Nat. Cell Biol.

NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION 1

L E T T E R S

Diego and Prickle regulate Frizzled planar cell polarity signalling by competing for Dishevelled bindingAndreas Jenny1, Jessica Reynolds-Kenneally1, Gishnu Das1, Micheal Burnett1 and Marek Mlodzik1,2

Epithelial planar cell polarity (PCP) is evident in the cellular organization of many tissues in vertebrates and invertebrates1–5. In mammals, PCP signalling governs convergent extension during gastrulation and the organization of a wide variety of structures, including the orientation of body hair and sensory hair cells of the inner ear6,7. In Drosophila melanogaster, PCP is manifest in adult tissues, including ommatidial arrangement in the compound eye and hair orientation in wing cells1,2,4. PCP establishment requires the conserved Frizzled/Dishevelled PCP pathway1–5. Mutations in PCP-pathway-associated genes cause aberrant orientation of body hair or inner-ear sensory cells in mice6,7, or misorientation of ommatidia and wing hair in D. melanogaster1,2,4. Here we provide mechanistic insight into Frizzled/Dishevelled signalling regulation. We show that the ankyrin-repeat protein Diego binds directly to Dishevelled and promotes Frizzled signalling. Dishevelled can also be bound by the Frizzled PCP antagonist Prickle8. Strikingly, Diego and Prickle compete with one another for Dishevelled binding, thereby modulating Frizzled/Dishevelled activity and ensuring tight control over Frizzled PCP signalling.

In the D. melanogaster eye, PCP is generated when immature omma-tidial preclusters rotate 90 ° towards the dorso-ventral midline (the equator), adopting opposite chiral forms on either side of it. This results in a mirror-image ommatidial arrangement across the equa-tor (Fig. 1a, b)2,4. The Frizzled (Fz) PCP signal — transduced via Dishevelled (Dsh) and potentially a heterotrimeric G protein9, Rho-family GTPases and a Jun N-terminal kinase (JNK) cascade1,2,10 — specifies the cell fates of the photoreceptors R3 and R4. It thus defines the chiral form of each ommatidium and the associated direction of rotation (Fig. 1a, b)2,4. Graded Fz activity, higher at the equator than at the poles, results in an initial small difference in Fz activity between R3 and R4. The R3 precursor is thought to receive Fz PCP signalling first or at higher levels, because it is closer to the equator2,4. This Fz activity difference between the equatorial R3 and polar R4 precursors is then amplified in a process that involves Delta (Dl) transcription and Notch (N) signalling1,2,4.

1Mount Sinai School of Medicine, Brookdale Department of Molecular, Cellular and Developmental Biology, 1 Gustave L. Levy Place, New York, NY 10029, USA.2Correspondence should be addressed to M.M. (e-mail: [email protected])

Published online: 5 June 2005; DOI: 10.1038/ncb1271

In PCP mutant backgrounds, ommatidia form properly but choose R3/R4 cell fates — and thus chirality — stochastically and rotate to a random extent; a few also remain symmetrical1,2,4. Several PCP genes, including prickle (pk), strabismus (stbm), flamingo (fmi) and diego (dgo) are required for the regulation of Fz PCP signalling activity. Whereas fz and dsh are required in R3 (ref. 11), stbm and pk act in R4, where they are required to antagonize Fz8,12,13.

Dgo is a cytoplasmic protein with six amino-terminal ankyrin repeats that colocalizes with Fz14,15. Before the onset of PCP signalling, all PCP proteins initially colocalize apically at the cell membrane. This initial api-cal recruitment depends on Fz and Fmi14,16, with Pk also depending on a direct interaction with Stbm for membrane recruitment12,17. Furthermore, the Dgo ankyrin repeats can interact with Pk and Stbm and probably contribute to an initial phase of apical localization14. Genetic studies show a redundancy at this stage: only double mutants of either dgo, pk or stbm have an effect on Fmi or Fz apical localization. At these early stages, a potential higher-order complex of PCP proteins might function to main-tain Fmi apically14. Moreover, overexpression of PCP proteins such as Fz or Pk also leads to increased apical levels of Stbm or Fmi8,17. Later, during PCP signalling and asymmetry generation, Fz, Dsh and Dgo become enriched on the R3 side of the R3/R4 cell border, whereas Stbm becomes enriched at the R4 side10,12. Likewise in the wing, Fz, Dsh and Dgo sort to the distal end of wing cells, whereas Pk and Stbm, the Fz/Dsh antagonists, become enriched proximally in each cell12,16–18.

The role of Dgo in Fz PCP signalling, however, remains unclear. To dissect the function of dgo in PCP establishment, we first used mosaic analysis to determine in which photoreceptor it is required (Fig. 1c–e). Our results indicate that dgo is necessary in R3 because 98.4% of mosaic clusters with a wild-type R3 developed correctly. In contrast, ommatidia with a dgo− R3 precursor chose their chirality stochastically or remained symmetrical. We also analysed whether Dgo has the potential to instruct a cell to adopt a specific fate. For example, the cell of the R3/R4 pair with higher Fz levels always adopts the R3 fate1,2,4. We thus tested the effect of overexpressed Dgo (sevenless (sev)-Dgo) by analysing ommatidia with mosaic sev-Dgo R3/R4 pairs in an otherwise wild-type background. All R3/R4 mosaic sev-Dgo clusters that showed either a chirality inversion or adopted a symmetrical R3/R3 arrangement carried sev-Dgo in the R4

© 2005 Nature Publishing Group

L E T T E R S

2 NATURE CELL BIOLOGY ADVANCE ONLINE PUBLICATION

precursor that developed as R3 (example shown in Fig. 1f). Furthermore, in addition to rotation defects and chirality inversions, high levels of Dgo in both R3 and R4 precursors (two copies of a sev-Dgo transgene) frequently lead to symmetrical R3/R3-type ommatidia (Fig. 1g). Thus high levels of Dgo can promote the R3 fate even in the R4 precursor. Taken together, dgo, like fz, is required in R3 and promotes R3 cell fate, suggesting that it positively influences Fz PCP signalling.

Genetic interactions between gain- (GOF) and loss-of-function (LOF) alleles of different PCP components have helped to dissect the relationships of the respective genes. For example, the sev-Fz phenotype is dominantly suppressed by dsh and RhoA alleles, suggesting that Dsh and RhoA act as positive effectors of Fz PCP signalling19,20. Similarly, sev-Fz is dominantly suppressed by dgo LOF alleles, again consistent with a positive role of dgo on Fz PCP signalling (see Supplementary Information,

ba

c e g

d f

Dorsal

Ventral

Equator

75

50

25

R1 R2 R3 R4 R5 R6 R7 R8

1

2

4

7

8 6

5

38 11 7 10 2 7 5 2

3 5 4 2 1 4 1 2

5 7 1 1 1 10 2 3

2 23 14 7 5 19 21 1

5 4 5 1 1 3 5 3

3 1 1 1

34

1 1 4 7

Percentage of wild-type (pigmented)R cells in ommatidia with abnormal polarity

Figure 1 dgo is required in the R3 photoreceptor. (a) Schematic of an eye imaginal disc with the dorsal–ventral midline (equator) in yellow. Anterior is left, dorsal is up (as in subsequent figure). Initially, ommatidial preclusters are symmetrical. PCP signalling determines R3 (orange) and R4 (blue), followed by a 90 ° rotation of clusters towards the equator. (b) Adult eye section: ommatidia are arranged in a mirror symmetric pattern with respect to the equator. R3 is positioned at the tip of the trapezoid (see inset). Schematic with dorsal and ventral clusters represented by black and red arrows, respectively, is shown on the right. (c–e) Clonal analysis. (c) Mosaic dgo380 eye. Wild-type cells are marked by pigment granules (for example, black dots adjacent to the rhabdomeres of photoreceptors). A dorsal wild-type ommatidium is indicated with a green arrow. When R3 is wild type (dgo+; black and white circles in d represent wild-type and mutant R cells, respectively), the cluster adopts correct polarity (black arrows in c; n = 236). When the R3 precursor is dgo−, clusters often adopt random polarity, leading to symmetrical clusters (yellow

arrow in c) or chirality flips (orange arrow in c; wild-type or dgo− R3/R4 cells are marked by black or yellow arrowheads, respectively). Grey shaded field in d corresponds to clusters with only R3 precursor mutant. (e) Quantification of mosaic analysis. Wild-type R3 cells were highly under-represented in mosaic ommatidia with wrong polarity. The genotype of no other photoreceptor affected polarity12 (n = 439). (f) Section through the dorsal area of an eye mosaic for the overexpression sev-Dgo genotype (sev-Dgo cells are marked by pigment granules). In ommatidia that are mosaic for sev-Dgo within the R3/R4 pair that show chirality flips or R3/R3 symmetric arrangement, the R cell with higher Dgo levels develops as R3 even when it was the R4 precursor (21 total; example marked by an orange arrow; pigmented/non-pigmented R3/R4 cells are marked with black and yellow arrowheads, respectively). Correctly polarized ommatidium is indicated by a green arrow. (g) Two copies of a sev-Dgo transgene lead to many symmetric ommatidia of the R3/R3 type (green arrows in schematic beneath section).


L E T T E R S


Table S1). Interestingly, sev>Dgo is also suppressed by fz alleles (Fig. 2a, b and see Supplementary Information, Table S1), suggesting that there is not a strict linear relationship between Fz and Dgo (see also below). All other sev>Dgo interactions (for example, with dsh, N, Dl or RhoA alleles) behave comparably to those with sev>Fz19,20 (Fig. 2c and see Supplementary Information, Table S1), again suggesting that dgo acts positively in Fz PCP signalling. In addition, sev>Dgo is enhanced by pk and stbm (Fig. 2d and see Supplementary Information, Table S1). Thus, removing a factor

that acts positively in the Fz PCP pathway (for example, fz or dsh) sup-presses the Dgo GOF phenotype, whereas removing an inhibitor (that is, pk and stbm) enhances it. Taken together with the genetic requirement, this indicates that Dgo promotes Fz PCP signalling.

Pk and Stbm have qualitatively opposing effects on PCP signalling com-pared with Dgo, and repress Fz activity8,13,21. How can this antagonism be explained mechanistically? To address this question, we performed a sys-tematic search for physical interactions between proteins involved in PCP

dgo269 dsh1/+;dgo269 dsh1/Y;pkpk1/+

sev>Dgo sev>Dgo;fzF31/+ sev>Dgo;pkpk-sple6/+

a cb d

dsh1/Y

fe g h

dsh1/+;sev>Dgo

Figure 2 Genetic interactions of dgo with other PCP factors. Panels show tangential sections of adult eyes of indicated genotypes, with corresponding schematics in lower panel. Arrows are as in Fig. 1, with symmetric ommatidia in green (R3/R3 type) and blue (R4/R4); circle represents an unscorable cluster. (a) sev>Dgo shows typical PCP phenotypes including rotation and chirality defects (note that in order to score for genetic

interactions, a line with a weaker phenotype than that in Fig. 1g was used). (b–d) Its phenotype is dominantly suppressed by fz (b; sev>Dgo;fzF31/+) and dsh (c; dsh1/+;sev>Dgo), and enhanced by pk (d; sev>Dgo; pkpk-sple6/+). (e, f) A weak allele of dgo (e; dgo269) is enhanced by removing a copy of dsh (f; dsh1/+;dgo269). (g, h) The PCP-specific allele dsh1 (g) is suppressed by a pk LOF allele (h; dsh1/Y; pkpk1/+).


L E T T E R S


establishment. Yeast two-hybrid assays showed that Dgo specifically inter-acts with the basic-PDZ region of Dsh (see Supplementary Information, Fig. S1a). We then confirmed that Dgo binds Dsh in co-immunoprecipi-tation experiments. Myc-tagged Dsh specifically co-immunoprecipitates with yellow fluorescent protein (YFP)-tagged Dgo (YFP–Dgo), but not with green fluorescent protein (GFP) alone (Fig. 3a). Similarly, YFP–Dgo co-precipitates with Myc–Dsh (data not shown). Interestingly, glutathione S-transferase (GST) pull-down experiments show that this interaction is mediated by the part of Dgo that is carboxy-terminal to the ankyrin repeats (Dgo∆Ank; Fig. 3b). Our pull-down experiments also confirmed that Dsh interacts with Pk and Stbm (Fig. 3b; GST–Dsh binds to the cytoplasmic C-tail of Stbm and also binds to Pk)8,17,22. Strikingly, both Dgo and Pk interactions with Dsh map to the basic-PDZ region of Dsh (GST–Dsh B-PDZ; schematic in Fig. 3b). Under the conditions used, the DEP (Dsh, Egl-10 and Pleckstrin) and C-terminal domain of Dsh — the region to

which the Dsh–Pk interaction has been mapped previously8 — does not bind Pk. A possible explanation for this discrepancy is that Dsh might have multiple Pk-binding sites. We mapped the region of Dgo binding to Dsh using in vitro translated deletion constructs of Dgo∆Ank. The 181 amino acids just after the ankyrin repeats of Dgo are sufficient to interact with the basic-PDZ region of Dsh (Fig. 3c). BLAST searches with these 181 amino acids identify, in addition to insect Dgo homologues, vertebrate Diversin (see Supplementary Information, Fig. S1b, c for scheme and alignment), the best candidate for a Dgo homologue in vertebrates23 (see also below). In summary, Dgo, Pk and Stbm can all bind strongly to the same region of Dsh and thus some of these interactions might be mutually exclusive.

These observations suggest that the opposite effects of Dgo and Pk on Fz PCP signalling are mediated mechanistically by a direct competition between Dgo and Pk for Dsh binding. We thus tested whether binding of Dgo and Pk to Dsh is mutually exclusive.

16

14

12

10

8

6

4

2

Per

cent

age

Pk

bou

nd

His−Dgo∆AnkHis−control

a b c

d e

100%

inp

ut

2µg

His

−con

trol

2 µg

His

−Dgo

∆Ank

His−Dgo∆Ank His−control His

−∆H

is−C

1 2 3 4 5 6 7 8 9 10 11 12 13 14

40

25

20

15

35S-Pk

100%

inp

ut

GS

T−D

sh B

-PD

Z

GS

T−co

ntro

l

35S-∆C335S-∆N135S-∆N2

35S-∆C135S-∆C2

35S-Dgo∆ANK

DIX DEPGST−Dsh:

IP Anti-Dgo(GFP)

Lysates

50

64

98

30

98

64

Dsh−MycYFP−Dgo

EGFP

++−

+−+

++−

+−+

Dsh (Myc)

Dgo (GFP)

GFPDIX B-PDZ

B-PDZ

DEPGST−Dsh:

GS

T−D

sh D

EP

-Cte

rm

100%

inp

ut

GS

T−co

ntro

l

GS

T−D

sh

GS

T−D

sh ∆

Cte

rm

GS

T−D

sh B

-PD

Z

35S-control

35S-Dgo

35S-Dgo∆Ank35S-StbmCterm

35S-Pk

Mr(K)

Amount of competitor (µg)

Mr(K)

0 5 10 15 20

* *

*

**

*

*

**

*

*

**

***

Figure 3 Dgo competes with Pk for Dsh binding. (a) Dsh and Dgo co-immunoprecipitate from transfected HEK293T cells. Dsh–Myc co-immunoprecipitates with YFP–Dgo (but not with enhanced GFP) (left; 2% of lysates on the right). Dgo also stimulates Dsh phosphorylation (compare change of migration of Dsh cotransfected with YFP–Dgo versus EGFP). (b) Dsh fragments (colour-coded in schematic below) pull down in vitro translated fragments of Dgo, Stbm and Pk (yellow in schematic on right). The basic-PDZ region (B-PDZ) of Dsh is sufficient to bind to full-length Dgo, Dgo∆Ank (lacking the N-terminal Ank repeats), the C-terminal region of Stbm, and Pk (region common to all Pk isoforms, including the PET and the three LIM domains29). None of the in vitro translated proteins binds to the DEP domain and C terminus of Dsh under the conditions used, nor to an unrelated control (GST–control). (c) 181 amino acids following the Dgo Ank repeat region (boxed in schematic on the right) are sufficient to bind to the B-PDZ region of Dsh. The deletion constructs tested are indicated on the

right. ∆C2 is probably incorrectly folded and does not bind to Dsh. (d) Dgo competes with Pk for Dsh binding. Autoradiograph (top) of Coomassie-stained gel (below). Increasing amounts of His6-tagged Dgo∆Ank compete with in vitro translated Pk for binding to GST–Dsh B-PDZ (compare lane 2 with lanes 3–6 in autoradiograph). A control protein does not affect Pk binding (His–control; lanes 8–11), nor does Pk bind to an unrelated GST-fusion protein (lane 14). Note on the Coomassie-stained gel that only the specific competitor (yellow asterisks, compare lanes 2–6 with lane 7; levels of bound competitor are close to saturation) binds to GST–Dsh B-PDZ (red asterisks; lanes 2–11). Control protein (yellow asterisks; lane 12) does not bind (lanes 8–11). Neither competitor binds to an unrelated GST protein (His–∆, lane 13 and His–C, lane 14, respectively; the unrelated GST protein is marked with red asterisks). Lane 1: 100% of 35S-Pk used per pull-down. (e) Quantification of similar competition experiments, performed in triplicate, with full-length GST–Dsh. Error bars represent s.d.


L E T T E R S


Strikingly, increasing amounts of Dgo (His–Dgo∆Ank ) prevent Pk from binding to the basic-PDZ region of Dsh in a dose-dependent manner (Fig. 3d; note that His–Dgo∆Ank binds GST–basic-PDZ concomitantly; His6-tagged Pk also competes with in vitro translated Dgo∆Ank for Dsh binding (see Supplementary Information, Fig. S1d)). An unrelated His6-tagged control protein does not compete with Pk for binding to Dsh (Fig. 3d; lanes 8–11). Quantification of a similar competition experiment (performed in triplicate) with full-length GST–Dsh again shows an effi-cient and specific competition between Dgo and Pk for binding to Dsh (Fig. 3e). Thus the opposite effect of Dgo and Pk on Fz PCP signalling can be explained by mutually exclusive binding to the Fz effector Dsh.

If Dgo stimulates Fz PCP signalling by binding to Dsh and thus protect-ing it from Pk binding (and its antagonistic effects), then activation of Fz PCP signalling by overexpression of Dsh should also be modified by Dgo

levels. Consistently, removing a copy of dgo dominantly suppresses the sev-Dsh phenotype (see Supplementary Information, Table S1). Analogously, the homozygous phenotype of the weak dgo269 allele is enhanced by the removal of a copy of dsh (Fig. 2e, f and see Supplementary Information, Table S1), and the PCP-specific allele dsh1 is also weakly enhanced by the removal of a dgo copy (data not shown). These genetic interactions sup-port a model in which Dgo stimulates Fz signalling by binding to Dsh.

The inhibitory effect of Pk on Dsh should also be reflected in genetic interactions. Consistent with the model, the hypomorphic pkpk1 allele (which has no eye phenotype on its own) partially suppresses the dsh1 phenotype (Fig. 2g, h; other pk alleles show a similar tendency, see Supplementary Information, Table S1). Because Pk and Stbm can both bind Dsh and have been shown to act in a complex12,17, it is important to note that alleles of stbm did not suppress dsh1, nor did a pk-stbm

dpp>Pkdpp>Dgodpp dpp>Pk + Dgo

a b

c d e f

c' d' e' f'

Percentage of wing width

10080604020−20−40

dpp>Pk + Fz

dpp>Dgo + Pk

dpp>Fz

dpp>Dgo + Fz

dpp>Dgo

dpp>Pk

dpp>Stbm

dpp>Pk + Stbm

dpp>Dgo + Stbm

dpp>Dgo+Pk + Stbm

Figure 4 Dgo and Pk compete with each other in vivo. (a) Schematic of a wing, indicating the expression domain of dpp>Gal4 (green) and the wing region shown in panels c–f (blue rectangle). (b) Quantification of the overexpression effects. The percentage of wing width showing aberrant hair orientation (along the red line in a) is shown for the genotypes indicated on the left. Positive and negative numbers indicate hairs pointing away from or towards the source of expression, respectively. All differences are significant, as shown by t-tests (P < 0.001). Error bars represent s.d.

(c–f) Compared with control (c), overexpression of Dgo (d) and Pk (f) causes wing hairs to point away from or towards the expression domain, respectively. Arrows indicate direction and extent of misoriented wing hairs. (e) Coexpression of Dgo and Pk leads to an intermediate phenotype, supporting a competition between Pk and Dgo for Dsh activity in vivo. (c′–f′) Enlarged area (boxed region in c) of the above wings. Arrows indicate direction of wing hairs. The green stripe represents the vertex of dpp>Gal4 expression. Anterior is up, distal to the right.


L E T T E R S


double mutant show an enhanced suppression (see Supplementary Information, Table S1), suggesting that pk inhibits Dsh function. We cannot exclude the possibility that Stbm might not be limiting in the eye and therefore does not show a genetic interaction. However, stbm alle-les have been successfully used to dominantly modify overexpression phenotypes of Pk12 (see also below). In conclusion, the genetic interac-tions support the model that Dgo and Pk modulate Fz PCP signalling by competing for Dsh binding.

On the basis of the above results, it is expected that Dgo and Pk also compete in vivo. In the wing, PCP signalling is manifest in the distal out-growth of an actin-rich hair from each cell (see Fig. 4c, c′)1,2,4. The hairs generally point along a slope of Fz activity from proximal to distal and can be reoriented by manipulation of Fz signalling levels (hairs always point away from high Fz levels)24. This reorientation of wing hairs is preceded by the corresponding relocalization of PCP proteins along the ectopic axis8,17. Overexpression of Fz or Dgo under the control of decapentaplegic (dpp)-Gal4 in a stripe along the proximo-distal axis (schematic in Fig. 4a) results in reorientation of wing hairs, which now point laterally away from the expression domain15,24 (Fig. 4d for Dgo). Overexpression of Pk has the opposite effect, having led to the suggestion that Pk antagonizes Fz PCP signalling8 (Fig. 4f, f′). This effect is dosage sensitive, because co-overexpression of Fz with Dgo or Pk enhances or represses, respectively, the effect of Fz alone (Fig. 4b). As predicted on the basis of our genetic interactions and in vitro competition data, co-overexpression of Pk with Dgo reduces the extent to which Dgo is able to reorient the wing hairs (Fig. 4e, e′ and 4b for quantification). On the other hand, we found no consistent change in the dpp>Dgo phenotype by coexpression of Stbm (Fig. 4b). However, overexpression of Stbm together with Pk and Dgo potentiated the effect of Pk on Dgo, giving rise to hairs that point towards the dpp expression domain (quantified in Fig. 4b), consistent with Pk and Stbm acting as a functional complex. These data demonstrate that levels of Dgo and Pk affect PCP signalling strength in opposite directions, as expected for a direct competition for Dsh binding.

How could Dgo exert its stimulatory effect? It is widely believed that activation of Dsh requires phosphorylation25. Intriguingly, we find that cotransfection of Dgo with Dsh leads to a stimulation of Dsh phospho-rylation (Fig. 3a; the mobility shift of Dsh is reversed by phosphatase treatment; data not shown). Binding of Dgo to Dsh could thus promote Dsh activation via stimulation of its phosphorylation.

In addition, Fz recruits Dsh to cell membranes in imaginal discs, cell culture and Xenopus animal cap cells8,18,26. This could occur indirectly, involving a heterotrimeric G protein9, or via direct binding or both. The PDZ domain of Dsh binds weakly to a specific peptide near the C termi-nus of Fz27. Fz is also required for the recruitment of Dgo to apical cell membranes in imaginal discs14 (see model in Fig. 5), and Diversin, the vertebrate homologue of Dgo, can stimulate Dsh-induced JNK signalling in HEK293 cells23. The stimulatory effect of Dgo on Fz PCP signalling could therefore result from the formation of a multiprotein complex that includes Fz, Dsh and Dgo (but not Pk). Such a complex could elicit a stronger signalling response in the R3 precursor. This would explain why, based on genetic interactions, Fz, Dsh and Dgo cannot be placed in a strictly linear pathway but rather seem to work as a complex.

Furthermore, Pk can prevent Dsh from being recruited to the cell membrane by Fz in cell culture8 or in zebrafish embryos28. During the redistribution of the PCP proteins, after initial apical recruitment, Pk binding to Dsh could thus inhibit its membrane association and prevent the formation of a Fz/Dsh/Dgo complex in the R4 precursor (Fig. 5) or on the proximal side in wing cells.

In vertebrates, Fz PCP signalling is also required for the elongation of the body axis during gastrulation (convergent extension), a process that depends on directional cell movements. Vertebrate Pk (reviewed in ref. 5) and the Dgo homologue Diversin23 both affect convergent extension. The JNK signalling stimulatory activity of Diversin, and the conservation of an interaction between Dsh and Pk in Xenopus5, suggest that Dgo and Pk have similar opposing effects on Fz PCP signalling in D. melanogaster and vertebrates.

METHODSGenetics. Overexpression studies were performed using the Gal4/UAS system30, or by direct expression of the dgo coding sequence in a modified sev enhancer or UAS vector (see also ref. 15). Transgenic flies were generated by standard P-ele-ment-mediated transformation. sev>Dgo crosses were grown at 29 °C. All other crosses were grown at 25 °C. w1118 (w−) was used as a control. sev-Dgo mosaics were generated by crossing Ki, pp,∆2-3 to w−; sev-Dgo flies.

The sev-fz, sev-dsh, UAS-fz strains were as described19,20. Alleles used were dgo308, dgo380, dgo269 (ref. 15), rhoA720, rhoA79-3, pkpk-sple13, pkpk-sple6, pkpk1, stbm6cn, dsh1, dshv26, fzF31, fzR52, DlrevF10, N55e11, top38c1, dpp-Gal4 (as described at http://flybase.bio.indiana.edu). sev-Gal4 and UAS-pk strains were gifts from K. Basler and D. Gubb, respectively.

Tangential eye sections were prepared as described20. Three to twelve inde-pendent eyes were scored for each genotype. Wings were incubated in PBS with 0.1% Triton-X100 for at least 1 h before mounting in 80% glycerol in PBS. The overexpression effects were quantified by measuring the width of the affected part of the wing relative to the whole wing width along a line from where wing vein 2 touches the wing margin that runs perpendicular to the anterior–posterior compartment boundary (red line in schematic in Fig. 4a). Hairs that point towards the expression domain were arbitrarily given a negative sign to reflect the differ-ence between these and hairs pointing away from the expression domain. Six to ten wings were quantified per genotype.

Two-hybrid assays and biochemistry. The basic-PDZ region of Dsh was ampli-fied with primers Dsh_ext_PDZ_upper (TATGGATCCGAATTGACGCTGGACCG) and Dsh_ext_PDZ__stop_lower (ATAGTCGACTCATCGCACCGGCTCCGTGCGCG) and cloned as a BamHI/SalI fragment into pASmod12. pAct-mod_Dgo was generated by inserting Dgo from pCRIITopo_Dgo14 as a NotI/SalI fragment into pAct_mod. Bait and prey plasmids were transformed into PJ64-9α and PJ64-9a, respectively. Yeast two-hybrid assays were performed by mating bait and prey strains in duplicate. Diploid strains were then spotted on plates lacking histidine and containing 3 mM 3-aminotriazole to assay for interaction. Positive and negative control plasmids were from BD Biosciences (Palo Alto, CA).

Stb

m

R3

DshDsh

JNK-cascade

Fz

DeltaS

tbm

Pk

Pk

Pk

Dgo

R4JNK-cascade

Delta

Dl N

Fz

Dgo

Figure 5 Model of how Dgo and the Pk–Stbm complex differentially affect Dsh and Fz PCP signalling in R3 and R4. In R3, Dgo stimulates Fz PCP signalling and prevents Pk from acting on Dsh. In contrast, Pk, acting in the R4 precursor, prevents binding of Dgo to Dsh and thus acts as an inhibitor of Fz PCP signalling.


L E T T E R S


pGexKG_Dsh contains the reading frame of Dsh, including the stop codon as a NcoI/SalI fragment. pGexKG_Dsh∆Cterm was made by deleting the BlpI/HindIII fragment of pGexKG_Dsh. pGex4T1_Dsh basic-PDZ was made by subcloning the above PCR product into the BamHI/SalI sites of pGex4T1. pGex4T1_Dsh DEP-Cterm was made by cloning the XhoI fragment of pGexKG_Dsh into pGex4T1. Note that the Dsh moiety of this fusion protein starts at the same restriction site as that in ref. 8, but ends at its endogenous stop and contains no linker sequences after the stop. GST fusions of Dsh correspond to the following amino acids: GST–Dsh, 1–624; GST–Dsh∆Cterm, 1–504; GST–Dsh basic-PDZ, 200–357; GST–Dsh DEP-Cterm, 394–624. GST-fusion proteins were expressed as described12 and checked by SDS–PAGE (see Supplementary Information, Fig. S2).

Dgo∆Ank was PCR amplified using Dgo∆Ank_Tlstart (TATGGATCCATCAATATGAAGGAGAAACCCAAGGAGG) and Dgo_lower_SalI (ATAGTCGACTCAAACTAGACTCGAGACATT) and subcloned into pBSIIKS as BamHI/SalI fragment. The NotI/BstEII fragment was then used to replace the N terminus of pCRIITopo_Dgo14. Dgo∆Ank was transferred as a BamHI/SalI fragment into the corresponding sites of pQE30 (Qiagen, Valencia, CA) and into the NdeI(blunt)/XhoI sites of pβTH12. In vitro translation and His6-tagged Dgo constructs contain amino acids 1–927 (full length) and 259–927 (∆Ank). pβTH_∆C1, pβTH_∆C2 and pβTH_∆C3 derivatives were made by opening (and blunting where required) and religating pBTH_Dgo∆Ank with SnaBI/NcoI(linker), ScaI(partial)/NcoI and XbaI, respectively. pβTH_∆N1 and pβTH_∆N2 were made by cloning SacI(blunt)/SalI(linker) and ScaI/SalI(linker) fragments of Dgo into the EcoRI(blunt)/XhoI and NdeI(blunt)/XhoI sites of pβTH. ∆C1, ∆C2, ∆C3 contain amino acids 259–841, 259–623 and 259–439 of Dgo, respectively. ∆N1, and ∆N2 contain amino acids 441–927 and 624–927 of Dgo, respectively. His-control was made by subcloning the BamHI/SalI fragment of pBS_PKM_C12 into the corresponding sites of pQE30. His-common was made by cloning the BamHI fragment of pTopo4.0_Common12 into pQE30 (encodes amino acids 14–964 of Pk).

Enhanced YFP was inserted as a blunted NheI/BamHI fragment into the blunted BamHI/XhoI sites of pCS(105). pCS(105)_YFPDgo was made by insert-ing a NotI(blunt)/SalI fragment of pCRIITopo_Dgo14 into the BglII(blunt)/SalI sites of pCS(105)_YFP. Additional constructs are as published12,14.

His6-tagged proteins were purified under native conditions using standard procedures (Qiagen) and dialysed against binding buffer (BP) (50 mM Tris-HCL pH 7.6, 150 mM KCl, 0.5% TritonX-100, 1 mM DTT) containing 10% glycerol. Radiolabelled proteins were translated in vitro using the coupled transcrip-tion–translation system (Promega, Madison, WI) according to the manufac-turer’s instructions using 1 µg DNA. Protein concentrations were determined by Bradford assay (Bio-Rad, Hercules, CA) using BSA as standard. Note that GST- and His6-tagged fusion proteins frequently are not expressed as full-length proteins, but as several breakdown products (reducing the actual concentrations of binding sites and requiring higher amounts of competitors).

GST pull-down experiments were performed as described12 in a total volume of 500 µl, but using only 1 µg GST-fusion protein and 0.5 µl of a standard coupled transcription–translation reaction (Promega). Under these conditions, the bind-ing reactions were in the linear range (data not shown). Where appropriate, His6-tagged competitor was added before addition of the radiolabelled protein, and reactions were adjusted for glycerol content. In the experiment shown in Fig. 4c, 10, 50, 75 and 100 µg corresponding competitor were used. In Supplementary Information, Fig. S1d, 2.5, 5, 10, 25, 50 and 100 µg corresponding competitor were used. Competitors and in vitro translated proteins were centrifuged at 10,000g for 1 min at 4 °C prior to use.

HEK293T cells were transfected with 5 µg of pCS_Dsh-Myc together with either pCS(105)_YFPDgo or pEGFP-C1, according to the calcium phosphate method. Cells were collected after 36 h in ice-cold PBS and lysed in 500 µl lysis buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 5 mM β-glycerophosphate,1 × protease inhibitor cocktail (Roche, Basel, Switzerland), 1% Triton-X100). After 15 min on ice, the lysates were mixed with 500 µl lysis buffer without Triton-X100 and centrifuged for 10 min at 10,000g at 4 °C. The supernatants were then incubated with 1 µg of the corresponding antibodies for 2 h on a rotating arm at 4 °C. Thirty microlitres of 50% ProteinG-Sepharose beads were then added for 1 h. The immunoprecipitates were washed three times with 1 ml of cold wash buffer (50 mM Tris-HCl pH 8.0, 150 mM Nacl,1 × protease inhibitor cocktail (Roche), 0.1% Triton-X100) and resuspended in 15 µl 2 × SDS sample buffer. SDS–PAGE (10%) and western analysis were performed according to standard procedures.

Note: Supplementary Information is available on the Nature Cell Biology website.

ACKNOWLEDGEMENTSWe thank D. Gubb, K. Basler, T. Wolff and the Bloomington stock center for fly strains, P. James for yeast strains, and J. Suriano and Z.-F. Du for technical help. We thank E. Wurmbach, R. Krauss and members of the Mlodzik laboratory for critically reading the manuscript. The work has been supported by NIH grant RO1 GM62917 to M.M. A.J. was supported in part by Swiss National Science Foundation grant 823A-64689.

COMPETING FINANCIAL INTERESTSThe authors declare that they have no competing financial interests.

Received 16 February 2005; accepted 5 May 2005Published online at http://www.nature.com/naturecellbiology.

1. Adler, P. N. Planar signaling and morphogenesis in Drosophila. Dev. Cell 2, 525–535 (2002).

2. Mlodzik, M. Planar cell polarization: do the same mechanisms regulate Drosophila tissue polarity and vertebrate gastrulation? Trends Genet. 18, 564–571 (2002).

3. Keller, R. Shaping the vertebrate body plan by polarized embryonic cell movements. Science 298, 1950–1954 (2002).

4. Strutt, D. Frizzled signalling and cell polarisation in Drosophila and vertebrates. Development 130, 4501–4513 (2003).

5. Veeman, M. T., Axelrod, J. D. & Moon, R. T. A second canon. Functions and mechanisms of β-catenin-independent Wnt signaling. Dev. Cell 5, 367–377 (2003).

6. Guo, N., Hawkins, C. & Nathans, J. Frizzled6 controls hair patterning in mice. Proc. Natl Acad. Sci. USA 101, 9277–9281 (2004).

7. Montcouquiol, M. et al. Identification of Vangl2 and Scrb1 as planar polarity genes in mammals. Nature 423, 173–177 (2003).

8. Tree, D. R. et al. Prickle mediates feedback amplification to generate asymmetric planar cell polarity signaling. Cell 109, 371–381 (2002).

9. Katanaev, V. L., Ponzielli, R., Semeriva, M. & Tomlinson, A. Trimeric G protein-depend-ent frizzled signaling in Drosophila. Cell 120, 111–122 (2005).

10. Strutt, D., Johnson, R., Cooper, K. & Bray, S. Asymmetric localization of frizzled and the determination of notch-dependent cell fate in the Drosophila eye. Curr. Biol. 12, 813–824 (2002).

11. Zheng, L., Zhang, J. & Carthew, R. W. frizzled regulates mirror-symmetric pattern forma-tion in the Drosophila eye. Development 121, 3045–3055 (1995).

12. Jenny, A., Darken, R. S., Wilson, P. A. & Mlodzik, M. Prickle and Strabismus form a functional complex to generate a correct axis during planar cell polarity signaling. EMBO J. 22, 4409–4420 (2003).

13. Wolff, T. & Rubin, G. M. strabismus, a novel gene that regulates tissue polarity and cell fate decisions in Drosophila. Development 125, 1149–1159 (1998).

14. Das, G., Jenny, A., Klein, T. J. & Mlodzik, M. Diego interacts with Prickle and Strabismus/Van Gogh to localize planar cell polarity complexes. Development 131, 4467–4476 (2004).

15. Feiguin, F., Hannus, M., Mlodzik, M. & Eaton, S. The Ankyrin repeat protein Diego mediates Frizzled-dependent planar polarization. Dev. Cell 1, 93–101 (2001).

16. Strutt, D. I. Asymmetric localization of frizzled and the establishment of cell polarity in the Drosophila wing. Mol. Cell 7, 367–375 (2001).

17. Bastock, R., Strutt, H. & Strutt, D. Strabismus is asymmetrically localised and binds to Prickle and Dishevelled during Drosophila planar polarity patterning. Development 130, 3007–3014 (2003).

18. Axelrod, J. D. Unipolar membrane association of Dishevelled mediates Frizzled planar cell polarity signaling. Genes Dev. 15, 1182–1187 (2001).

19. Boutros, M., Paricio, N., Strutt, D. I. & Mlodzik, M. Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell 94, 109–118 (1998).

20. Strutt, D. I., Weber, U. & Mlodzik, M. The role of RhoA in tissue polarity and Frizzled signalling. Nature 387, 292–295 (1997).

21. Taylor, J., Abramova, N., Charlton, J. & Adler, P. N. Van Gogh: a new Drosophila tissue polarity gene. Genetics 150, 199–210 (1998).

22. Park, M. & Moon, R. T. The planar cell polarity gene stbm regulates cell behaviour and cell fate in vertebrate embryos. Nature Cell Biol. 4, 20–25 (2002).

23. Schwarz-Romond, T. et al. The ankyrin repeat protein Diversin recruits Casein kinase Iε to the β-catenin degradation complex and acts in both canonical Wnt and Wnt/JNK signaling. Genes Dev. 16, 2073–2084 (2002).

24. Adler, P. N., Krasnow, R. E. & Liu, J. Tissue polarity points from cells that have higher Frizzled levels towards cells that have lower Frizzled levels. Curr. Biol. 7, 940–949 (1997).

25. Penton, A., Wodarz, A. & Nusse, R. A mutational analysis of dishevelled in Drosophila defines novel domains in the dishevelled protein as well as novel suppressing alleles of axin. Genetics 161, 747–762 (2002).

26. Rothbacher, U. et al. Dishevelled phosphorylation, subcellular localization and multimerization regulate its role in early embryogenesis. EMBO J. 19, 1010–1022 (2000).

27. Wong, H. C. et al. Direct binding of the PDZ domain of Dishevelled to a conserved inter-nal sequence in the C-terminal region of Frizzled. Mol. Cell 12, 1251–1260 (2003).

28. Carreira-Barbosa, F. et al. Prickle 1 regulates cell movements during gastrulation and neuronal migration in zebrafish. Development 130, 4037–4046 (2003).

29. Gubb, D. et al. The balance between isoforms of the prickle LIM domain protein is critical for planar polarity in Drosophila imaginal discs. Genes Dev. 13, 2315–2327 (1999).

30. Brand, A. H. & Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401–415 (1993).


S U P P L E M E N TA RY I N F O R M AT I O N

WWW.NATURE.COM/NATURECELLBIOLOGY 1

Figure S1 (a) Dgo interacts specifically with the Basic-PDZ region of Dsh but not with P53 or Lamin C in yeast two-hybrid assays. Baits are indicated on the left and preys on top. The interaction of P53 with SV40T served as positive control. Assays were performed in duplicate. (b) Schematic of Dgo and mouse Diversin with the region shown in the alignment in (c) marked in red. (c) Alignment of the region of Diego sufficient to bind Dsh (∆C3 in Fig. 3c) from D. melanogaster (gi24652550), D. pseudoobscura (gi54636910), A. gambiae (gi31240123), A. melifera (gi48097710), and human (gi40788998), chicken (gi50744700), mouse (gi19924302),

Zebrafish (gi56208021) Diversin are shown. (d) His6-tagged Pk competes with in vitro translated Dgo∆Ank for binding the basic-PDZ region of Dsh as does in vitro translated Pk for His6-tagged Dgo∆Ank (Fig. 3d). Lane 1: 100% of input used for pull-down experiments in lanes 2-15. Compared to binding in the absence of competitor (lane 2), increasing amounts of His6-tagged Pk (H-Pk; lanes 3-8), but not of an unspecific competitor (H-control; lanes 9-14) prevent Dgo∆Ank from binding to Dsh. Dgo∆Ank does not bind to unrelated Gst-fusion protein (lane 15). For experimental detail see Methods.

a bDgo 927 aa

mouse Div 712 aa

A. melifera DgoHuman Div

Chicken DivMouse Div

Zebrafish DivConsensus

Anopheles DgoD. pseud. Dgo

D. mel Dgo





D. mel Dgo





D. mel Dgo

SV40T Dgo

P53

Lamin C

Dsh B-PDZ

c

100%

Inp

ut

H-Prickle H-ControlNeg.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

S-Dgo∆Ank35

d



2 WWW.NATURE.COM/NATURECELLBIOLOGY

DIX B PDZ DEPG-Dsh:

G-D

sh D

EP

-Cte

rm

G-C

ontr

ol

G-D

sh

G-D

sh ∆

Cte

rm

G-D

sh B

-PD

Z

25014898

64

50

36

Figure S2 For quality control, 500ng of each of the GST-fusion proteins indicated on top of the panel and color-coded below were separated on a 12% SDS-PA gel that was stained with Coomassie Blue. Predicted molecular

masses are: G-Control: 34.9 kDa, G-Dsh: 96.3 kDa, G-Dsh∆Cterm: 84.6 kDa, G-Dsh B-PDZ: 43.8 kDa, G-Dsh DEP-Cterm: 51.9 kDa.



WWW.NATURE.COM/NATURECELLBIOLOGY 3

Table S1 Genetic interactions.

GOF %±stdv

sev-Fz/w- 70.4±13.1

sev-Fz/dgo308 11.1±4.0*

sev-Fz/dgo380 20.7±6.7*

sev>Dgo/w- 15.5±3.8

sev>Dgo/fzF31 6.2±2.1*

sev>Dgo/fzR52 6.9±2.4*

sev>Dgo/dsh1 4.3±1.6*

sev>Dgo/dshV26 4.9±1.2*

sev>Dgo/rhoA72o 4.1±1.6*

sev>Dgo/rhoA79-3 5.2±1.5*

sev>Dgo/N 35.9±8.2*

sev>Dgo/Dl 31.2±2.4*

sev>Dgo/pk-sple6 31.2±3.5*

sev>Dgo/pk-sple13 38.4±2.0*

sev>Dgo/stbmnull 26.7±2.5*

sev>Dgo/stbmX 23.2±4.3*

sev>Dgo/pk-sple13,stbmnull 67.9±4.8*

sev>Dgo/top38c 16.4±2.2

sev-Dsh/w- 68.0±4.3

sev-Dsh/dgo308 50.8±6.6*

sev-Dsh/dgo380 48.8±3.1*

LOF

w-;dgo269 8.8±3.3

dsh1/w-;dgo269 24.8±5.8*

dshV26;w-;dgo269 20.0±7.4*

dsh1/Y;+/+ 51.8±11.0

dsh1/Y;pk1/+ 29.5±3.6*

dsh1/Y;sple1/+ 41.7±6.7

dsh1/Y;pk-sple13/+ 41.3±3.0

dsh1/Y;stbmnull/+ 50.4±8.6

dsh1/Y;stbmx/+ 47.9±4.4

dsh1/Y;pk-sple13,stbmnull/+ 37.0±5.6

Due to their differing phenotypes, wrong chirality was scored for sev>Fz and sev>Dgo interactions while achiral ommatidia were scored for sev>Dsh interactions. For the loss of function interactions, wrong chirality, symmetric ommatidia and rotation defects were scored. The EGFR allele top38c is shown as example for a locus that does not interact with sev>Dgo. * denotes differences significant at p≤0.02. Y stands for the Y chromosome. w1118 (w-) was used as control.


Nat. Cell Biol.

Documents

Transcript of Nat. Cell Biol.