosome abnormalities
Screening for low risk populations
![Page 46: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/46.jpg)
Microdeletions / Single Gene Test ? Fetal (Placental) karyotype?
Microdeletions:
– Several abstract presentations.
– Varies between laboratories.
– Difficult to evaluate – because rare.
– Likely to raise FPR.
– Increased cost with 3 of the 4 labs.
Case reports of achondroplasia & thanatophoric
Dwarism.
Rh genotype in fetus.
![Page 47: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/47.jpg)
Low Risk Population NEXT (noninvasive examination of trisomy)
Hypothesis: NIPT better screening tool than
biochemical screening.
Norton, ME, NEJM 2015
![Page 48: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/48.jpg)
Low Risk Population NEXT (noninvasive examination of trisomy)
Prompted ACOG statement
Prospective, multicentered, blinded study.
35 International centers.
Patients, 10-14 wks gestation, undergoing routine first
trimester screening (NT & Biochemical screening).
cfDNA results blinded.
Birth outcome: dx testing or newborn examination.
Norton, ME, NEJM 2015
![Page 49: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/49.jpg)
Low Risk Population NEXT (noninvasive examination of trisomy)
18,955 women enrolled.
15,841 results available for analysis.
Mean maternal age: 30.7 yrs.
Compared to standard screening.
Method: targeted sequencing (counting method)
76% less than 35 yrs of age.
Norton, ME, NEJM 2015
![Page 50: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/50.jpg)
NIPT detected 38/38 trisomy 21.
– 19 were in the low risk group.
First trimester screening 30/38 (No second
trimester test).
FPR 0.06 & 5.4% respectively.
PPV 80.9% vs 3.4%. (4/5 vs 1/30)
Norton, ME, NEJM 2015
Low Risk Population NEXT (noninvasive examination of trisomy)
![Page 51: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/51.jpg)
No results group:
– 13 aneuploidies (3 DS, 1 +18, 2 +13, 4 triploidy, 1
+16, 1 del11p, 1 with structurally abnormal
chromosome.
Prevalence higher than in the cohort with
results: 1/38 (2.7%) vs 1/236 (0.4%).
Among 6 common aneuploidies, each detected
with biochemical screening (risk range 1/26-1/2).
Norton, ME, NEJM 2015
Low Risk Population NEXT (noninvasive examination of trisomy)
![Page 52: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/52.jpg)
Higher sensitivity and specificity than
biochemical screening.
FPR 100 fold less than std screening.
Regardless of maternal age.
Higher cost.
Norton, ME, NEJM 2015
Low Risk Population NEXT (noninvasive examination of trisomy)
Conclusions
![Page 53: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/53.jpg)
3% did not reveal a result.
– May be related to increased maternal weight.
– May be related to an abnormal karotype.
– If these were included, the detection rate would
decrease.
– No consensus about: repeating NIPT, using
biochemical screening or offering diagnostic
testing.
Norton, ME, NEJM 2015
Low Risk Population NEXT (noninvasive examination of trisomy)
Conclusions
![Page 54: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/54.jpg)
Explanations for Discordant
Results
Confined placental mosaicism.
Fetal mosaicism.
Vanishing twin.
Maternal Karyotype.
Discordant twin karyotype.
Cancer.
![Page 55: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/55.jpg)
PRESENTATION-0029 vB
ACOG Practice Advisory April 2015
Still using 2012 committee opinion.
Positive result requires confirmation with
diagnostic test.
“No-call” group is at increased risk of
chromosomal abnormality.
– Tests that do not return results are typically excluded
from companies’ summary statistics leading to an
overstatement of the test preformance.
![Page 56: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/56.jpg)
PRESENTATION-0029 vB
ACOG Practice Advisory April 2015
Other screening modalities, biochemical and
ultrasound, will detect additional important
conditions not detected by NIPT.
All of these issues are true in high and low risk
populations, but more pronounced in the low risk
population (e.g. lower PPV).
![Page 57: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/57.jpg)
PRESENTATION-0029 vB
ACOG Committee Opinion on NIPT
“Cell free fetal DNA appears to be the most effective screening test for aneuploidy in high risk
women… is one option that can be used as a primary screening test in women at increased risk of
aneuploidy”
“[NIPT] should be an informed patient choice after pretest counseling”
“[NIPT] should not be offered to low-risk women or women with multiple gestations”
“A patient with a positive test result should be referred for genetic counseling and should be
offered invasive prenatal diagnosis for confirmation of test results.”
Also supporting NIPT for high risk pregnancies:
57
![Page 58: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/58.jpg)
Explaining test to Patients
Data
(Age,
Blood)
=
Modified (Personal) risk assessment
1 _____
X
1 _____
2 >
1 _____
10,000 <
1 _____
200 Seq vs NIPT
5% 1%
90% 99%
Positive rate:
Detection rate:
![Page 59: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/59.jpg)
Pre-lecture Questions: True or False
NIPT stands for NonInvasive Prenatal test. T
Considering current guidelines, all women should be offered NIPT
screening. F
All NIPT techniques preform similarly. T
The primary source of “fetal DNA” is from the fetus. F
The introduction of the NIPT test has reduced the number if invasive
tests. T
NIPT is the quickest test to go from publication to use to insurance
coverage in the history of medicine. T
The primary purpose of NIPT testing is to determine the gender of the
baby. F
A twin demise that appears to have died 4+ weeks earlier, will not
interfere with the NIPT analysis. F
![Page 60: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/60.jpg)
Kathryn Murray, MS, CGC
![Page 61: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/61.jpg)
FORTE vs. Z-score Comparison
Provides individualized risk
score
Accounts for fetal fraction
Can incorporate other
clinical risk factors
FORTE Z-Score • Groups all trisomies
into one category
• Does not factor in fetal
fraction
FORTETM (Fetal-fraction Optimized Risk of Trisomy Evaluation) – refers to the algorithm that incorporates DANSR assay results (chromosome counts, fetal fraction), and other clinical information to provide a individualized risk score
![Page 62: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/62.jpg)
Normalized chromosomal value
vs. Z-score method NCV
– #counts Chr 21/Counts
on Custom reference Chr
– High precision, removes
variation
– Maximizes dynamic
range
Z-score
– # counts Chr 21/# counts
all Chr
– GC correction
– Z-score result
– Sample to sample
variability
– Reduces dynamic range
![Page 63: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/63.jpg)
Risk Calculation
Z-score(Sequenom)
– Total maternal and fetal/total reference
– Mean chromosomal amount + 3 SD
– >3 is positive, <3 is negative
Normalized chromosomal value(Verinata)
– Total maternal and fetal/custom reference
– >4SD is positive, 2.5-4 is no-call, <2.5 is negative
FORTE(Fetal-fraction optimized risk of Trisomy Evaluation) (Ariosa)
– LR = cfDNA of specific chr/total cffDNA
– Provides individualized risk score
– Maternal age + GA x LR of result
– Accounts for fetal fraction
![Page 64: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/64.jpg)
Initial Study Data Sequenom Verinata Ariosa
total n= 2,437 651 4097
# of published
studies
4 3 4
T21 249 102 205
T18 62 44 113
T13 12 15 -
XO ? 19 - 20 -
2013 Publication
Clinical experience
(>6,000 spls)
within expected
performance parameters
2013 Poster presentation
Clinical experience
(>60,000 spls)
within expected
performance parameters Update
![Page 65: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/65.jpg)
Sensitivity/Specificity - Totals Sequenom Verinata Ariosa
T21 detection 249/251
(99.2%)
102/102
(100%)
205/205
(100%)
FPR 4/1880
(0.2%)
0/438 3/3547
(0.08%)
T18 detection 59/59
(>99.9%)
43/44
(97.7%)
111/113
(98.2%)
FPR 5/1688
(0.3%)
0/499 2/3547
(0.05%)
T13 detection 11/12
(91.7%)
11/15
(73.3%)
-
FPR 16/1688
(0.9%)
0/531 -
XO detection NA 15/16
(93.8%)
NA
FPR NA 0/464 NA
![Page 66: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/66.jpg)
MaterniT21plus (Sequenom)
Results: “Positive” vs. “Negative” based on z-score.
1% chance for no result
Determines whether or not a Y chromosome is
present.
Will accept samples on twins and IVF/egg donor
Long term potential for genome wide studies
![Page 67: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/67.jpg)
MaterniT21 (Sequenom)
![Page 68: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/68.jpg)
PRESENTATION-0029 vB
Verinata Health MELISSA Study
• Large-scale, prospective and blinded clinical validation
– High-risk patient population
– Singleton gestations analyzed
– Over 60 U.S. centers enrolled
• All samples with any abnormal karyotype analyzed
– Emulates real-world testing, fetal karyotype not known beforehand
• Samples analyzed for aneuploidy across the genome
– Demonstrates the true potential of verifi® test MPS technology
MatErnal BLood IS Source to Accurately Diagnose Fetal Aneuploidy
68
![Page 69: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/69.jpg)
PRESENTATION-0029 vB
MELISSA Study
• 2,882 samples collected
• 534 selected for analysis
– Including all abnormal karyotypes (N=221)
– Gestational age: 10 – 23 weeks
– BMI (kg/m2): 17 – 59
– Includes 38 ART pregnancies
– Diverse (27.3% non-white)
Study Design, Demographics
69
![Page 70: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/70.jpg)
PRESENTATION-0029 vB
MELISSA Study MPS Performance
70
Classified Sensitivity
(%)
95% CI Specificity
(%)
95% CI
Chromosome 21 100·0
(89/89)
95·9 - 100·0 100·0
(404/404)
99·1 - 100·0
Chromosome 18 97·2
(35/36)
85·5 - 99·9 100·0
(460/460)
99·2 - 100·0
Chromosome 13 78·6
(11/14)
49·2 - 95.3 100·0
(485/485)
99·2 - 100·0
Monosomy X 93·8
(15/16)
69·8 - 99·8 99·8
(416/417)
98·7 - >99.9
Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012
![Page 71: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/71.jpg)
PRESENTATION-0029 vB
Other Abnormal Karyotypes in MELISSA
Complex Karyotypes Detection
Mosaics (T21, T18) Demonstrated blinded detection (4/4)1
Robertsonian Translocations (T21, T13) Demonstrated blinded detection (3/3)1
Rare autosomal aneuploidies Demonstrated blinded detection (T16, T20)1
Sub-chromosomal Duplication Demonstrated blinded detection (38MB duplication on chromosome 6)2
Demonstrated Detection of Complex Karyotypes
71
1 Bianchi DW, et al. Obstet Gynecol. 2012 Mar;119(5):890-901. 2 Srinivasan et al., ASHG 2012 Abstract.
Note: verifi® test does not distinguish between full chromosome, mosaic, or translocation trisomy
![Page 72: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/72.jpg)
PRESENTATION-0029 vB
Product Profile
72
Chromosomes Analyzed 21, 18, 13, and (Optional) X and Y
Blood draw requirement 1 blood tube (7-10mL)
Patient Eligibility Validated in high risk pregnancies
Singletons at ≥10 weeks gestation
Egg donors accepted
Sample collection On-site collection kits, ambient shipping
Turn-around time 8 to 10 days
Clinical Support In-house genetic counselors for consultation with
healthcare providers
![Page 73: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/73.jpg)
PRESENTATION-0029 vB
verifi® prenatal test Results
verifi® test uses a unique dual threshold
classification system
Borderline results classified as
“Aneuploidy Suspected”
– Indicates borderline results where false
positive is more likely than “detected” results
– Occur in approximately 0.2-0.6% of results
per chromosome* UPDATE 6/13 They have
adjusted their algorithm with more narrow
“aneuploidy suspected” range.
A Safe and Effective Classification System
73
* Verinata Health, Inc - data on file.
Original Publication: Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012
![Page 74: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/74.jpg)
PRESENTATION-0029 vB
Dual Threshold Classification Indicates Borderline Results
74
VS.
Single Threshold
Method verifi® prenatal test
Dual Threshold
Trisomy
Diploid
![Page 75: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/75.jpg)
PRESENTATION-0029 vB
verifi® prenatal test
• Red alert at top to highlight abnormal results
• Abnormal results in table are highlighted in red
• Comments included to provide additional guidance
• Test claims restated as reference
Test Report
75
![Page 76: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/76.jpg)
PRESENTATION-0029 vB
Sex Chromosome Aneuploidy (SCA)
High incidence
• Affects 1 in 300-400 live births
• Monosomy X associated with high rate of spontaneous loss
• Mosaic forms common
Prenatal diagnosis difficult
• Not screened by current serum screens
• Ultrasound usually normal (except in monosomy X)
• Only diagnosed by invasive procedures
Detection of SCA has clinical utility
• Delivery management when ultrasound abnormalities present
• E.G. Monosomy X with cystic hygroma
• Early detection may help in early childhood intervention in SCA cases
76
![Page 77: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/77.jpg)
PRESENTATION-0029 vB
* False Positive Rate
Verinata Health publication “Analytical Validation of the verifi® prenatal test: Enhanced Test Performance for Detecting Trisomies 21, 18, and 13 and the Option for Classification of Sex
Chromosome Status”, Data on File. Original Publication: *Bianchi et al. Obstetrics and Gynecology, Vol 119, No. 5, May 2012
Sex Chromosome Option
77
(19/20
) (243/249
) (227/229
)
-
98.4%
99.0%
Accuracy Sensitivity
99.1%
97.6%
95.0%
XXX, XXY, XYY
XY
XX
Monosomy X 1.0%
0.8%
1.1%
FPR
*
Limited prevalence in clinical data precludes performance calculations
verifi® prenatal test Performance
![Page 78: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/78.jpg)
PRESENTATION-0029 vB
Fetal Sex Chromosome
determination • Both Verinata and Sequenom give results
regarding sex chromosomes:
• Verinata: with every report.
• Sequenom: reports whether Y is present or not
and only if they have evidence of SC aneuploidy.
• Sequenom Published paper:
• 6% not reportable rate.
• Lower accuracy than trisomies.
• Assumes mom is normal for sex chromosomes.
• CG composition of CG of X and Y is similar.
• Homology of Y chromosome and other chromosome
(i.e. decreased signal noise relationship)
• Y chromosome is small and there is wide variation
in measured representation.
![Page 79: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/79.jpg)
Harmony (Ariosa)
Prospective, blinded
– NICE trial
81/81 T21 1/2888 FP 0.03%
37/38 T18 2/2888 FP 0.07%
– 4.5% failure rate
– 39% of abnormal karyotypes were other than T21/T18
Norton ME, Brar H, Weiss J, et al. Non-
Invasive Chromosomal Evaluation(NICE)
Study: results of a multicenter prospective
cohort study for detection of fetal trisomy
21 and trisomy 18. AJOG 137.e1-e8. Aug
2012.
![Page 80: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/80.jpg)
Harmony (Ariosa)
Up to 4.6% chance for no result
Can’t do on twins or IVF with egg donor at this time
Technology may be limiting in the future
Offering to the general population
Results predict PPV and NPV allowing providers to counsel patients appropriately
Largest published data set
Inclusion of clinical information in risk assessment
Targeted sequencing means decreased cost
Future studies
– T13 validation
– NITE- 500 subjects. European eval of T21 and T18
– NEXT- 25,000 subjects comparing Harmony to current 1st trimester screening for
T21
![Page 81: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/81.jpg)
Harmony (Ariosa)
![Page 82: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/82.jpg)
DANSR vs Massively Parallel Shotgun Sequencing Assay Comparison
Chr 18 and 21 cfDNA
Other Chr cfDNA
Unmapped cfDNA
cfDNA in blood
DANSR (Directed analysis) MPSS (Random analysis)
Same cfDNA fragments from select
chromosomes analyzed every time
Only relevant cfDNA fragments go onto
DNA sequencing
96 patient samples analyzed
simultaneously
Random cfDNA fragments from all
chromosomes analyzed every time
All cfDNA fragments go onto DNA
sequencing regardless of relevance
4-8 patient samples analyzed
simultaneously
82
![Page 83: NIPT inservice talk May 2015](https://reader036.fdocuments.in/reader036/viewer/2022062406/55cd3943bb61eb23108b45cf/html5/thumbnails/83.jpg)
Previous NIPT Results – Proof of Concept Study
83
•166 Maternal blood samples, 9+ weeks •Confirmed by amnio/CVS or cord blood •145 euploid / 21 aneuploid •Includes T13, T18, T21, 45X, 47XXY
• 145 have high confidence at all 5 chrom
• >99% average confidence for all high confidence call chromosomes
• Nicolaides Paper 2013:
• 242 blinded high risk CVS.
• 229/242 results.
• 32/229 abnormal (+21, +18, +13, -X, triploidy)
• No false positive.
• No false negatives.
0
5
10
15
20
25
30
35
40
Fetal Fraction
All Correctly Called
Failed Quality Test
Zimmermann et al. Prenat Diag. 2012