Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs...
Transcript of Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs...
![Page 1: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/1.jpg)
Clinical implementation of Non-invasive prenatal diagnosis (NIPD) for single
gene disorders Natalie Chandler
Senior Clinical Scientist, London North Genomic Laboratory Hub cfDNA 2019 – May 24th 2019
![Page 2: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/2.jpg)
Natalie Chandler
London North Genomic Laboratory Hub
Great Ormond Street NHS Foundation Trust
London, UK
Clinical implementation of Non-invasive prenatal diagnosis (NIPD) for single
gene disorders
Disclosure information: Nothing to declare
![Page 3: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/3.jpg)
Cell-free fetal DNA
Issues
• Relative abundance of maternal cfDNA
• Emanates from the placenta - risk of mosaicism?
• Limitations for use in multiple pregnancies
• When used in early pregnancy, issues associated with ‘vanishing twin’
• Originates from placenta (trophoblast)
o represents whole fetal genome
• Detectable from 4 weeks
o % increases with gestation
o 10-20% of total cfDNA
o Cleared from circulation within 30mins of delivery
![Page 4: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/4.jpg)
Non-invasive prenatal … definitions
NIPD - Diagnosis
Monogenic disorders, fetal sex, RHD
Does not require invasive test for confirmation
NIPT or NIPS
Testing or Screening – aneuploidy
Risk of confined placental mosaicism
‘Screens’ all cfDNA
Requires invasive test for confirmation
![Page 5: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/5.jpg)
NIPD for single gene disorders – where marker/ mutation not present in mother
Test that we offer:
Non-Invasive Fetal sex determination – service started in 2007, report around 17 cases per month – 3 day TAT
FGFR3-related skeletal dysplasia including achondroplasia and thanatophoric dysplasia – service started in 2013, at least 1 run a week – 5 day TAT
FGFR2-related craniosynostosis syndromes e.g. Apert & Crouzon
10 common cystic fibrosis mutations – Paternal exclusion test, low uptake
NIPD bespoke service for paternal and de novo mutations
• 30% of all our molecular prenatal diagnosis since 2015 have been non-invasive
![Page 6: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/6.jpg)
>7 weeks
Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs
qPCR assay
Probes specific to Y chromosome
~17 cases/mnth
Sensitivity 99.5% (95% CI 98.2–99.9%)
Reduces invasive testing rate by ~50%
Economic analysis showed NIPD was no more expensive than IPD (Hill et al, 2011)
NIPD – quantitative PCR for fetal sex determination
Male
Female
CCR5
SRY
SRY CCR5
![Page 7: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/7.jpg)
FRAS1 exon 66
hg19_dna range=chr4:79437011-79437070
ctccctccctggcagAGGCAGGGTTCCTGGATGATGTGGTCTATGATAGCACTGCCCTGGGGCCTGGCTACGATCGCCC
CTTCCAGTTTGACCCCAGCGTGCGAGAGCCGAAGACCATCCAGCTCTACAAACACCTGAACCTGAAGAGCTGCGTGTGG
ACCTTTGATGCTTATTATGACATGACTGAGCTGATTGACGTCTGTGGGGGCTCTGTAACCGCTGACTTCCAGgtaggtg
ccccggggcttgtctgaggactctgc
Amplicon Based Design – panels & bespoke service
C primer
Re familial mutation
G exon
Sample index - 6bp
Illumina sequence adaptor (MiSeq)
60bp
![Page 8: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/8.jpg)
Bioinformatic Analysis
Automated scripting to count wild type and mutant sequences
Monitoring sample indexes for potential contamination
Poor quality data is filtered out ID6 ID7 ID8
cffDNA (1) cffDNA (2) Mat gDNA FRAS1 wt 319077 141751 440538
FRAS1 c.10261C>T 34498 12055 292
ZFX 36743 44017 350940 ZXY 6 0 2
![Page 9: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/9.jpg)
Bioinformatic Analysis
Confirmation of Fetal DNA ZFX/Y, HLA and SNP assays are run in parallel to confirm presence of cffDNA in the same plasma extract undergoing mutation test: • Calculate fetal fraction • Important in mutation negative cases
ID01 ID08 ID02
cfDNA cfDNA gDNA
HLABexon3-VAR01 0 1 2
HLABexon3-VAR02 3509 2734 2805
HLABexon3-VAR03 1 9 0
HLABexon3-VAR04 9 26 11
HLABexon3-VAR05 4108 3582 2876
HLABexon3-VAR06 3 0 0
HLABexon3-VAR07 336 656 0
HLABexon3-VAR08 0 0 0
ZFX 27046 48258 55986
ZFY 764 1456 6
Apert wt 97397 163414 97801
Apert c.755C>G 15 15 13
Apert c.758C>G 16 26 8
Apert c.755_756delCGinsTT 0 2 0
FETAL FRACTION ID01
VARIANT Counts
Maternal allele 1: VAR#2 3509
Maternal allele 2: VAR#5 4108
TOTAL maternal counts: 7617
VARIANT Counts
Fetal HLA variant: VAR#7 336
Fetal Fraction: 8.45
![Page 10: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/10.jpg)
Next generation sequencing – FGFR3 panel
5 amplicons
29 mutations
4 ACH
12 TD1, 1 TD2
1 Severe Achondroplasia with Developmental Delay and Acanthosis Nigricans (SADDAN)
9 Hypochondroplasia
2 Craniosynostosis (p.Pro250Arg/Leu)
Screens multiple mutations in one test
Digital readout
742C>T Arg248Cys TD1
746C>G Ser249Cys TD1
749C>T Pro250Leu CRANIO
749C>G Pro250Arg CRANIO
1108G>T Gly370Cys TD1
1111A>T Ser371Cys TD1
1118A>G Tyr373Cys TD1
1123G>T Gly375Cys ACH
1130T>G Leu377Arg ACH
1138G>A Gly380Arg ACH
1138G>C Gly380Arg ACH
1142T>A Val381Glu HCH
1619A>C Asn540Thr HCH
1619A>G Asn540Ser HCH
1620C>A Asn540Lys HCH
1620C>G Asn540Lys HCH
1948A>C Lys650Gln HCH
1948A>G Lys650Glu TD2
1949A>C Lys650Thr AN
1949A>T Lys650Met SADDAN
1950G>C Lys650Asn HCH
1950G>T Lys650Asn HCH
2419T>A *807Argext*101 TD1
2419T>G *807Glyext*101 TD1
2420G>C *807Serext*101 TD1
2420G>T *807Leuext*101 TD1
2421A>C *807Cysext*101 TD1
2421A>G *807Trpext*101 TD1
2421A>T *807Cysext*101 TD1 Chitty et al. Prenatal Diagnosis 2015, 35:656-62
![Page 11: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/11.jpg)
NIPD for FGFR3 mutations 2013 – 2016 Diagnostic yield by indication
Achondroplasia: Normal limb length <24 wks, shortening >24 wks, relative macrocephaly, frontal bossing, short fingers, polyhydramnios
Thanatophoric dysplasia: Very short limbs from first trimester, short ribs and small chest, polyhydramios, frontal bossing, cloverleaf skull, short fingers
Referral reason Number of FGFR3 NIPD Number positive
Short limbs only 168 28 (17%)
Two ultrasound features 50 28 (56%)
>two features 19 19 (95%)
Affected relative 6 2 (30%)
Previously affected (germ-line mosaic risk)
66 0
Paternal age 1 0
Head circumference
Femur length
achondroplasia
thanatophoric
Phenotyping is key in maximising diagnostic yield
![Page 12: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/12.jpg)
Inclusion criteria 1-3 base pair mutation
gDNA from affected proband or carrier parent
De Novo / Paternal Dominant
For recessive conditions, parents must carry different mutations
Target Population Couples with a pregnancy at risk of a genetic condition where the mutation is known and invasive prenatal diagnosis would otherwise be the only option
Exclusions Pseudogene Polymorphisms
Bespoke NIPD
cffDNA testing in pregnancy
Pre-pregnancy work-up preferred
Minimum 9 weeks gestation
Maternal sample run in parallel
![Page 13: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/13.jpg)
Audit of bespoke service delivered at GOSH Phenotype Gene Mutation
Tuberous sclerosis TSC2, TSC1 c.133_134delCT, c.1525C>T, c.2713C>T c.4351dupC, c.4645T>A
Neurofibromatosis type 1
NF1 c.4823T>C, c.4330A>G c.5170C>T, c.1748A>G
Rhabdoid Tumour Predisposition Syndrome
SMARCB1 c.157C>T c.118C>T
Epileptic encephalopathy, early infantile
SCN8A KCNQ2 SCN1A SCN2A
c.669G>T c.431G>A c.5726C>T c.2627A>C
Skeletal Dysplasia
FGFR3 TCF12
SLC26A2 COL2A1
SOX9
c.779C>G c.1916del
c.296T>C (AR) c.2104G>A c.332C>T
Fraser syndrome (AR) FRAS1 c.10261C>T (x4), c.10261C>T
Battens TPP1 c.509-1G>C
Noonan syndrome PTPN11 c.178G>A, c.923A>G
Porencephaly COL4A1 c.324+1G>A
Marfan syndrome FBN1 c.8268G>A, c.1285C>T, c.5911T>G
Polycystic kidney disease PKHD1 c.1486C>T (AR)
Alpers syndrome POLG c.2542G>A
Gorlin Syndrome PTCH1 c.443del
Carney complex PRKAR1A c.124C>T
Von-Hippel Lindau VHL c.499C>T
Brain malformation disorders EIF2B5 (AR) COL4A1
c.241G>A c.324+1G>A
Phenotype Gene Mutation
Intellectual disability ARID1B KDM5B BCAP31
CASK KAT6A PACS1
c.1488C>A, c.6129del, c.3343C>T c.2359T>C
c.678+1G>A c.37G>T
c.4213G>T c.607C>T
Congenital Nephrotic WT1 c.1301G>A
Cornelia De Lange NIPBL c.4160dupA
Osteogenesis imperfecta COL1A1 COL1A2
c.543+4A>T, c.543+4A>T, c.2299G>A, c.1875+1G>A c.1801G>A, c.1801G>A x3
Renal tubular dysgenesis ACE c.96del (AR)
Epider Palmoplantar Keratoderma
KRT9 c.482A>G, c.482A>G
Hereditary Spastic Paraplegia SPAST c.1361A>G
Familial dilated cardiomyopathy ACTC1 TPM1
c.664G>A c.742A>G
Alexander disease GFAP c.235C>A
Laron syndrome (AR) GHR c.922G>A
MECP2-related disorder MECP2 c.148_152del
Mitochondrial disorders POLG AIFM1
c.2542G>A (AR) c.603_605del, c.1715G>A (AR)
Metabolic disorders OTC ADSL TPP1
GELDC
c.608C>G c.153+1G>T (AR) c.509-1G>C (AR) c.2879G>A (AR)
Eye disorders OTX2 c.534C>A
Immunological disorders STAT3 c.1853G>A
Congenital myopathy DNM2 ACTA1
c.1856C>T c.478C>A
102 bespoke tests offered
23 other conditions worked up
20/102 mutation positive
![Page 14: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/14.jpg)
Challenge: fetal DNA present amongst high background of maternal
Definitive NIPD for autosomal recessive conditions
cffDNA fraction directly affects expected extent of allelic imbalance
Relative mutation dosage-RMD
![Page 15: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/15.jpg)
Definitive NIPD for recessive conditions Linkage analysis and RHDO
High relative concentration of maternal cfDNA complicates the assay requiring linkage analysis when parents carry the same mutation or when the paternal allele has been inherited.
Target SNPs flanking the relevant gene
Genotype maternal, paternal & proband or unaffected sib
Establish linkage of SNPs to the mutation
Use heterozygous SNPs to determine fetal fraction
Maternal
Paternal Proband
Lo et al 2010 Sci Trans Med; New et al 2014 J Clin Endo Metab
![Page 16: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/16.jpg)
RHDO – Cystic Fibrosis Service
Cases (n)
Outcome Gestation (wks)
Fetal Fraction (%)
Comment
10 Both high risk, affected 9 – 10 5 – 14.4%
7 Both low risk, unaffected 9 – 9+4 4.8 – 19%
20 One high risk, unaffected carrier
9 – 14 9 – 19.8%
6 Maternal allele inconclusive Paternal allele low risk
9+2 – 9+6 2 – 6.4% Reported as unaffected carrier
2 Maternal allele inconclusive Paternal allele high risk
9+5 – 10+4 3 – 6.7% Repeated and both maternal allele low risk
1 Maternal allele high risk Paternal allele inconclusive
10+3 10.4% Inconclusive – likely recombination event on paternal allele. Invasive testing required
1 Both maternal & paternal inconclusive
9+3 undetermined No informative SNPs 3’ of gene. ?Consanguineous
Gene dossier approved for clinical use in the NHS in late 2016
47 pregnancies referred for CF NIPD in 2 ½ years compared with ~ 2 per annum invasive tests
![Page 17: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/17.jpg)
We are currently working up RHDO services for CAH, SMA & haemophilia. DMD service is also available in the Birmingham laboratory in the UK.
Bringing RHDO services into Clinical service is costly and requires a large number of samples for validation. Limited to common genetic conditions.
Not able to offer testing to consanguineous families at present
Requires samples from the father and previous child / pregnancy – not always available
- Published proband free RHDO methods are available but at present they are too costly for clinical implementation
Limitations of RHDO
![Page 18: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/18.jpg)
Challenge
fetal DNA present amongst high background of maternal
NIPD for autosomal recessive conditions
cffDNA fraction directly affects expected extent of allelic imbalance
Relative mutation dosage-RMD
![Page 19: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/19.jpg)
Droplet digital PCR (ddPCR)
Relative mutation dosage assays for mutations carried by the mother
X linked example: • Mother carrier of F8 mutation c.6046C>T p.(Arg2016Trp) which causes haemophilia • Fetal fraction 20% obtained by Y chromosome marker • Statistical increase observed in mutant droplets over wild type • Fetus predicted to be affected
Blue = mutant droplets; Green = wild-type droplets
![Page 20: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/20.jpg)
NIPD for mutations carried by the mother
Sickle Cell Disease • 12 ddPCR replicates • Analysis using Poisson correction • Examine ratio of mutant droplets to wild type droplets
3.9%
Heterozygous Homozygous mutant Homozygous wild-type Fetal genotype
Fetal fraction 6.1% 6.8%
![Page 21: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/21.jpg)
• Our assays show that this approach is feasible
• Technically challenging assays to design and optimise
• Currently working on optimising assay design as well as analysis pipelines
• To bring to clinical service – sensitivity & specificity needs to be similar to invasive testing
• May not possible at samples with low fetal fraction (<4%). Sample at a later gestation?
• Fetal fraction determined by Y specific marker in male pregnancies. How can we accurately quantify fetal fraction in female pregnancies?
Relative mutation dosage assays for mutations carried by the mother: The challenges to be addressed
![Page 22: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/22.jpg)
NIPD service delivery in the UK – where are we now?
Condition Tested Fail/ inconclusive
Affected
Achondroplasia 280 5 63
Thanatophoric dysplasia 122 5 37
Apert syndrome 24 0 5
Cystic fibrosis (paternal exclusion) 17 1 7*
Cystic Fibrosis (RHDO) 37 2 8
Crouzon syndrome 15 0 7
Bespoke NIPD 87 **6 not possible 19
Total 582 18 (3%) 146
*one false negative At GOSH >32% of all molecular genetic prenatal diagnosis is NIPD (67% if including fetal sex)
West Midlands regional Genetics Laboratory Spinal Muscular Atrophy, Duchenne and Becker Muscular Dystrophies
![Page 23: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/23.jpg)
NIPD service delivery at GOSH
0
20
40
60
80
100
120
2010/11 2011/12 2012/13 2013/14 2014/15 2015/16 2016/17
Res
earc
h b
ased
tes
tin
g
Ach
on
dro
pla
sia
& T
D
NG
S FG
FR3
Pan
el
NG
S FG
FR2
Pan
el
CF
pat
ern
al e
xclu
sio
n
Bes
po
ke t
esti
ng
CF
~R
HD
O
2017/18
193
![Page 24: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/24.jpg)
Conclusions
Technical challenges
• Delivering an accredited NIPD service for known paternal or de novo mutations is relatively straightforward.
• Expanding the service to make NIPD available for conditions where the mother is a carrier is challenging, time consuming and costly.
• Relative haplotype dosage analysis methods have been successful in clinical service but this approach has its limitations
• Relative mutation dosage assays show potential but more work is required to bring in to clinical service
![Page 25: Natalie Chandler · Ultrasound to confirm gestation, identify multiple pregnancies or empty sacs qPCR assay Probes specific to Y chromosome ~17 cases/mnth Sensitivity 99.5% (95% CI](https://reader034.fdocuments.in/reader034/viewer/2022052614/606fa7dba62d0f1999018975/html5/thumbnails/25.jpg)
Acknowledgments
NETRGL Lyn Chitty Fiona McKay Joseph Shaw Sandra Moore Natalie Chandler Helena Ahlfors
Funding NETRGS RAPID NIHR PGfAR GOSH CC Charity GOSH BRC
The work described here was partially funded by the National Institute for Health Research (NIHR) under its Programme Grants for Applied Research Programme (RP-PG-0707-10107 – “RAPID”) and the GOSH BRC. The views expressed are those of the author and not necessarily those of the NHS, the NIHR or the Department of Health.
Research Team Sophie Sheppard Rhiannon Mellis Melissa Hill