Next generation seed quality testing

download Next generation seed quality testing

If you can't read please download the document

  • date post

    11-Jan-2017
  • Category

    Documents

  • view

    214
  • download

    1

Embed Size (px)

Transcript of Next generation seed quality testing

  • INTERNATIONAL SEED TESTING ASSOCIATION www.seedtest.org

  • Seed quality is defined and measured along a number of axes:

    Is the seed of the right variety? ...Varietal ID tests Is it genetically pure? ... Genetic purity tests Does it contain the right traits Trait purity tests with no adventitious presence of unintended GM seed AP/GMO tests Is it physically pure (free from debris or inert matter)? Purity tests Is the seed free from disease and pathogens Seed health tests is the seed vigorous? Cold test, Accelerated aging test how well will it germinate? ...Warm test; Tetrazolium test

    The way we define seed quality is not likely to change soon;

    however, the methods we test it by are evolving constantly

  • Advances are driven by technology: New technological innovations enables new & Improved modes of testing.

    http://www.englishblog.com/2009/03/cartoon-the-evolution-of-communication.html

  • Making the leap: From traditional (e.g. organismal) approaches to new (molecular) methodologies

    http://tomfishburne.com/2010/10/making-the-leap.html

  • Already employing advanced/new methods Keeping up with advances: For example the evolution from SSRs to SNPs for genetic purity testing.

    Look Ma no hands !!!

    ARCGA - Arnold Roth Deposit Collection, The Ohio State University Billy Ireland Cartoon Library & Museum

  • In this Session some of the new and emerging

    technologies will be presented:

  • Next Generation Seed Quality Testing, Benjamin (Beni) Kaufman SpectraSeed: Seed phenotype database through spectral imaging, Jens Michael Carstensen, Karsten Hartelius and Kaare Jensen Seed identification of medicinal plant species using machine vision, Sepideh Anvarkhah, Mohammad Khajeh-Hosseini, Ali Davari Edalat Panah, Mohammad Hassan Rashed Mohassel. Development of a diagnostic tool and resource for seed identification with Lucid and imaging technologies, Ruojing Wang and Jennifer Neudorf An image analysis for determination of genetic purity of different wheat varieties Esmaeil N. Azar, Ghasem Tohidloo, Samad Mobasser, Majid D. Shoar and Fardin Khazaei Speed of seed imbibition related to seedling evaluation: precocious criteria from image analysis to predict the seedling type in a germination test. Marie-Hlne Wagner, Sylvie Ducournau, Valrie Blouin, Didier Demilly and Jol Lechappe Multiplex detection of plant pathogens, Jan J.H.W. Bergervoet, Marjanne M. de Weerdt, Ren R.A.A. van der Vlugt, Sharon S. Van Brunschot and Jos J.R.C.M. van Beckhoven

  • 8 6/26/2013

  • *

    Technical advances as they apply to: Genome analysis.

    @Present: DNA Markers, a method for genome sampling

    Slide Provided by Dr. Pegadaraju Venkatramana BioDiagnostics Inc.

  • New Chemistries Isothermal amplification Universal Probe chemistry

    New Platforms Miniaturization, High Through Put

    New Approach Next Generation Sequencing/ Sequence capture

  • *NPCR is a probe-based qPCR technology that utilizes Illuminas unique NZyme chemistry

    *NZyme is a multipart nucleic acid enzyme (DNAzyme).

    *All oligos must assemble on the target sequence in order for fluorescence to be generated (high specificity).

    *Universal substrate results in cost savings

    *4 dyes to choose from-allows multiplexing

    New Chemistry

  • 3-step real-time PCR protocol

    Compatible with instruments from all major manufacturers

  • *Higher specificity *Higher PCR efficiency

    *Earlier Cq *Higher multiplexing success rates

    *Lower cost

    vs.

  • Mostly by bringing competition to the qPCR Chemistry market. Its impact will depends on: Level of: Signal to noise Variation Cost

  • EnviroLogix - Confidential Internal Use Only

    The nicking enzyme nicks the target DNA

    Polymerase attaches to

    open 3-end of nicked strand Polymerase extends and

    displaces DNA strand with high processivity

    New Chemistry

  • Reverse template anneals and polymerase extends

    Forward template anneals and polymerase extends beyond Nicking Enzyme Recognition site

    Nicking enzyme nicks Polymerase attaches and

    extends

    DNAbleTM Schematic

    EnviroLogix - Confidential Internal Use Only

  • Formation of DNAbleTM Duplex Exponential Amplification

    n Nick n Displace n Extend

    Formation of amplification products

    Detection

    DNAbleTM Schematic

    EnviroLogix - Confidential Internal Use Only

  • Assay can detect any reasonable DNA or RNA sequence

    Crude samples are compatible

    True isothermal reaction

    Utilizes 2 templates (primers), polymerase and nicking enzyme

    * Enzymes allow direct amplification from genomic DNA

    Reaction volumes range from 1 l to 50 l.

    Reagents may be stabilized via lyophilization

    Dual detection allows for detection of internal control

    Multiple readout options

    * Real-Time via Molecular Beacons

    * Endpoint via Molecular Beacons

    * Lateral-flow detection with visual results

    DNAbleTM Features:

  • DNAble Impact Factor:

    Isothermal reaction x Crude extract : May enable the development of hand held /field testing devices. Applicable at: Elevators for GMO testing Breeders field nursery for trait confirmation.

    Isothermal x Possible small Reaction volumes Reagents may be stabilized via lyophilization

    Dual detection (allows for detection of internal control) Amendable to high through-put in-line platforms

  • In line multiple step processing (Assembly line)

    Continues feed ( high through put)

    Tape array (savings in consumables)

    Small reaction volume ( saving in reagents)

    Hands free ( savings in labor)

    New Platforms:

  • 15.30 DNA markers in purity testing (Beni Kaufman, Pioneer a DuPont Business, United States of America)

    Nested Molecular Markers Battery for the testing of:

    Genetic Purity Trait Purity Varietal Identification Essentially Derived Varieties (EDV) Plant Varietal Protection

    https://www.seedtest.org/upload/cms/user/ISTA-June11-Seminar-1530-Kaufman.pdf

  • Trait Purity Genetic Purity

    Varietal ID Essentially Derived Variety (EDV)

    Plant Varietal Protection (PVP)

  • The number and genomic distribution of

    the markers determines the depth and

    resolution of the DNA fingerprint

    obtained.

    The closer the relatedness or genetic

    similarity of individuals/ varieties/lines.

    The higher the number of markers are

    needed to tell them apart.

    Slide Provided by Dr. Pegadaraju Venkatramana BioDiagnostics Inc.

  • Nested Markers to satisfy all purity applications:

    Varietal ID

    Genetic Purity

    EDV

    PVP BDI-III-XX

  • Why sample the genome - why not analyze whole genomic DNA sequences

  • *

  • Mark B. Gerstein, Yale University

  • DNA Segment

    Whole Genome Sequencing

    Fractional Sequencing Methods

    RNA-Seq

    Amplicon

    RAD-Seq

    Whole genome not always necessary

    Courtesy of Rick Nipper

  • Advantages

    Focus on Region of Interest with high Coverage oQTL, Exon Only, etc

    Multiplex many samples

    Disadvantages Reference Sequence must be available Size restrictions 100kb-10Mb Library Cost and/or Labor Sequence Capture

    Methods/Vendors Amplicon Pooling and Sequencing

    Golden Gate Type Probe Extension

    RainDance MicroDroplets

    NimbleGen On Array and In Solution

    Agilent On Array and In Solution Upcoming:

    wIllumina Custom PCR Plates/cRNA Probes wLife Tech Seq Cap for Ion

  • Restriction-site Associated DNA Sequencing (RAD-Seq)

    *RAD-Seq uses restriction nucleases as a strategy to focus DNA sequencing on a small fraction of the target genome

    *Despite the relatively small amount of the genome queried, thousands to hundreds of thousands of genetic variants can be readily identified.

    RAD sequences

    0.1% to

    10%

    of a selected genome

    Courtesy of Rick Nipper

  • Chromosome

    GTGGTCATGCATCGTAGTGCACATGGCATGTGCAGTCAT CACCAGTACGTAGCATCACGTGTACCGTACACGTCAGTA

    enzyme recognition site

    genomic sequence

    Restriction Enzyme Digestion Sites

    Sequence region around digestion site utilizing next-gen sequencing platform

    Courtesy of Rick Nipper

  • CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT

    Sample I

    CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCACCTCGT CACCAGTACGTAGCAACTCGT CACCAGTACGTAGCAACTCGT

    Sample II

    Sample 1 Genotype:

    C/C

    Sample 2 Genotype:

    C/A

    Examine sequence data from individual locus: Identify variants and determine genotypes

    TCAGTACACGTGCACCAGTACGTAGCATCTCGT

    Chromosome

    Courtesy of Rick Nipper

  • Nested Molecular Markers Battery for the Testing of:

    Genetic Purity Trait Purity Varietal Identification Essentially Derived Varieties (EDV) Plant Varietal Protection

    By way of TARGATED SEQUENCING

    One run through - will have all the sequence information for all tests. Data analysis will target sequences associated with test of interest Stored data can always be accessed and additional mining/analysis done

    Why stop here

  • Seed testing:

    Is the seed of the right variety? ...Varietal