Neurochemistry of the mammalian cone ‘synaptic...

Vision Research 38 (1998) 1359–1369

Neurochemistry of the mammalian cone ‘synaptic complex’

Noga Vardi a,*, Katsuko Morigiwa b, Tian-Li Wang a, Yi-Jun Shi a, Peter Sterling a

a Department of Neuroscience, 122B Anatomy-Chemistry Building, Uni6ersity of Pennsyl6ania School of Medicine, Philadelphia,PA 19104-6058, USA

b Department of Physiology, Osaka Uni6ersity Medical School, Osaka 565, Japan

Received 20 June 1997

Abstract

The cone ‘synaptic complex’ is a unique structure in which a single presynaptic axon secretes glutamate onto processes ofbipolar cells (both ON and OFF) and horizontal cells. In turn, the horizontal cell processes antagonize cone and bipolar responsesto glutamate (probably by GABA). What still remains largely unknown is the molecular identity of the postsynaptic receptors andtheir exact locations. We identified several subunits of the glutamate receptor and the GABAA receptor expressed at the conesynaptic complex and localized them ultrastructurally. Glutamate receptors: (i) Invaginating (probably ON) bipolar dendrites inthe monkey and rat express the metabotropic glutamate receptor, mGluR6. The stain is intense on the dendritic membrane whereit first enters the invagination, and weak at the tip nearest to the ribbon. The cone membrane is electron-dense where it apposesthe intense stain for mGluR6. Surprisingly, invaginating bipolar dendrites in the cat also express the AMPA receptor subunits,GluR2/3 and GluR4. (ii) Dendrites forming basal contacts in the cat (probably OFF) express the AMPA subunits GluR2/3,GluR4, and also the kainate subunit, GluR6/7. The stain is especially intense at the dendritic tips in apposition to electron-denseregions of cone membrane. (iii) Horizontal cells in the cat express the AMPA subunits GluR2/3, GluR4 and the kainate subunit,GluR6/7. The stain is strongest in the cytosol of somas and primary dendrites, but is also present in the invaginating terminalswhere it localizes to the membrane subjacent to the ribbon. GABAA receptors: (i) ON and OFF bipolar dendrites in the monkeyexpress the a1 and b2/3 subunits. The stain is localized to the bipolar cell membrane in apposition to horizontal cell processes.(ii) Cones did not express the GABAA subunits tested by immunocytochemistry, but b3 mRNA was amplified by RT-PCR fromrat photoreceptors. Conclusions: (i) mGluR6 receptors concentrate on dendrites at the base of the invagination rather than at theapex. This implies that receptors at both ‘invaginating’ and ‘basal’ contacts lie roughly equidistant from the release sites andshould therefore receive similar spatiotemporal concentrations of glutamate. (ii) The ‘cone’ membrane is electron-dense oppositeto the receptor sites on both ON and OFF bipolar cells. This suggests a special role for this region in synaptic transmission.Possibly, these densities signify a transporter that would regulate glutamate concentration at sites remote (\200 nm) from thelocus of vesicle release. © 1998 Elsevier Science Ltd. All rights reserved.

Keywords: Glutamate receptors; GABA receptors; Bipolar cells; Horizontal cells; mGluR6

1. Introduction

The first visual synaptic relay, i.e. the cone synapticcomplex, is unique among CNS synapses both in itscomplexity and specialization. The cone terminal itselftransmits to as many as 500 postsynaptic elements [1,2]belonging to about 12 different cell types [3–7]. Also atthis complex, processes of horizontal cells feed lateralinformation to both cones and bipolar cells [8–10]. Thesynaptic contacts in this complex are highly specialized,and two in particular, the ‘invaginating’ and the ‘basal’

contact, have received attention [11]. At the invaginat-ing contact, synaptic vesicles which are tethered to thesynaptic ribbon are ‘docked’ where the ribbon anchorsto the presynaptic membrane. Postsynaptically, thereare two lateral horizontal cell processes directly appos-ing the presynaptic release sites and 1–4 central bipolardendrites (commonly ON) located farther from therelease sites. At the basal (or flat) contact, the coneemploys an electron-dense membrane which lacks clus-tered vesicles and apposes a bipolar cell dendrite (com-monly OFF), whose membrane is also electron-dense.Another contact, possibly important but neglected, ex-ists between the cone and the ON bipolar dendrites at

* Corresponding author. Tel.: +1 215 8984520; fax: +1 2158989871; e-mail: [email protected].

0042-6989/98/$19.00 © 1998 Elsevier Science Ltd. All rights reserved.

PII: S0042-6989(98)00007-8

N. Vardi et al. / Vision Research 38 (1998) 1359–13691360

the mouth of the invagination. Here the cone mem-brane is electron-dense with ‘fluffy’ submembranousmaterial, but the apposing bipolar membrane appearsunspecialized [12,13].

The chemical architecture of the cone synaptic com-plex is less understood. The cone transmitter has beenidentified as glutamate [14], but the exact identity andlocalization of the receptors for glutamate have notbeen established. Horizontal cells in the cat and mon-key are thought to be GABAergic because they con-tain GABA and glutamic acid decarboxylase (GAD)[15–17], but this remains controversial in other spe-cies. For example, in rabbits, GABA and GAD65 aredown-regulated during development [18] and GABAcannot be detected in the horizontal cell terminals inthe adult [19]. However, recent evidence show that allhorizontal cell terminals, in the adult, do expressGAD67 [20]. The mechanism of release is also not wellunderstood. GABA is thought to be released by atransporter mediated mechanism [21], but the trans-porter has not been identified [22]. Postsynaptically,several subunits of the GABAA receptor are associ-ated with the synaptic complex, but none so far werelocalized to photoreceptors. Here we summarize ourprogress on these issues.

2. Methods

2.1. Tissue preparation

Eyes were obtained from an adult monkey, cat andrat under deep pentobarbital anesthesia. Monkey reti-nas were obtained from the laboratory of Dr EhudKaplan (M. fascicularis ; for GABAA receptor local-ization), and from the Primate Center (Alice, TX; M.mulatta ; for mGluR6 localization). All experiments in-volving animals were done in compliance with Federalregulations and the University of Pennsylvania policy.Following enucleation, the animals were sacrificed byanesthetic overdose. The posterior half of each eyewas fixed by immersion for 1 h either in buffered 4%paraformaldehyde and 0.01% glutaraldehyde, for mostexperiments, or in a mixture of 4% paraformaldehyde,0.05% glutaraldehyde and 0.2% picric acid for thelocalization of GABAA receptors. Following fixation,the eyes were rinsed in buffer, soaked overnight in30% buffered sucrose, and freeze thawed (1–3 times).A piece of retina, about 1 mm dorso-lateral to theoptic disk, was cut out, embedded and sectioned atthe Vibratome (50–100 mm).

2.2. Immunocytochemistry

Sections were incubated in primary antibody dilutedin phosphate buffer including 10% normal goat serum

and 5% sucrose for 2 days in 4°C; rinsed; incubatedin secondary antibody conjugated to horseradish per-oxidase (HRP) for 3 h in room temperature, rinsedand developed with 3,3%-diamino-benzidine tetrahy-drochloride (DAB). For certain experiments the DABreaction product was intensified by the gold-substi-tuted silver-intensified peroxidase method (after [23]modified from [24]). The tissue was then osmicated(1.5% osmium tetroxide, 60 min); dehydrated in 50%and 70% methanol; stained with 1% uranyl acetate in70% methanol (60 min); dehydrated in methanol;cleared in propylene oxide; and embedded in Epon812. Ultrathin sections (silver-gold) were mounted onformvar-coated slot grids and stained lightly with leadcitrate and uranyl acetate.

2.3. Antibodies

Polyclonal antibody for the rat mGluR6 (gener-ously donated by Dr Nakanishi; used at 1:1000) wasgenerated against a synthetic peptide corresponding tothe carboxy-terminus of this receptor. Its specificitywas previously established [25]. Polyclonal antibodyfor human mGluR6 was also generated against thecarboxy-terminus of this receptor, but this sequencediffered from that of the rat [26] (used at 1:5000); itscharacteristics will be described elsewhere. Polyclonalantibodies against the carboxy-termini of GluR1, 2/3and 4 (1:60–80) were obtained from Chemicon Inter-national (Temecula, CA). Polyclonal antibody forGluR 6/7 (1:100) was kindly provided by Dr RichardL. Huganir (Howard Hughes Medical Institute, JohnHopkins School of Medicine, Baltimore, MD). All ofthese antibodies recognized the intracellular domainsof the receptors. Monoclonal antibodies for theGABAA a1 and b2/3 subunits (bd-24 and bd-17, re-spectively) were generously donated by Dr J.G.Richards, and they recognized an epitope located onthe extracellular domain of the receptor subunits.

2.4. Reconstruction and cell identification in the ratstained for mGluR6

Cone pedicles, horizontal cell terminals, and conebipolar dendritic tips were reconstructed according topreviously published methods [5,27] from 31 serial sec-tions (total thickness of about 2.5 mm). Several criteriawere used to discriminate between cell profiles: (i) Conepedicles have dark cytoplasm packed with synapticvesicles; (ii) Horizontal cell terminals invaginate thepedicle, and their cytoplasm is very pale; (iii) Horizon-tal cell dendritic stalks approaching the pedicle weretraced to their invaginating terminals so as to distin-guish them from bipolar dendritic tips; (iv) Bipolardendritic tips are typically apposed to dense cone mem-brane; and (v) Half of the bipolar dendritic tips were

N. Vardi et al. / Vision Research 38 (1998) 1359–1369 1361

Fig. 1. Immunostaining for mGluR6 (monkey, peripheral cone terminals, electron micrographs). The stain (gold particles) is present ininvaginating bipolar (ib) dendrites that occupy the central position of the synaptic triad. The stain is not present in dendrites forming flat (or basal)contacts (f). Small arrows point to synaptic ribbons. h, horizontal cell terminals; c, region of cone terminal that apposes the invaginating bipolarcell.

Fig. 2. Immunostaining for mGluR6 (rat, electron micrograph). The cone pedicle (outlined) forms ‘basal-like’ contacts (double arrows) with somestained dendrites and invaginating contacts (ib) with others. Roughly half of the dendrites contacting the cone are stained. Invaginating unstainedprocesses near synaptic ribbons (r) are horizontal cell terminals, two of which are labeled (h).

stained with gold-intensified DAB, so they could bediscriminated from the neighboring unstained tips.

2.5. Photoreceptor isolation

Rat retina was cut into pieces and incubated inHanks medium (Gibco BRL Products, Gaithersburg,MD) containing 0.5 mM EDTA, 0.1 mg/ml cysteineand 0.8 mg/ml papain (Worthington Blochemical, Free-hold, NJ) for 5–10 min at 28–30°C. Pieces of retinawere then rinsed in Hanks buffer, and gently trituratedwith a fire polished pipette (1.5 mm tip diameter). Adrop of the cell suspension was diluted ten-fold, and

placed on a glass cover slip coated with concanavalin A(Sigma, St. Louis, MO). Cells were allowed to settle forabout 10 min and viewed under an upright LaborluxLeitz microscope. Photoreceptors (isolated or small ag-gregates) were aspirated into a conventional glass mi-cro-electrode with a tip diameter of 1–2 mm. Theaspirated cells were expelled into a micro-tube and keptfrozen until use.

2.6. RT-PCR

Total RNA (either from the rat whole retina or fromgroups of dissociated photoreceptors) was extracted


Fig. 3. Immunostain for mGluR6 is present in most serially reconstructed invaginating cone bipolar cells (rat). (A): Tracing of two radial sectionsof the same pedicle (medium shade) showing two ribbons (r), horizontal cell terminals (light shade), stained bipolar dendrites (dark shade) andunstained bipolar dendrites (unshaded). The stained dendrite marked by ‘*’ in both sections is the same: it forms an invaginating contact in section3 and a ‘basal like’ contact in section 7. (B): Cone pedicles, ribbons and dendritic tips were reconstructed from 31 radial sections. The outline ofthe cone pedicle in the tangential plane was determined, and ribbons and dendritic tips were projected onto this plane. Because a three-dimensionalimage is projected to a two-dimensional plane, the actual projections are complicated and overlapping. Therefore, the structures were simplified,and are represented as dark lines for ribbons, filled circles for stained dendritic tips, and empty circles for unstained dendritic tips. Circles designatedby ‘i’ are invaginating dendritic tips found to be associated with a ribbon. This figure illustrates that: (i) about half of the dendritic tips were stained;(ii) most stained dendritic tips are associated with a ribbon; and (iii) most unstained dendritic tips are farther away from the ribbon.

Fig. 4. Localization of immunostaining for mGluR6 within the invaginating dendrite (ib) in the rat (A) and monkey (B; electron micrographs).Stain (large arrows) concentrates at the base of the dendritic tip which apposes the electron dense region of the cone terminal (c). Stain is absentat the apex of the dendrite which apposes the horizontal cell terminal (h). In A, the triad is shown in a typical view as a cross-section; note thatthe invaginating dendrite is located about 400 nm from the ribbon (site of exocytosis). In B, the triad was sectioned parallel to its long axis, thusonly one horizontal cell terminal (h) is seen, and it parallels the ribbon (small arrow). The dendrite labeled ‘ib’ can be identified as an invaginatingbipolar dendrite both by its position below the horizontal cell terminal and by the electron dense cone membrane apposing it.


Fig. 5. Immunostaining for ionotropic receptor subunits (cat; electron micrographs). (A): GluR6/7. A stained dendrite forms a basal contact(arrow). The invaginating bipolar (ib) and other bipolar cells were unstained in this section. (B): GluR2/3. Stained invaginating dendrite (ib). (C):GluR6/7. Paired horizontal cell terminals in a tangential view at a region of apposition. A synaptic ribbon is present in an adjacent section,approximately 100 nm above this plane. Stain (arrows) is present in one of the terminals along the line of apposition. r, ribbon; h, horizontal cellterminal.

Fig. 6. Immunostaining for GABAA, a1 (monkey). The stain concentrates on bipolar cell dendrites beneath cone pedicles, and in apposition tohorizontal cells. The stain is present at both invaginating (ib) and flat (f) dendritic tips. This cannot be due to diffusion of DAB reaction productbecause the stain is absent from the cleft between horizontal processes (h) and cones (c). Regions of bipolar membrane apposing horizontal cellprocesses (long arrows) stain more strongly than other regions (short arrows). r, ribbon.

and purified (acid-guanidium and phenol-chloroform).Reverse transcription (RT) was carried out on 2–5 mgtotal RNA in 20 ml buffer containing 50 mM Tris–HCl, pH 7.4, 60 mM KCl, 10 mM MgCl2, 1 mMdithiothreitol (DTT), 1 U/ml RNase inhibitor, 0.5mM of each dNTP, 500 pmole of random hexamer(or 100 pmole oligodT) and 200 U of Super II M-MLV reverse transcriptase (Gibco BRL, Gaithersburg,MD). The RT reaction was run at 42°C for 50 min;

PCR was run with 2 ml of the cDNA products fromthe RT reaction. The PCR buffer contained 10 mMTris–HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.4mM dNTP, 0.2 mM 5% and 3% primers and 2.5 U ofAmpliTaq (Perkin Elmer Cetus, Norwalk, CT). PCRwas performed on a programmable thermocycler(Perkin Elmer) with the following parameters: 94°C 4min, 30–45 cycles of 94°C 1 min, 50°C 1 min, 72°C 2min, then extend at 72°C 10 min. Specific oligonucle-


Fig. 7. PCR product for GABAA b subunits. (A): A schematic showing the position of the primers (numbers below the RNA strand), and theexpected size of the PCR product (numbers above the bar, in kbp). (B and C): Total RNA (2–5 mg) isolated from either whole retina (B) orphotoreceptors (rod and cone; C) was subjected to reverse transcription and PCR amplification using specific primers for b1, b2 and b3 subunits.(B): All three messages were amplified from whole retina mRNA, and the PCR products were at the expected length (30 cycles). The signal forthe b2 subunit (arrow) is weak and not sufficiently specific. (C): Only the message for the b3 subunit was amplified from the isolatedphotoreceptors (45 cycles). M, marker.

otide primers for the b subunits of the GABAA recep-tor were synthesized (Gibco-BRL products, Gaithers-burg, MD) with the following sequences:

b1:5% primer: CAAGACCAGAGTGCCAATGAA3% primer: GCCCTCACGGCTGCTCAGTGG

b2:5% primer: AGATTATAAACTCATCACCAAG3% primer: CTCGTTGTTGGCATTAGCAGCb3:5% primer: GATCGATCCAAGAGTGAAATC3% primer: CGTCTTCTTGTGCGGGATGCT

Fig. 8.

Fig. 8. Tentative match of receptor localization to specialized junc-tions at the cone synaptic complex. Schematic after Raviola andGilula [13]. The following numbers refer to labeled regions on thediagram. (1) Cone-to-horizontal cell terminal: presynaptic conemembrane with particles is presumed to include Ca2+ channels forexocytosis. Horizontal cell membrane in apposition to this regionof the cone contains intramembrane particles on the A face. Thisregion stains for AMPA/kainate receptor subunits (GluR2/3,GluR4 and GluR6/7). Note that the electron-dense membrane ofthe horizontal cell extends above region 1, where it does not con-tain intramembranous particles. This is labeled region 6. (2) Cone-to-OFF bipolar cell (basal junction): presynaptic cone membraneand postsynaptic bipolar membrane are electron-dense and containparticles. GluR subunits (2/3, 4 and especially 6/7) localize to theelectron-dense dendritic membrane. (3) Cone-to-ON bipolar cell:cone membrane is electron-dense, but lacks particles. Opposingthis region is the region of bipolar dendritic membrane that stainsfor mGluR6; this membrane is not electron dense. The invaginat-ing ON bipolar cell dendrite also stains for the AMPA receptorsubunits GluR2/3 and GluR4, but their precise localization wasnot determined. (4) Horizontal cell terminal-to-ON bipolar den-drite: the presynaptic horizontal cell membrane is electron-dense,but the ON bipolar dendritic membrane lacks intramembrane par-ticles. GABAA receptor localize to this unspecialized region. (5)Horizontal cell terminal-to-OFF bipolar dendrite: GABAA receptorlocalize to the OFF bipolar dendrite in apposition to an ascendinghorizontal cell process below the cone pedicle. (6) Horizontal cellterminal-to-cone (predicted): at the upper slope of the synapticridge, the horizontal cell membrane is electron-dense, but lacksintramembrane particles, so it probably does not contain glutamatereceptors. This region is the only specialized region between hori-zontal cells and cones (except region 1), suggesting it might be thesite of synaptic feedback. This membrane might express a GABAtransporter. GABA receptors (e.g. the b3 subunit) might reside atthe apposing unspecialized cone membrane.


3. Results

3.1. Localization of the mGluR6 receptor in the rat andmonkey

The metabotropic glutamate receptor mGluR6 wasidentified in the rat retina and localized to the dendritictips of the rod bipolar cell [25,28–30]. Activation ofthis receptor by glutamate or the specific agonist 2-amino-4-phosphonobutyric acid (L-AP4) hyperpolar-izes this cell type via a trimeric G-protein coupled to asecond messenger cascade [31–34]. ON cone bipolarcells are similarly hyperpolarized by L-AP4 [35,36],implicating mGluR6 as a possible glutamate receptorhere as well. We immunostained the rat and monkeyretinas for mGluR6 and asked whether some or all ONcone bipolar cells express mGluR6 and where it local-izes at the subcellular level. To identify the ON cells wefirst looked at peripheral cone terminals in the monkeybecause here, all invaginating dendrites are ON, andquite likely all dendrites forming basal contacts areOFF [2]. In other mammalian retinas, this segregationinto invaginating/ON, basal/OFF, is true for most celltypes, but not all [11,37,38].

At peripheral cone terminals of the monkey, allinvaginating dendrites were stained, and all dendritesforming basal contacts were unstained (Fig. 1). Thissuggests that most, and possibly all, ON cone bipolarcell types express mGluR6. At cone terminals of the rat,about half of all dendritic tips contacting the cone(41/79) stained for mGluR6 (Fig. 2), suggesting thatabout half of the bipolar cell types express this recep-tor. Many of the stained dendrites contacted the coneat basal-like junctions. The cone membrane apposingthese stained dendrites was often electron-dense, butwhether the bipolar membrane was electron-dense orsimply dark due to the immunostain was not clear.These contacts, therefore, may not have been true basaljunctions. Close observation of serial sections revealedthat a given dendrite may form a contact at the conebase in one section, and occupy the central elementposition in another (Fig. 3A). This is not unique to therat, since in the cat, cb6, an invaginating ON conebipolar cell, also forms basal contacts [37]. We havetherefore traced all the stained dendrites of two pediclesin serial sections [39] and determined if they occupy thecentral element of the triads. This revealed that nearly70% (28/41) of the stained dendrites terminated ascentral elements of the triad (Fig. 3), suggesting thatthey are ON cells. Thus, for two species with twodifferent antibodies, most ON bipolar types expressmGluR6.

When staining intensity in the invaginating dendrites(both the monkey and rat) was relatively weak, it didnot concentrate at the apex, i.e. at the region nearestthe site of vesicular release. It concentrated near thebase of the invaginating dendritic tips, particularly at

the region apposed to the cone. Just beneath the conemembrane at this site is a layer of fluffy electron-densematerial (Fig. 4).

3.2. Localization of ionotropic glutamate receptorsubunits in the cat

The glutamate receptor in horizontal cells and OFFbipolar cells is ionotropic (AMPA/kainate) [14,40].However, which subunits are expressed by a given celltype is unknown. We applied antibodies raised againstthe AMPA-sensitive subunits GluR2/3, GluR4 and thekainate-sensitive subunit GluR6/7 to the cat and mon-key, but since staining in the cat was stronger, we usedthis species for further analysis at the electron micro-scope level [41]. Immunoreactivity for other ionotropicglutamate receptor subunits have not been thoroughlyanalyzed here, but are present in retina as shown bylight microscopy [42–44].

OFF bipolar cell dendritic tips expressed all threesubunits (GluR2/3, GluR4 and GluR6/7). The stainwas strongest at the basal contact, subjacent to theelectron-dense postsynaptic membrane (Fig. 5A). Thecone membrane at this site bears a layer of fluffyelectron-dense material, resembling that observed oppo-site to the mGluR6 receptor. Quite unexpectedly, den-dritic tips of invaginating bipolar cell also expressed theAMPA-sensitive subunits (GluR2/3 and GluR4) (Fig.5B). Whether or not this includes all invaginating den-drites could not be determined here [41,45]. Also, wewere unable to determine if these receptors andmGluR6 are present in the same membrane region.

Horizontal cells expressed all three subunits quitestrongly in their somas and primary dendrites, butweakly or not at all in their terminals (Fig. 5A and B).When stain was observed in the horizontal cell termi-nals, it appeared at the electron-dense membrane, sub-jacent to the presynaptic ribbon. In several instances,we observed the stain for GluR6/7 in a tangential viewof the horizontal cell terminals sectioned just below theribbon. The stain was distributed along the electron-dense horizontal cell membrane, facing the other hori-zontal cell terminal (Fig. 5C). Apparently, theionotropic glutamate receptor is located on a narrowstrip of horizontal cell membrane along the synapticridge.

3.3. Localization of GABAA receptor subunits in themonkey

Since horizontal cells in the cat and monkey proba-bly use GABA as their neurotransmitter [17], we exam-ined the localization of the a1 and b2/3 subunits of theGABAA receptor in the cone synaptic complex of thesespecies [46,47]. Both subunits were expressed in theouter plexiform layer, in association with the conesynaptic complex. Here we show the staining obtained


for the a1 subunit in the monkey. The stain was restrictedto the plasma membrane (Fig. 6). Both presynaptic andpostsynaptic membranes were stained because the anti-body recognizes the extracellular domain of the a1subunit and the DAB reaction product in the extracellu-lar space diffuses across the synaptic cleft. Such stainingof presynaptic membrane has been also reported in othersynapses in the central nervous system [48–50]. Thestrongest stain was observed in regions of appositionbetween horizontal cell processes and bipolar cell den-drites (both OFF and ON). Regions of appositionbetween horizontal cell process and cone pedicle, andbetween adjacent horizontal cell processes, were un-stained (Fig. 6).

Cone pedicles (and also rod spherules) were unstainedby antibodies to the a1 and b2/3 subunits, and byantibodies to other subunits of GABAA and GABAC

receptors [51–56]. Possibly, the expression level is belowthreshold of immunostaining. Indeed, several subunitswere found positive in the rat photoreceptors by in-situhybridization (a, b1, and b3) [52,54] and by reversetranscription and polymerase chain reaction (RT-PCR;b1 and b2) [57]. Since these data were not consistent were-investigated this question by RT-PCR using differentsets of primers applied to total RNA from isolatedphotoreceptors.

3.4. Identification of GABAA subunits in the ratphotoreceptors

When mRNA was amplified from whole retina byRT-PCR using specific primers for b subunits (b1, b2and b3), all three subunits were amplified (Fig. 7A). Butwhen mRNA was amplified from photoreceptors, onlythe b3 subunit was amplified (Fig. 7B). PCR for wholeretina and photoreceptor cDNA were processed in par-allel. To control for possible contamination by cells frominner retina mRNA, we attempted to amplify the GluR6mRNA. This message could be amplified from wholeretina mRNA, but not from the isolated photoreceptors.To control for contamination from the pipettes, weattempted to amplify samples of water and cDNAcontaining the b1 and b2 clones. These samples were notamplified using specific primers for the b3 subunit.

4. Discussion

The glutamate and GABA receptors localized to thecone synaptic complex by immunocytochemistry corre-spond to junctions previously identified by morphology[12,13,58,59]. Fig. 8 summarizes these possible corre-spondences. AMPA/kainate receptors on the horizontalcells populate the electron-dense membrane beneath thevesicular release site of the cone terminal. They arerestricted to the membrane region that contains in-

tramembrane particles [13]. AMPA/kainate receptors onOFF bipolar cells populate electron-dense membrane atthe basal junction, and this membrane also containsintramembrane particles. mGluR6 and GABAA recep-tors on ON bipolar dendrites populate unspecializedregions that lack intramembrane particles. GABAA re-ceptors at other locations in the retina and brain also lackintramembrane particles [60–62]. The cone and horizon-tal cell membranes that appose these receptors areelectron-dense with a fluffy submembranous material.

4.1. Implications of receptor location for synaptictransmission at the cone synaptic complex

4.1.1. Cone to bipolar dendriteThe glutamate receptors on bipolar dendrites are all

located at relatively large distances from the site ofvesicular release. mGluR6 localizes not to the apex, butto the base of the invaginating dendritic tip (monkey) orto the basal-like junction (rat). Similarly, AMPA/kainatereceptors localize to basal junctions. The distance fromrelease sites to receptors on bipolar dendrites ranges from80 to 1300 nm [39,58,63]. By comparison, the distancefrom release sites to AMPA/kainate receptors on hori-zontal cells is less than 20 nm. The unusually largedistance of the bipolar cell receptors may ensure that asingle vesicle will deliver a slowly rising and slowly fallingglutamate concentration, apparently matched to theEC50 for these receptor types [64].

The cone membrane in apposition to both types ofglutamate receptor bears a noticeable layer of fluffyelectron-dense material, and this might contribute tosynaptic signaling. One idea is that this region hosts aglutamate transporter. Such molecules are known to bepresent in photoreceptors [65–68], and their locationnear the postsynaptic receptor would be effective inremoving the glutamate directly from the synaptic cleft.

4.1.2. Horizontal cell to bipolar cellGABAA receptors in the monkey are present on OFF

and ON bipolar dendritic tips. This observation is robust,having been demonstrated with antibodies against twodifferent subunits. Furthermore, ON rod bipolar den-drites stain for the GABAC receptor [55] and express aCl− current when GABA is applied [69–71]. All of theseobservations suggest that the monkey horizontal cellterminals release GABA onto both OFF and ON bipolardendrites.

This is puzzling. One can easily understand the pres-ence of GABAA receptors on OFF bipolar dendritesbecause the light in the ‘surround’ would suppressGABA release from horizontal cells, and antagonize thehyperpolarizing ‘center’ response of the cone bipolar.But it is harder to understand the presence of GABAA

receptors on ON bipolar dendrites. Light in the sur-round would suppress GABA release from horizontal


cells, and ‘facilitate’ the depolarizing center response,which would be the opposite of what is observed[72,73]. One way out of this conundrum would be tohold the chloride equilibrium potential of ON bipolarcell dendrites low enough that suppression of GABArelease would hyperpolarize the cell.

The horizontal cell membrane apposed to theGABAA receptor on bipolar dendrites bears a fluffy,submembranous electron-dense material. Since horizon-tal cells probably release GABA via a transporter-medi-ated mechanism [21,74], this region might host aGABA transporter.

4.1.3. Horizontal cell to coneWe expected a synapse from the horizontal cell to the

cone, because of evidence that the mammalian cone hasan inhibitory surround [75,76]. However, none of theGABAA subunits localized to cone membrane.Nonetheless, since all of the receptors that we didlocalize were present in apposition to an electron-densemembrane, we looked for this in horizontal cell termi-nals. At the upper slope of the synaptic ridge thehorizontal cell membrane is electron-dense (Fig. 8, re-gion 6). Since it seems not to stain for AMPA/kainatereceptor and lacks intramembrane particles [13], it isprobably not part of the cone-to-horizontal cellsynapse. Possibly, this region represents the feedbacksynapse from horizontal cell to cone. GABA receptorsmight reside in apposition to this electron-dense regionat the unspecialized cone membrane. The receptormight contain the GABAA b3 subunit since this sub-unit was detected in photoreceptors by RT-PCR (thisstudy), and by in-situ hybridization [52]. Using differentprimer sets, Grigorenko and Yeh [57] reported b1 andb2 mRNA expression by RT-PCR. Therefore, thequestions of which subunits are expressed by photore-ceptors and whether horizontal cell feedback to mam-malian cone is exerted by GABA or a differentneurotransmitter remain unsettled.

Acknowledgements

We thank Sally Shrom and Tina Geueke for techni-cal assistance, and Dan Jurow for reading themanuscript. Supported by EY11105, EY00828,EY08124.

References

[1] Missotten L. The Ultrastructure of the Human Retina. Brussels:Editions Arscia S.A., 1965.

[2] Chun M-H, Grunert U, Martin PR, Wassle H. The synapticcomplex of cones in the fovea and in the periphery of themacaque monkey retina. Vis Res 1996;36:3383–95.

[3] Boycott BB, Dowling JE. Organization of the primate retina:Light microscopy. Philosophical Trans R Soc (Lond) B1969;255:109–84.

[4] Kolb H, Nelson R, Mariani A. Amacrine cells, bipolar cells andganglion cells of the cat retina: a Golgi study. Vis Res1981;21:1081–114.

[5] Cohen E, Sterling P. Demonstration of cell types among conebipolar neurons of cat retina. Philosophical Trans R Soc (Lond)B 1990;330:305–21.

[6] Boycott BB, Wassle H. Morphological classification of bipolarcells of the primate retina. Eur J Neurosci 1991;3:1069–88.

[7] Grunert U, Martin PR, Wassle H. Immunocytochemical analysisof bipolar cells in the macaque monkey retina. J Comp Neurol1994;348:607–27.

[8] Baylor DA, Fuortes MGF, O’Bryan PM. Receptive fields ofcones in the retina of the turtle. J Physiol 1971;214:265–94.

[9] Tachibana M, Kaneko A. Gamma-aminobutyric acid acts ataxon terminals of turtle photoreceptors: Difference in sensitivityamong cell types. Proc Natl Acad Sci USA 1984;81:7961–4.

[10] Sterling P, Smith RG, Rao R, Vardi N. Functional architectureof mammalian outer retina and bipolar cells. In: Archer S,Djamgoz MBA, Vallerga S, editors. Neurobiology and ClinicalAspects of the Outer Retina. London: Chapman and Hall,1995:325–348.

[11] Kolb H, Nelson R. The organization of photoreceptor to bipolarsynapses in the outer plexiform layer. In: Djamgoz MBA, ArcherSN, Vallerga S, editors. Neurobiology and Clinical Aspects ofthe Outer Retina. London: Chapman and Hall, 1995:273–296.

[12] Lasansky A. Cell junctions at the outer synaptic layer of theretina. Invest Ophthalmol 1972;11:265–75.

[13] Raviola E, Gilula NB. Intramembrane organization of special-ized contacts in the outer plexiform layer of the retina. J CellBiol 1975;65:192–222.

[14] Massey SC, Maguire G. The role of glutamate in retina circuitry.In: Wheal H, Thomson, A, editors, Excitatory Amino Acids andSynaptic Transmission. 2nd ed. Academic Press, 1995:201–221.

[15] Chun MH, Wassle H. GABA-like immunoreactivity in the catretina: electron microscopy. J Comp Neurol 1989;279:55–67.

[16] Pourcho RG, Owczarzak MT. Distribution of GABA im-munoreactivity in the cat retina: A light- and electron-micro-scopic study. Vis Neurosci 1989;2:425–35.

[17] Vardi N, Kaufman DL, Sterling P. Horizontal cells in cat andmonkey retina express different isoforms of glutamic acid decar-boxylase. Vis Neurosci 1994;11:135–42.

[18] Messersmith EK, Redburn DA. The role of GABA duringdevelopment of the outer retina in the rabbit. Neurochem Res1993;18:463–70.

[19] Pow DV, Levick WR. Is amino methyl phosphonic acid anendogenous GABA ligand in adult rabbit horizontal cells? InvestOphthalmol Vis Sci 1997;38:S617 (Abstract).

[20] Johnson M, Vardi N. Regional differences in GABA and GADimmunoreactivity in rabbit horizontal cells. 1998; Vis Neurosci(in press).

[21] Schwartz E. Depolarization without calcium can release gamma-aminobutyric acid from a retinal neuron. Science 1987;238:350–5.

[22] Johnson J, Chen T-K, Rickman DW, Evans C, Brecha NC.Multiple gamma-aminobutyric acid plasma membrane trans-porters (GAT-1, GAT-2, GAT-3) in the rat retina. J CompNeurol 1996;375:212–24.

[23] Sassoe-Pognetto M, Wassle H, Grunert U. Glycinergic synapsesin the rod pathway of the rat retina: Cone bipolar cells expressthe alpha-1 subunit of the glycine receptor. J Neurosci1994;14(8):5131–46.

[24] van den Pol AN. Silver intensification of colloidal gold orhorseradish peroxidase for dual ultrastructural immunocyto-chemistry. In: Van Leeuwen FW, Buijs RM, Pool CW, Pach O,


editors. Molecular Neuroanatomy. Elsevier Science, 1988:315–336.

[25] Nomura A, Shigemoto R, Nakamura Y, Okamoto N, MizunoN, Nakanishi S. Developmentally-regulated postsynaptic local-ization of a metabotropic glutamate-receptor in rat rod bipolarcells. Cell 1994;77:361–9.

[26] Duvoisin RM, Vardi N. The mGluR6 L-AP4 receptor is ex-pressed in both rod and cone ON bipolar cells in primate retina.Soc Neurosci 1996;21 (Abstract).

[27] Smith RG. Montage: A system for three-dimensional reconstruc-tion by personal computer. J Neurosci Methods 1987;21:55–69.

[28] Nakajima Y, Iwakabe H, Akazawa C, Nawa H, Shigemoto R,Mizuno N, Nakanishi S. Molecular characterization of a novelretinal metabotropic glutamate receptor mGluR6 with a highagonist selectivity for L-2-amino-4-phosphonobutyrate. J BiolChem 1993;268:11868–73.

[29] Hartveit E, Brandstatter JH, Enz R, Wassle H. Expression of themRNA of seven metabotropic glutamate receptors (mGluR1 to7) in the rat retina. An in situ hybridization study on tissuesections and isolated cells. Eur J Neurosci 1995;7:1472–83.

[30] Hartveit E. Functional organization of cone bipolar cells in therat retina. J Neurophysiol 1997;77:1716–30.

[31] Slaughter MM, Miller RF. 2-amino-4-phosphonobutyric acid: anew pharmacological tool for retina research. Science1981;211:182–4.

[32] Nawy S, Jahr CE. Suppression by glutamate of cGMP-activatedconductance in retinal bipolar cells. Nature 1990;346:269–71.

[33] Shiells RA, Falk G. Glutamate receptors of rod bipolar cells arelinked to a cyclic GMP cascade via a G-protein. Proc R Soc(Lond) B 1990;242:91–4.

[34] Yamashita M, Wassle H. Responses of rod bipolar cells isolatedfrom the rat retina to the glutamate agonist 2-amino-4-phospho-nobutyric acid (APB). J Neurosci 1991;11:2372–82.

[35] de la Villa P, Kurahashi T, Kaneko A. L-glutamate-inducedresponses and cGMP-activated channels in retinal bipolar cellsdissociated from the cat. J Neurosci 1995;15:3571–82.

[36] Euler T, Schneider H, Wassle H. Glutamate responses of bipolarcells in a slice preparation of the rat retina. J Neurosci1996;16:2934–44.

[37] Nelson R, Kolb H. Synaptic patterns and response properties ofbipolar and ganglion cells in the cat retina. Vis Res1983;23:1183–95.

[38] McGuire BA, Stevens JK, Sterling P. Microcircuitry of bipolarcells in cat retina. J Neurosci 1984;4:2920–38.

[39] Vardi N, Morigiwa K. ON cone bipolar cells in rat express themetabotropic receptor mGluR6. Vis Neurosci 1997;14:789–94.

[40] Hamassaki-Britto DE, Hermans-Borgmeyer I, Heinemann S,Hughes TE. Expression of glutamate receptor genes in themammalian retina: the localization of GluR1 through GluR7mRNAs. J Neurosci 1993;13(5):1888–98.

[41] Morigiwa K, Vardi N. Differential expression of AMPA/kainatereceptor subunits in cat outer retina. 1998;(submitted).

[42] Peng Y-W, Blackstone CD, Huganir RL, Yau K-W. Distribu-tion of glutamate receptor subtypes in the vertebrate retina.Neuroscience 1995;66:483–97.

[43] Qin P, Pourcho RG. Distribution of AMPA-selective glutamatereceptor subunits in the cat retina. Brain Res 1996;710:303–7.

[44] Brandstatter JH, Koulen P, Wassle H. Kainate receptors in therat retina. Invest Ophthalmol Vis Sci 1997;38:s689 (Abstract).

[45] Hughes TE. Are there ionotropic glutamate receptors on the rodbipolar cell of the mouse retina? Vis Neurosci 1997;14:103–9.

[46] Vardi N, Masarachia P, Sterling P. Immunoreactivity toGABAA receptor in the outer plexiform layer of the cat retina. JComp Neurol 1992;320:394–7.

[47] Vardi N, Sterling P. Subcellular localization of GABAA receptoron bipolar cells in macaque and human retina. Vis Res1994;34:1235–46.

[48] Richards JG, Schoch P, Haring P, Takacs B, Mohler H. Resolv-ing GABAA/benzodiazepine receptors: Cellular and subcellularlocalization in the CNS with monoclonal antibodies. J Neurosci1987;7:1866–86.

[49] Somogyi P, Takagi H, Richards JG, Mohler H. Subcellularlocalization of benzodiazepine/GABAA receptors in the cerebel-lum of rat, cat, and monkey using monoclonal antibodies. JNeurosci 1989;9:2197–209.

[50] Nusser Z, Roberts JDB, Baude A, Richards JG, Sieghart W,Somogyi P. Immunocytochemical localization of the a1 andb2/3 subunits of the GABAA receptor in relation to specificGABAergic synapses in the dentate gyrus. Eur J Neurosci1995;7:630–46.

[51] Brecha NC. Expression of GABAA receptors in the vertebrateretina. Prog Brain Res 1992;90:3–28.

[52] Greferath U, Muller F, Wassle H, Shivers B, Seeburg P. Local-ization of GABAA receptors in the rat retina. Vis Neurosci1993;10:551–61.

[53] Greferath U, Grunert U, Muller F, Wassle H. Localization ofGABAA receptors in the rabbit retina. Cell Tiss Res1994;276:295–307.

[54] Greferath U, Grunert U, Fritschy JM, Stephenson A, Mohler H,Wassle H. GABAA receptor subunits have differential distribu-tions in the rat retina: In situ hybridization and immunohisto-chemistry. J Comp Neurol 1995;353:553–71.

[55] Enz R, Brandstatter JH, Wassle H, Bormann J. Immunocyto-chemical localization of GABAC receptor rho subunits in themammalian retina. J Neurosci 1996;16:4479–90.

[56] Koulen P, Brandstatter JH, Kroger S, Enz R, Bormann J,Wassle H. Immunocytochemical localization of the GABAC

receptor rho subunits in the cat, goldfish and chicken retina. JComp Neurol 1997;380:520–32.

[57] Grigorenko EV, Yeh HH. Expression profiling of GABAA re-ceptor b-subunits in the rat retina. Vis Neurosci 1994;11:379–87.

[58] Dowling JE, Boycott BB. Organization of the primate retina:electron microscopy. Proc R Soc (Lond) B 1966;166:80–111.

[59] Boycott BB, Hopkins JM. Cone bipolar cells and cone synapsesin the primate retina. Vis Neurosci 1991;7:49–60.

[60] Landis DMD, Reese TS. Differences in membrane sturcturebetween excitatory and inhibitory synapses in the cerebellarcortex. J Comp Neurol 1974;155:93–126.

[61] Landis DMD, Reese TS, Raviola E. Differences in membranestructure between excitatory and inhibitory components of thereciprocal synapse in the olfactory bulb. J Comp Neurol1974;155:67–92.

[62] Raviola E, Dacheux RF. Excitatory dyad synapse in rabbitretina. Proc Natl Acad Sci USA 1987;84:7324–8.

[63] Calkins D, Tsukamoto Y, Sterling P. Foveal cones form basal aswell as invaginating contacts with diffuse ON bipolar cells. VisRes 1996;36:3373–81.

[64] Rao-Mirotznik R, Buchsbaum G, Sterling P. Functional archi-tecture of the mammalian rod synapse. 1998;(submitted).

[65] Marc RE, Lam DMK. Uptake of aspartic and glutamic acid byphotoreceptors in goldfish retina. Proc Natl Acad Sci USA1981;78:7185–9.

[66] Miller AM, Schwartz EA. Evidence for the identification ofsynaptic transmitters released by photoreceptors of the toadretina. J Physiol 1983;334:325–49.

[67] Eliasof S, Werblin F. Characterization of the glutamate trans-porter in retinal cones of the tiger salamander. J Neurosci1993;13:402–11.

[68] Vandenbranden CAV, Verweij J, Kamermans M, Muller LJ,Ruijter JM, Vrensen GFJM, Spekreijse H. Clearance of neuro-transmitter from the cone synaptic cleft in goldfish retina. VisRes 1996;36:3859–74.

[69] Suzuki S, Tachibana M, Kaneko A. Effects of glycine andGABA on isolated bipolar cells of the mouse retina. J Physiol1990;421:645–62.


[70] Yeh HH, Lee MB, Cheun JE. Properties of GABA-activatedwhole-cell currents in bipolar cells of the rat retina. Vis Neurosci1990;4:349–57.

[71] Chappell RL, Malchow RP, Ripps H. Perforated patch record-ings from isolated skate bipolar cells. Biol Bull 1992;183:347–8.

[72] Werblin FS, Dowling JE. Organization of the retina of themudpuppy, Necturus maculosus. II. Intracellular recording. JNeurophysiol 1969;32:339–55.

[73] Kaneko A. Physiological and morphological identification ofhorizontal, bipolar and amacrine cells in goldfish retina. J Phys-

iol 1970;207:623–33.[74] Ayoub GS, Lam DMK. The release of gamma-aminobutyric

acid from horizontal cells of the goldfish (Carassius auratus)retina. J Physiol 1984;355:191–214.

[75] Leeper HF, Charlton JS. Response properties of horizontal cellsand photoreceptor cells in the retina of the tree squirrel, Sciuruscarolinensis. J Neurophysiol 1985;54:1157–66.

[76] Mangel SC. Analysis of the horizontal cell contribution to thereceptive field surround of ganglion cells in the rabbit retina. JPhysiol 1991;442:211–34.

.

Neurochemistry of the mammalian cone ‘synaptic...

Documents

Transcript of Neurochemistry of the mammalian cone ‘synaptic...