INTERNATIONAL SEED TESTING ASSOCIATION www.seedtest.org

Seed quality is defined and measured along a number of axes:

• Is the seed of the right variety? ...Varietal ID tests • Is it genetically pure? ... Genetic purity tests • Does it contain the right traits …Trait purity tests • with no adventitious presence of unintended GM seed …AP/GMO tests • Is it physically pure (free from debris or inert matter)? …Purity tests • Is the seed free from disease and pathogens …Seed health tests • is the seed vigorous? …Cold test, Accelerated aging test • how well will it germinate? ...Warm test; Tetrazolium test

The way we define seed quality is not likely to change soon;

however, the methods we test it by are evolving constantly

Advances are driven by technology: New technological innovations enables new & Improved modes of testing.

http://www.englishblog.com/2009/03/cartoon-the-evolution-of-communication.html

“Making the leap”: From traditional (e.g. organismal) approaches to new (molecular) methodologies –

http://tomfishburne.com/2010/10/making-the-leap.html

Already employing advanced/new methods… Keeping up with advances: For example the evolution from SSRs to SNPs for genetic purity testing.

“Look Ma no hands… !!!”

ARCGA - Arnold Roth Deposit Collection, The Ohio State University Billy Ireland Cartoon Library & Museum

In this Session some of the new and emerging

technologies will be presented:

Next Generation Seed Quality Testing, Benjamin (Beni) Kaufman SpectraSeed: Seed phenotype database through spectral imaging, Jens Michael Carstensen, Karsten Hartelius and Kaare Jensen Seed identification of medicinal plant species using machine vision, Sepideh Anvarkhah, Mohammad Khajeh-Hosseini, Ali Davari Edalat Panah, Mohammad Hassan Rashed Mohassel. Development of a diagnostic tool and resource for seed identification with Lucid and imaging technologies, Ruojing Wang and Jennifer Neudorf An image analysis for determination of genetic purity of different wheat varieties Esmaeil N. Azar, Ghasem Tohidloo, Samad Mobasser, Majid D. Shoar and Fardin Khazaei Speed of seed imbibition related to seedling evaluation: precocious criteria from image analysis to predict the seedling type in a germination test. Marie-Hélène Wagner, Sylvie Ducournau, Valérie Blouin, Didier Demilly and Joël Lechappe Multiplex detection of plant pathogens, Jan J.H.W. Bergervoet, Marjanne M. de Weerdt, René R.A.A. van der Vlugt, Sharon S. Van Brunschot and José J.R.C.M. van Beckhoven

8 6/26/2013

*

Technical advances as they apply to: Genome analysis.

@Present: DNA Markers, a method for genome sampling

Slide Provided by Dr. Pegadaraju Venkatramana BioDiagnostics Inc.

ØNew Chemistries… § Isothermal amplification

§ Universal Probe chemistry

ØNew Platforms… §Miniaturization, High Through Put

ØNew Approach… § Next Generation Sequencing/ Sequence capture

*NūPCR is a probe-based qPCR technology that utilizes Illumina’s unique NūZyme chemistry

*NūZyme is a multipart nucleic acid enzyme (DNAzyme).

*All oligos must assemble on the target sequence in order for fluorescence to be generated (high specificity).

*Universal substrate results in cost savings

*4 dyes to choose from-allows multiplexing

New Chemistry

3-step real-time PCR protocol

Compatible with instruments from all major manufacturers

*Higher specificity

*Higher PCR efficiency

*Earlier Cq

*Higher multiplexing success rates

*Lower cost

vs.

Mostly by bringing competition to the qPCR Chemistry market. Its impact will depends on: Level of: “Signal to noise ” Variation Cost

EnviroLogix - Confidential Internal Use Only

ü The nicking enzyme nicks the target DNA

ü Polymerase attaches to

open 3’-end of nicked strand ü Polymerase extends and

displaces DNA strand with high processivity

New Chemistry

ü Reverse template anneals and polymerase extends

ü Forward template anneals and polymerase extends beyond Nicking Enzyme Recognition site

ü Nicking enzyme nicks ü Polymerase attaches and

extends

DNAbleTM Schematic

EnviroLogix - Confidential Internal Use Only

ü Formation of DNAbleTM Duplex ü Exponential Amplification

n Nick n Displace n Extend

ü Formation of amplification products

ü Detection

DNAbleTM Schematic

EnviroLogix - Confidential Internal Use Only

ØAssay can detect any reasonable DNA or RNA sequence

Ø“Crude” samples are compatible

ØTrue isothermal reaction

ØUtilizes 2 templates (primers), polymerase and nicking enzyme

* Enzymes allow direct amplification from genomic DNA

ØReaction volumes range from 1 μl to 50 μl.

ØReagents may be stabilized via lyophilization

ØDual detection allows for detection of internal control

ØMultiple readout options

* Real-Time via Molecular Beacons

* Endpoint via Molecular Beacons

* Lateral-flow detection with visual results

DNAbleTM Features:

DNAble “Impact Factor”:

Ø Isothermal reaction x Crude extract : May enable the development of “hand held” /”field” testing devices. Applicable at: Elevators for GMO testing Breeder’s field nursery for trait confirmation.

ØIsothermal x Possible small Reaction volumes Reagents may be stabilized via lyophilization

Dual detection (allows for detection of internal control) Amendable to high through-put in-line platforms

• In line multiple step processing (Assembly line)

• Continues feed ( high through put)

• Tape array (savings in consumables)

• Small reaction volume ( saving in reagents)

• Hands free ( savings in labor)

New Platforms:

15.30 DNA markers in purity testing (Beni Kaufman, Pioneer a DuPont Business, United States of America)

Nested Molecular Markers Battery for the testing of:

• Genetic Purity • Trait Purity • Varietal Identification • Essentially Derived Varieties (EDV) • Plant Varietal Protection

Trait Purity Genetic Purity

Varietal ID Essentially Derived Variety (EDV)

Plant Varietal Protection (PVP)

The number and genomic distribution of

the markers determines the depth and

resolution of the DNA fingerprint

obtained.

The closer the relatedness or genetic

similarity of individuals/ varieties/lines.

The higher the number of markers are

needed to tell them apart.

Slide Provided by Dr. Pegadaraju Venkatramana BioDiagnostics Inc.

Nested Markers to satisfy all purity applications:

Varietal ID

Genetic Purity

EDV

PVP BDI-III-XX

Why sample the genome - why not analyze whole genomic DNA sequences

*

Mark B. Gerstein, Yale University

DNA Segment

Whole Genome Sequencing

Fractional Sequencing Methods

RNA-Seq

Amplicon

RAD-Seq

Whole genome not always necessary…

Courtesy of Rick Nipper

Advantages

•Focus on Region of Interest with high Coverage

oQTL, Exon Only, etc…

•Multiplex many samples

Disadvantages •Reference Sequence must be available •Size restrictions 100kb-10Mb •Library Cost and/or Labor Sequence Capture

Methods/Vendors •Amplicon Pooling and Sequencing

•“Golden Gate” Type Probe Extension

•RainDance MicroDroplets

•NimbleGen On Array and In Solution

•Agilent On Array and In Solution •Upcoming:

wIllumina Custom PCR Plates/cRNA Probes wLife Tech Seq Cap for Ion

Restriction-site Associated DNA Sequencing (RAD-Seq)

*RAD-Seq uses restriction nucleases as a strategy to focus DNA sequencing on a small fraction of the target genome

*Despite the relatively small amount of the genome queried, thousands to hundreds of thousands of genetic variants can be readily identified.

RAD sequences

0.1% to

10%

of a selected genome

Courtesy of Rick Nipper

Chromosome

GTGGTCATGCATCGTAGTGCACATGGCATGTGCAGTCAT CACCAGTACGTAGCATCACGTGTACCGTACACGTCAGTA

enzyme recognition site

genomic sequence

Restriction Enzyme Digestion Sites

Sequence region around digestion site utilizing next-gen sequencing platform

Courtesy of Rick Nipper

CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT

Sample I

CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCAACTCGT CACCAGTACGTAGCAACTCGT

Sample II

Sample 1 Genotype:

C/C

Sample 2 Genotype:

C/A

Examine sequence data from individual locus: Identify variants and determine genotypes

TCAGTACACGTGCACCAGTACGTAGCATCTCGT

Chromosome

Courtesy of Rick Nipper

Nested Molecular Markers Battery for the Testing of:

• Genetic Purity • Trait Purity • Varietal Identification • Essentially Derived Varieties (EDV) • Plant Varietal Protection

By way of TARGATED SEQUENCING

• One run through - will have all the sequence information for all tests. • Data analysis will target sequences associated with test of interest • Stored data can always be accessed and additional mining/analysis done

Why stop here…

Seed testing:

• Is the seed of the right variety? ...Varietal ID tests • Is it genetically pure? ... Genetic purity tests • Does it contain the right traits …Trait purity tests • with no adventitious presence of unintended GM seed …AP/GMO tests • Is it physically pure (free from debris or inert matter)? …Purity tests • Is the seed free from disease and pathogens …Seed health tests • Is the seed vigorous? …Cold test, Accelerated aging test • How well will it germinate? ...Warm test; Tetrazolium test

Ö Ö

Ö

Ö Ö

Whole Genome Association (& QTL) studies identify genomic sequences associated with the traits of interest see for example:

* Bogamuwa, S., Jang, J.-C. The Arabidopsis tandem CCCH zinc finger proteins AtTZF4, 5 and 6 are involved in light-, abscisic acid- and gibberellic acid-mediated regulation of seed germination (2013) Plant, Cell and Environment. Article in Press.

* Abe, A., Takagi, H., Fujibe, T., Aya, K., Kojima, M., Sakakibara, H., Uemura, A., Matsuoka, M., Terauchi, R. OsGA20ox1, a candidate gene for a major QTL controlling seedling vigor in rice (2012) Theoretical and Applied Genetics, 125 (4), pp. 647-657.

* Davar, R., Majd, A., Darvishzadeh, R., Sarrafi, A. Mapping quantitative trait loci for seedling vigour and development in sunflower (Helianthus annuus L.) using recombinant inbred line population (2011) Plant OMICS, 4 (7), pp. 418-427.

* Quantitative trait loci analysis for rice seed vigor during the germination stage. Wang ZhouFei; Wang JianFei; Bao YongMei; Wang FuHua; Zhang HongSheng; Zhejiang University Press, Hangzhou, China, Journal of Zhejiang University (Science B), 2010, 11, 12, 958-964

Is This Feasible ?

The information is there, so is the technology – someone needs to put it together

Is This Feasible ?

Economically – The more testing needs are satisfied per sequencing effort the more economical feasible/favorable it is: • Varietal ID tests $100

• Genetic purity tests $100 • Trait purity tests $60 • AP/GMO tests $150 • Cold test $35 • Germ test $40 • Total: $485

Targeted sequencing: RAD: $175 Other: $200

37

Data2Bio’s tGBS technology stringently controls the fraction of genome that is sequenced and genotyped. Reads are clustered at few sites: • Minimizes missing data across lines; enhances repeatability • 100s-60,000 SNPs (“tunable”); adequate for most applications,

including QC • High confidence SNP calls • Can confidently genotype heterozygous loci, even in species

without a reference genome

Line 1

Line 2

*Potentially it is possible to test simultaneously all the seed attributes.

*Highest possible resolution *It has the promise to be economical BUT:

Not everything is genetics! Environmental factors can not be predicted

therefore

Some “Standard Seed Testing” will always be required!

“Impact Factor” ?

Gina Zastrow-Hayes DuPont Pioneer

Rick Nipper Floragenex

Satish Rai Douglas Scientific

Daniel Shaffer Envirologix

Todd Deppe Margaret Esser Illumina

Pat Schnable Data2Bio Iowa State University Pegadaraju Venkatramana

BioDiagnostics Inc.

43

Line 1

Line 2

• ~1M sites, i.e., more than is required for most applications, including seed quality applications

• SNP calls based on few reads (error rate). Can not call heterozygotes

• Limited overlap of sites among lines leads to missing data across samples

• Requires imputation (heavy-duty bioinformatics) - difficult in species without a reference genome