Ngs webinar 2013

Sample & Assay Technologies

GeneRead DNAseq Targeted Exon Enrichment & GeneRead Library Quantification System for

Next Generation Sequencing

Shankar Sellappan, Ph.D.Global Product Manager

[email protected]

1

Sample & Assay Technologies Pathway-Focused Analysis Tools

2

Sample & Assay Technologies GeneRead DNAseq & Library Quant NGS System

3

Agenda

� Introduction� Targeted Enrichment

� Workflow� Principles� Data Analysis� Pathway Content� Performance Data� Application Example

� Library Quantification� Workflow� Application Example

� Summary

Sample & Assay Technologies Biological Markers Define Biological Processes

Cell cycle Angiogenesis

P53MDM2CyclinsCDKs

VEGFbFGF

ANGPTPDGF

IL8TLRIFNγTNFβ

Ind

ivid

ual

p

arti

cip

ants

Inflammation

4

Sample & Assay Technologies Complete Biological Story

Built on Pathway / Network Analysis

5

Pat

hw

ay

Cell cycle Angiogenesis Inflammation

Sample & Assay Technologies Determining DNA Differences

Patient sample = ATGCCATCTGGGACGGGTCAGTAGWild-type = ATGCCATCTGTGACGGGTCAGTAG

How could that SINGLE base difference make the person sick?

Let’s look at the amino acids that are translated in both samples:

Patient sample DNA = ATG CCA TCT GGG ACG GGT CAG TAGAmino Acid Sequence = Met P S G T G Q Stop

Compare the two amino acid sequences:

Patient sample AA Sequence = Met P S G T G Q StopWild-Type AA Sequence = Met P S V T G Q Stop

Valine Glycine

If the wild-type protein, with the Valine positioned here, looked like:

and in the patient sample, it is a Glycine, and it looks like:

Well….the protein just won’t work.

6

Sample & Assay Technologies What is NGS (Next Generation Sequencing)?

Massively Paralleled Sequencing

7

Instead of sequencing a DNA sequence from

Sequence many small pieces at the same time

Sample & Assay Technologies When doing NGS analysis, what are you looking for?

Easy-to-use workflow and Data output

Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample

Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered.

8

Sample & Assay Technologies Your NGS research needs

9

� Identify low frequency DNA mutation variants�Work with low quality DNA samples, such as FFPE

samples�Focus efforts on a focused set of genes important to

their research �Simple methodology to make variant calls�Selective sequencing saves sequencing capacity

Sample & Assay Technologies Traditional NGS Workflow

Isolate DNA

Library Prep & Quantification

NGS

Sequence Analysis & Variant ID

• Whole genome analysis• Too much irrelevant data• Poor quality reads / coverage

10

Sample & Assay Technologies New NGS Workflow with Targeted Enrichment

11

• Focused on your genes of interest• Why look at all 20,000

genes in the human genome when you are interested in only a few?

• Enables deep sequencing to ID low frequency mutation / rare variants

• Integrated controls to assess target enrichment

Achieve more sensitive mutation detection with 1 additional step

80 ng

Sample & Assay Technologies Target Enrichment: Principles

Multiplex PCR-enabled enrichment of gene of interest

Division of non-adjacent gene primer sets into 4 tubes increases amplification specificity.

12

We provide primer sets that produce overlapping PCR products• For any gene or set of genes in the human genome

Sample & Assay Technologies Targeted Enrichment: Details

13

~ 150 bp PCR products

Sample & Assay Technologies Complete Analysis Workflow

With integrated controls to assess sample quality / TE process

14

- QIAGEN GeneRead Library Preparation Kits (for IT and IL)- QIAGEN GeneRead Size Selection Kits- QIAGEN GeneRead Library Indexing Kits

Coming Soon!

- QIAGEN NGS Platform

Sample & Assay Technologies NGS Sequence Analysis and Variant ID Software

� FREE Complete & Easy to use Data Analysis with Web-based Software

15

Sample & Assay Technologies Read Mode: Paired End vs Single End

Goal: Increased # of Reads / Amplicon

TACGCATCGATGCGGTAACTGCTGATCGTCGTAGTGCTAGCTGA

Single End Sequencing:

Paired End Sequencing (both ends are sequenced):

Sequence of Interest:



AGTCGATCGTGATGCTGCTAGTCGTCAATGGCGTAGCTACGCAT

Sample & Assay Technologies How Genes on Panels Are Selected

Genes Involved in Disease

Genes with High Relevance

� Comprehensive Cancer Panel (124 genes)

� Disease Focused Gene Panels (20 genes)

� Breast cancer

� Colon Cancer

� Gastric cancer

� Leukemia

� ALSO AVAILABLE: Custom Panels from ANY GENE or COLLECTION OF GENES in Human Genome

� Biologically relevant gene content� Clinically relevant: Published association with the

disease state – Multiple Publically accessible databases– Text mining tools– Manually curated

� Technically relevant gene content� Most frequently mutated genes� Specific feedback from the thought leaders

Liver cancer

Lung Cancer

Ovarian Cancer

Prostate Cancer

17

Sample & Assay Technologies Targeted Enrichment: Panel Information

Sample & Assay Technologies NGS Target Enrichment Design Strategy

Commonly encountered issues solved by GeneRead Algorithm

19

• Design Coverage• How much of the gene is covered by your amplicons

• Sequence Coverage Uniformity• How much ease base pair is covered: Ideally, it should be uniform

• Specificity• % of reads mapped back to your sequence of interest

Sample & Assay Technologies Design Coverage Information Provided

Base Pairs Covered

20

Sample & Assay Technologies Coordinate Information

Sample & Assay Technologies BED File Information

22

C1 = Covered Regions

C*1 = Uncovered Regions

Sample & Assay Technologies Gene Visualization with UCSC Genome Browser

23

Instructions will be provided online at SABiosciences.com

Sample & Assay Technologies GeneRead DNAseq Gene Panel: Performance data

Design coverage

% C

ove

red

by

Des

ign

Discover more potential variants by covering more exons for genes of interest in assay design

GeneRead DNAseq Custom Panel

GeneRead DNAseq Lung Cancer Panel

GeneRead DNAseq Comprehensive Cancer Panel

24


Sequence coverage uniformity

More bases sequenced above minimum read depth, generating more high-quality consensus calls.




25

GeneRead DNAseq Gene Panel: Performance data

Sample & Assay Technologies Multiplexing Capacity of Target Enrichment

On Popular NGS Platforms

26


Specificity (On-target reads)*

Sp

ecif

icit

y(%

on

-tar

get

rea

ds)

No wasting of sequencing capacity




* On-Target Reads= Number of reads on target out of total number of reads per run

27

GeneRead DNAseq Gene Panel: Performance data

Sample & Assay Technologies DNAseq Gene Panel Application Data

KRAS:G12V is present in all three FFPE lung adenocarcinomas

Detection of Low Prevalence Somatic Mutation in FFPE Lung Adenocarcinoma Sample

Human Lung Cancer GeneRead DNASeq Gene panel was used to enrich 20 genes in genomic DNA isolated from three FFPE lung adenocarcinoma and one FFPE normal lung samples. Sequencing data was analyzed using QIAGEN NGS Data Analysis Web Portal and high quality variants were filtered.

NOTE: KRAS mutations confirmed by either Pyro or ARMS mutation assays (qBiomarker Somatic Mutation PCR Array)

28


Where does Library Quantification fit within the NGS workflow?

Next-generation sequencing workflow

GeneRead (DNAseq) Library Quantification and QC System

Sample enrichment

Purificationand

amplification

Library preparation

Next generation sequencing run

Result verification

Why do you want to:1. quantify their NGS DNA libraries2. know the quality of their NGS DNA libraries?

� You have to, in order to ensure high quality reads� Sequencing runs are expensive and time consuming, therefore, you want to ensure that

downstream sequencing analyses are performed on samples of adequate quality for NGS technology.

(Optional)

29

Sample & Assay Technologies Why choose qPCR for NGS Library Quantification?

1. BioAnalyzer measures total nucleic acids- Why is this a problem?

30

- For each technology, the greater the concentration of each sample (X-axis), the greater the # of clusters

- This should be a linear relationship

- Only qPCR provides this

2. Low limit of detection

3. Consistency of results

Sample & Assay Technologies NGS Library Quantification Made Easy

Adapters can be quantified with qRT-PCR

31

Step 4: You perform qPCR with your sample. It should fall between our standard curve created with 5 sequential 10-fold dilutions. THAT is your library concentration to use in preparing your NGS analysis.

Step 1: You have your DNA (whole genome or target enriched)

Step 2: You prepare the DNA library for NGS by adding (via ligation) NGS platform-specific adapters�� NOTE: The adapters are short pieces of DNA

Step 3: We provide you 2 reagents:1. Pre-aliquoted dilutions of the standard 2. qPCR Primer Assays that detect the adapters

Sample & Assay Technologies GeneRead DNAseq Library Quantification Array

Assess target enrichment / sample quality

32

Ratio of

Target DNA : Control DNA

Quality of DNA Input to NGS

Sample & Assay Technologies GeneRead Library Quantification System

NGS library quantification for any sequencing application

33

, Ion Proton

Sample & Assay Technologies GeneRead DNAseq & LQ System: Summary

� Focused:� Biologically relevant content selection enables deep sequencing on

relevant genes and identification of rare mutations

� Flexible: � Mix and match any gene of interest

� NGS platform independent: � Functionally validated for IT PGM, MiSeq/HiSeq

� Integrated controls:� Enabling quality control of prepared library before sequencing

� Free, complete and easy of use data analysis tool34


Questions?Contact Technical Support: 9 AM – 6 PM M – F ET

Contact: 1-800-742-4368 OR [email protected]

Shankar Sellappan, Ph.D. (Global Product Manager)[email protected]

Ph.D. Trained Application Scientists� Available Before, During, and After Your Experiments for Consultation / Help

GeneRead DNAseq Panel & Library Quant System for NGS

35

� Additional NGS Products� GeneRead rRNA Depletion Kit� REPLI-g Mini Kit

� Coming Soon� GeneRead Library Preparation Kits� GeneRead Size Selection Kits

Starter Pack PromotionAvailable to U.S. Customers- Look in email I send to you

Sample & Assay Technologies NOTES / ADDITIONAL INFORMATION

36

Sample & Assay Technologies Genomic Information

http://hgdownload.cse.ucsc.edu/downloads.html#human

37

Human Genome build 19: hg19

Sample & Assay Technologies FFPE process

Has deamination (C � T and A � G) events during formalin fixation

38

Sample & Assay Technologies GeneRead Gene Panel Mastermix

Has HotStart Taq… but not QIAGEN Hotstar Taq DNA Polymerase 203203

It does generate overhang A in PCR products

39

Sample & Assay Technologies Species Compatibility

40

We currently support human samples with our GeneRead NGS Target Enrichment Panels.

For the LQ kit (the generic version), it could be used on any species, as the adaptors are species independent.

Sample & Assay Technologies Working with UCSC Genome Browser: 2013-01-09

SOP: GeneRead DNAseq Gene Panels with UCSC Browser

41

1. Have BED file for gene list with amplicon coordinates2. Go to UCSC Genome Browser: http://genome.ucsc.edu/cgi-bin/hgGateway3. Click: add custom tracks


42

4. Upload BED file and hit Submit

5. Click ‘go to genome browser’


43

6. Zoom in and out or type in coordinates to move position

NOTE: We need to show what a missing base looks like

Sample & Assay Technologies Concentration Information: Illumina vs IT

Sample & Assay Technologies Mitochondrial Gene Enrichment

Content and Use of controls in LQ

45

Since our controls for targeted enrichment are against the genome, and this request is for a ‘custom panel for mitochondrial genes’, is there a point to use our DNAseq version of the library quantification kit if the controls aren’t assessed against mt DNA? And just sell the researcher the generic version of the LQ kit?

I don’t think our controls work on mtDNA, since the copy number ratio of mtDNA:gDNA varies from cell to cell.

13 genes and MT full length designed

Sample & Assay Technologies Multiplexing Samples: Must Index

46

Sample & Assay Technologies Your needs

47

Your needs

� Simple and easy to perform method, with convenient and high-throughput format

� Fast� Reliable and accurate quantification of sequencing targets� Unmet need: Assess quality of target enriched DNA

� Efficient use of NGS capacity

NGS methodology needs� Too much DNA

� Mixed signals and un-resolvable data� Too little DNA

� Reduced sequencing coverage� Reduced read depth� Empty runs� Increase cost per run� Wasted time

Potential problems in NGS if library not quantified

Potential methods for library QC

� qPCR� Bioanalyzer� Qubit

Ngs webinar 2013

Documents

Transcript of Ngs webinar 2013