Nature Structural & Molecular Biology: doi:10.1038/nsmb€¦ · structures are based on the F....
Transcript of Nature Structural & Molecular Biology: doi:10.1038/nsmb€¦ · structures are based on the F....
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Figure 1
Predicted secondary structures of the ZTP riboswitches.
(a) Halothermothrix orenii, (b) Klebsiella pneumoniae, (c) Paenibacillus sp. HGF5, (d) Spirochaeta thermophila, (e) Thermobispora bispora, (f)
Thermosinus carboxydivorans, (g) Thermobacillus composti, and (h) F. ulcerans + 102-nt linker from environmental sample 3278. Secondary
structures are based on the F. ulcerans secondary structure as seen in the crystal structure. Additional helices predicted to form at the 5´ end of the
RNA are labeled “P0”, and the insertion domain helix of T. bispora is labeled “P5”.
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Figure 2
Crystallization of F. ulcerans ZTP riboswitch.
(a) Image of ZTP riboswitch crystals growing from a polyethylene glycol precipitate, as described in methods. Bar denotes 100 m. (b) Denaturing
polyacrylamide gel of a single riboswitch crystal. Lanes 1–3: riboswitch RNA control: 2.5, 1.25, and 0.625 g purified RNA. Lanes 4–6: sequential
crystal wash solutions. Lane 7: riboswitch crystal. (c) Density-modified 2|Fo|-|Fc| SAD map (blue mesh) used for initial model building, contoured at
2 .
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Figure 3
Conservation of ZTP riboswitch and mapping onto the F. ulcerans riboswitch.
(a) Conservation/covariation data published by Breaker and coworkers (Kim, P. B. et al, Mol Cell, 57, 317-28, 2015) mapped onto the sequence and
secondary structure of the F. ulcerans riboswitch. Red nucleotides are more than 97% conserved, blue nucleotides are more than 90% conserved, and
gray nucleotides are more than 75% conserved. (b) Cartoon view of the same conservation data mapped onto the crystallographic model. Coloring is
the same as in A, except black residues (not conserved) are shown in white.
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Figure 4
Small-angle X-ray scattering (SAXS) analysis of ZTP riboswitches.
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
(a) Size-exclusion chromatography traces for the F. ulcerans, H. orenii, and T. carboxydivorans pfl RNAs. (b)
Denaturing and native polyacrylamide gels of pooled and concentrated monomer fractions, visualized by
staining with ethidium bromide. Lane 1: H. orenii. Lane 2: F. ulcerans. Lane 3: T. carboxydivorans. (c) SAXS
data for the F. ulcerans, H. orenii, and T. carboxydivorans RNAs in the presence (red) and absence (black) of
ZMP. Arrow indicates the presence of aggregation in the T. carboxydivorans samples without ZMP. (d) Kratky
plot for the F. ulcerans riboswitch in the presence (black) and absence (red) of ZMP. (e) Cartoon view of the
crystal contact interface formed between two RNA dimers (left) and overall view of the tetramer in the crystal
(right). (f) Normalized size-exclusion chromatography traces of purified monomeric (left) and dimeric (right)
fractions of the F. ulcerans riboswitch prior to isothermal titration calorimetry (ITC) measurements (black) and
after ITC measurements (red).
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Figure 5
Representative isothermal calorimetry titration experiments and single-round transcription experiments of F. ulcerans ZTP riboswitch linker variant
RNAs.
(a) 20 M wild-type ZTP riboswitch titrated with 200 M ZMP. (b) 50 M +10 A linker variant titrated with 1 mM ZMP. (c) 50 M +20 A linker
variant titrated with 1 mM ZMP. (d) 50 M +env3278 linker variant titrated with 1 mM ZMP. (e) 40 M ZTP riboswitch lacking the pseudoknot
(55-75) with 40 M 59–75 added in trans titrated with 800 M ZMP. (f) 40 M ZTP riboswitch 55-75 titrated with 800 M ZMP. (g)
Representative transcription termination experiment of F. ulcerans ZTP riboswitch linker variants. Lanes 1–3: wild-type template in the presence of
0, 100, and 1000 M ZMP. Lanes 4–6: +10A linker template in the presence of 0, 100, and 1000 M ZMP. Lanes 7–9: +20A linker template in the
presence of 0, 100, and 1000 M ZMP. Lanes 10–12: +env3268 linker template in the presence of 0, 100, and 1000 M ZMP. Bands corresponding
to full-length (F) and terminated (T) transcription products are indicated.
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Table 1. Sequences of ZTP riboswitch plasmids
Species Genbank Code Sense/ Antisense
Genbank Sequence, nts RNA Sequence
Fusobacterium ulcerans ACDH02000027.1 antisense 25274–25200
UAUCAGUUAUAUGACUGACGGAACGUGGAAUUAACCACAUGAAGUAUAACGAUGACAAUGCCGACCGUCUGG
GCG
Thermosinus carboxydivorans NZ_AAWL01000017.1 antisense 16389–16319
GGAUACAGGACUGGCGGAUUAGUGGAAGCAACCACGUGGACUGUAUCCGAAGAAAAGCCGACCGCCUGGGC
Halothermothrix orenii NC_011899.1 antisense 2532890–
2532811
GGUCAUACGACUGGCGGUAUUAUAUGGAAUUAACCAUAGGGGAGUAUGACCGAUACUGGAAUAGCCGACCGC
CUGGGCAG
Paenibacillus sp. HGF5 NZ_AEXS01000185.1 antisense 10126–10053
GUUUAUGUGUGACUGGCGUAGCAUGGGGAACCAUGAGGGAGCACAUGGAUGACAACGGCCGUACGCCUGGGC
AG
Spirochaeta thermophila NC_014484.1 antisense 218946–
218848
CCCCUGCACUUCCCGCGAUAAUGGGACGACGACUGGCGCCCUCCGAGGCGGAAUCGACCGCCGGGGAGUCUUUUCCUCACCUGUCGCGCG
CCUGGGCAG
Thermobacillus composti NZ_AGFE01000009.1 antisense 140265–
140191
GUCCGAUGUGACUGGCGACGUUAAGUGGGGAACCACGGUGGAGCAUCGGACGAUAUUGGCCGGUCGCCUGGG
CAA
Thermobispora bispora NC_014165.1 antisense 2607860–
2607750
CCGAUAGAGUGAUGGGGCACGCGACUGGCGCUUGACGUGCCGCCGGCACGUCAAAAGGUGGGGCACCACCGGGGAGCGAAUCCGCGGAGGCCGUGCGCCUGGGUCGCC
GCG
Klebsiella pneumoniae NC_011283.1 sense 2593719–
2593786
ACCAUGUGACUGGCGCUGAAGACAGAAUACUGUCGGGGAGCAUGGUCGACGUCGCCGCGCGCCUGGGC
F. ulcerans +insert env3278 - - -
UAUCAGUUAUAUGACUGACGGAACGUGGAAUUAACCACAUGAAGUAUAACAAGGUGACAGAUCCAAAAAUUGCACCGCAGAUAGGGCGAU ACAUCACAGAUGUACCGCAGAUAAGGCGAUGCUUCAGAGAAGCACCGCAGGGUGCCGACCGUCUGGGCG
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Table 2. Isothermal calorimetry measurements of ZTP riboswitch species and mutants
RNA KD, nM G, kcal mol-1 H, kcal mol-1 T S, kcal mol-1
Fusobacterium ulcerans 487 ± 142 -9.14 ± 0.46 -17.1 ± 1.92 -8.15 ± 2.03
Thermobacillus composti 935 ± 320 -8.57 ± 0.21 -20.5 ± 7.1 -11.9 ± 6.8
Klebsiella pneumoniae N.B. N.B. N.B. N.B.
Thermosinus carboxydivorans 2370 ± 480 -7.77 ± 0.19 -5.69 ± 0.79 2.08 ± 0.98
Halothermothrix orenii 110 ± 26 -9.89 ± 0.15 -19.8 ± 3.2 -9.87 ± 3.0
Paenibacillus sp. HGF5 N.B. N.B. N.B. N.B.
Thermobispora bispora 1020 ± 150 -8.49 ± 0.12 -13.9 ± 2.6 -5.38 ± 2.7
Spirochaeta thermophila N.B. N.B. N.B. N.B.
29-34 U1A N.B. N.B. N.B. N.B. 29-34 GAAA N.B. N.B. N.B. N.B. 29-34 UCUG N.B. N.B. N.B. N.B.
U16A N.B. N.B. N.B. N.B. U16C N.B. N.B. N.B. N.B.
G17C C69G N.B. N.B. N.B. N.B. G17A C69U N.B. N.B. N.B. N.B.
A29U 27100 ± 5200 -6.49 ± 0.11 -3.93 ± 0.68 2.56 ± 0.80 A33G 603 ± 5 -8.83 ± 0.01 -15.6 ± 0.23 -6.78 ± 0.23 A33U 2080 ± 640 -8.08 ± 0.19 -8.37 ± 0.49 -0.29 ± 0.30 A34G 50200 ± 2700 -6.10 ± 0.03 -6.38 ± 0.96 -0.28 ± 0.99 A34U 33500 ± 3100 -6.35 ± 0.06 -8.16 ± 0.92 -1.81 ± 0.86 U40A 6910 ± 6100 -7.48 ± 0.64 -3.02 ± 1.7 4.45 ± 2.4 U40C 6990 ± 1500 -7.32 ± 0.13 -5.00 ± 0.23 2.32 ± 0.37 G63A N.B. N.B. N.B. N.B. G63U N.B. N.B. N.B. N.B. U70A N.B. N.B. N.B. N.B. U70C N.B. N.B. N.B. N.B. G71A N.B. N.B. N.B. N.B. G71U N.B. N.B. N.B. N.B.
+10A linker 2990 ± 330 -7.84 ± 0.07 -18.3 ± 0.03 -10.4 ± 0.04 +20A linker 4740 ± 370 -7.56 ± 0.05 -20.2 ± 0.35 -12.6 ± 0.30
+env3278 linker 9700 ± 2200 -7.13 ± 0.13 -7.91 ± 0.69 -0.78 ± 0.83 55-75 N.B. N.B. N.B. N.B.
55-75 + 59-75 intrans 14200 ± 3200 -6.89 ± 0.15 -18.2 ± 4.7 -11.3 ± 4.8
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073
Supplementary Table 3. PCR primers for transcription termination templates
Primer name Plasmid(s) amplified Primer sequence
Transcription template forward
primer
Wild-type F. ulcerans,F. ulcerans +10A, F.
ulcerans +20A, F.ulcerans +env3268
AAACCAAATAAGAAATTGACTATTTTACCTCTGGCGGTGATAATGGTTGCATGTAGTAAGGAGGTTGTATGGAAGATATCAGTTATATGA
CTGACG*
Transcription template reverse
primer
Wild-type F. ulcerans,F. ulcerans +10A, F.
ulcerans +20A
TCAACAATTATATTTGATATTTTTTTATTATCTTTTCCTAAAAAAATGTATAAAAAAAACCGACAATCTAGGCTTGTTCGCCCAGACGGT
CGGCATTGa
Transcription template +Env3268
linker reverse primer F. ulcerans +env3268
TCAACAATTATATTTGATATTTTTTTATTATCTTTTCCTAAAAAAATGTATAAAAAAAACCGACAATCTAGGCTTGTTCGCCCAGACGGT
CGGCACCCa
a Underlined sequence is the portion of primer complementary to the F. ulcerans plasmid.
Nature Structural & Molecular Biology: doi:10.1038/nsmb.3073