Nanopore Sequencing - The Long and the Short of it
Transcript of Nanopore Sequencing - The Long and the Short of it
![Page 1: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/1.jpg)
Nanopore Sequencing - The Long and the
Short of it
Monolina Binny
Field Applications Specialist
![Page 2: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/2.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Our goal: to enable the analysis of any living thing,
by any person, in any environment
Reproductive health
Consumer genomics
Clinical genetics
Infectious disease
Oncology
Pharmaceuticals
Health
Biodefense
Outbreak surveillanceEnvironmental
monitoring
Checkpoint species ID
Security
Research
Plants/crops
Genome Science
Human genetics
Cancer research
Transcriptomics
Clinical research
Pathogens /microbiology
Environmental
Industry
Food safety and efficiency
Agriculture
Biopharma production
Environmental
Water testing
Forensics
Education
Schools
Citizen Science
Universities
![Page 3: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/3.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
NANOPORE DNA SEQUENCINGHow does it work?
Multiple nanopore sensors arrayed in one
device
Operate independently but at the same
time
Motor
(E6, E7, E8)
Nanopore Reader
(R7, R8, R9, R10 etc...)
Membrane
(M9, M10 etc...)
Run Conditions
(Salt, fuel, script, temperature...)
Algorithm
(HMM, RNN etc...)
Nanopore sensing
![Page 4: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/4.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
2048 (512*) channels
Nanopore products: fully scalableOne core technology: real-time, on-demand
*up to this number of nanopore channels may be available for sequencing at any time
Single-test
sequencing
128 channels
Portable, USB powered
biological analysis
2048 (512*) channels
Commercially available
Five flow cells and
integrated computing
5 x 2048 (5 x 512=2,560*)
channels
Commercially available
High-throughput, versatile
benchtop system
48 x 12,000
(3,000 = 144,000*) channels
Commercially availableCommercially available
![Page 5: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/5.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
2019
Yield per flow cell, 1D chemistry
1Gb
10Gb
20Gb
2014
5Gb
30Gb
2015 2016 2017
target
R6
30bps
R6
30bps
R7
70bps
R9
250bps
R9.4
450bps
2018
R9.4
450bps
Evolution of
MinION/GridION flow
cell performanceR9.4
450bps
Software
upgrades
Increased
runtime
Current
record ~50Gb
![Page 6: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/6.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Which DNA kit?
(SQK LSK109)
![Page 7: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/7.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
DNA Sequencing Kits
RAPID SEQUENCING (SQK-RAD004)
10 minutes. Fragmentation based, no third-
party ligase required.
Ligation vs Rapid
1D LIGATION SEQUENCING (SQK-LSK109)
60 minutes. Flexible high yield library prep.
![Page 8: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/8.jpg)
RNA Sequencing Kits
![Page 9: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/9.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
RNA sequencing with Nanopore technology
Gene
Short
reads
Nanopore
reads
Span the entire length of a fragment
Full splice information for a fragment
Differential gene expression
Isoform counting made simple
Strand specific information
Normalisation to read length not required
Detect fusion genes
![Page 10: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/10.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
![Page 11: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/11.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Overview of library preparation for long read RNA sequencing
PCR-cDNA Direct cDNA Direct RNA
![Page 12: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/12.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Base modification detection with Direct RNA
Different current disruption
caused by modified bases
Third party tools have been
developed for detection
(nanopolish, signalAlign)
Tombo – found on ONT github
![Page 13: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/13.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Extraction methods
Internally investigating impact of extraction methods on performance and providing guidance
Time
Protocol builder available to assist
users with choosing the best protocol
for their sample and desired analysis
yie
ld
![Page 14: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/14.jpg)
Improving accuracy
![Page 15: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/15.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
1D2, R9.5
100%
90%
80%
1D, R7
1D, R9
1D, R9.4
1D, R6
90% of
readsMost
frequent
1D, R9.4.1
flip-flop
basecaller
Single molecule accuracy: internal results
20192014 2015 2016 2017 2018
1D, R9.4.1
Shift from event-based
basecalling to signal-based
basecalling (transducer)
Improved
basecalling
network
![Page 16: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/16.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Q50: 99.999%
Benchmark
Q40: 99.99%
Q30: 99.9%
Consensus accuracy: internal results
R9
Estimated
spread
R9.4.1
Target: consolidate Q50
then Q60 by further
evolving pores, base
callers, sample chemistry,
mixed signals
Improved references also
greatly impact accuracy
and sequencing
community is continuously
improving these
R10
Q43
Transducer
+
Medaka
20192016 2017 2018
R10
Q50
(99.999)
flip-
flop+
Medaka
Results shown include various consensus methods including Medaka polishing of base calls and Nanopolish signal level polishing, end 2018
R9.4.1
~Q40
flip-flop+
Medaka
![Page 17: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/17.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
CONSENSUS SEQUENCING ACCURACYSources of error in consensus
Modified / damaged
bases
Untrained context /
diversity of training sets
Base calling and training Assembly and polishing
Single read chunking
and scaling
Similar currents for
different sequences
Flat regions of signal
(e.g. homopolymers)
Generalisation of
models to all runs
Unoptimised methods
for longer reads
Chemistry
Many tools do not use
dwell time information
Quality scores poorly
represent error
Simplified to bases
(information loss)
Not fully utilising raw
data / alternative paths
Dependence on high
quality reference
Limitations of Viterbi
decoding
![Page 18: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/18.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
BASECALLINGGenerations of algorithms – 1D raw read
Strong history of improving accuracy
• Algorithms for base calling improving continuously
• Track record of cutting-edge base calling
• New methods can be applied to old “raw” data
Current “Flip-flop”
Mode ~ 95%
Albacore 2.3.4 Transducer
Guppy 2.3.1 Transducer
Guppy 2.3.1 Flip–flop
Guppy 2.3.5 Flip-flop
84% 88% 92% 96% 100%80%
Alignment 1D raw read accuracy
Read c
ount
1D R9.4.1 read
accuracy
S. Aureus
HMM
RNN (raw)
Transducer
RNN (events)
RNN (events)
Transducer
![Page 19: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/19.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
BASECALLINGSignal to Sequence
New “flip-flop” algorithm
• Network is learning to call the correct sequence NOT a
set of pre-labelled classifications
• All paths of signal to sequence are considered
• Samples in signal are not directly associated with bases
• Flip(+) and Flop(-) discriminates between no-movement
and repeats (e.g. in homopolymer)
• Network outputs transitions between single bases
• Simple decoding
• Trace output - human interpretable
• More meaningful quality scores TTACAGGTGCTCAGTACCATTTGTT
A+T+ C+T-
A+G+G-T+G+ C+T+C+ A+ T+G+ A+C+
C-A+T+
T-G+T+ T+
T-
A(+)→ C(+), G(+), T(+)
A(+)→ A(-)
A(-)→ A(+)
A(-)→ C(+), G(+), T(+)
Raw signal
Recurrent Neural
Network
(over time-steps)
Base call
RNN
Per-flipflop
Base probabilities
Base to base
transitions
(per time-step)Transitions
![Page 20: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/20.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
BASECALLINGFlip-Flop for DNA and direct RNA
Raw read 1D accuracies
• Moving over to Flip-flop for all base calling
• “Fast” network as accurate as transducer
• “High accuracy” 1D base caller at ~95% modal
accfast
Direct RNA Tra
nsd
uce
rF
lip-flo
p
80 85 90 95 100
density
1D accuracy (%)
DNA
80 85 90 95 100
density
Tra
nsd
uce
rF
lip-flo
p
accfast
1D accuracy (%)
RNA raw read 1D accuracies
• Direct RNA accuracy now comparable to DNA
• Hitting ~94% modal direct RNA with “high accuracy” caller
• Accuracy for GUAC, modifications possible in RNA signal
![Page 21: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/21.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
BASECALLINGModified bases
Base calling multiple modifications
• Categorical approach to base calling – scales gracefully
• Single model trained to call 5mC and 6mA
• Train for any modification and context given training data
Availability and roadmap
• Released in Taiyaki – training and calling
• Integrating calling into Guppy & MinKNOW – July 2019
• “All context” methods in R&Ddensity
Modified base score Modified base score
density
5mC
Canonical Canonical
6mA
CCWGGGATC
![Page 22: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/22.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
CONSENSUSMedaka
Medaka: pileup-based consensus correction
• Align reads to draft assembly
• Count bases in reads segregated by strand
• Bi-directional GRU network to form base probabilities
• 1 minute per 10Mb of draft on GPU
• Available from: Github, PyPI, Bioconda
• Epi2Me coming soon (Oct 2019)
2018
30
32
34
36
38
40
42
44
25 50 75 100 125 150
coverage
co
nse
nsu
s Q
B.Subtilis
E.coli
E.faecalis
L.monocytogenes
S.aureus
S.enterica
R9.4.1
Highly accurate Nanopore genomes
• Data collected with the R9.4.1 baselines chemistry
• 1D flip-flop calls with “high accuracy” model
• Medaka consensus correction
• S. aureus consensus now at Q44
![Page 23: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/23.jpg)
Pores
![Page 24: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/24.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Approx. 5 bases
dominate the
current signal
R9.4.1: Mixed sequence (highly accurate)
R9.4.1: Homopolymer sequence (difficult with “sharp reader”)
10xT 10xT 10xT
R9.X pores have a sharp reader head
• Very good in mixed sequence regions
• Okay when homopolymers are short (< 5)
• Struggle to discriminate longer homopolymers
• Weak information in current levels for homopolymers > 5
• Some additional information is in dwell time (motor speed)
• Fix: longer reader → more information → higher accuracy
CONSENSUS SEQUENCING ACCURACYReasons for the accuracy gap
![Page 25: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/25.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
New pore accurately calls homopolymers
• A pore with a longer or multiple “readers” has more bases dominating the signal
• Longer homopolymers are “seen” by the pore and can be decoded with high accuracy
Unpolished homopolymer accuracy
R9.4.1
R10
0
20
40
60
80
100
Accura
cy %
Homopolymer length
3 4 5 6
R10
R9.4.1
CONSENSUS SEQUENCING ACCURACYNew chemistry for improved accuracy – R10
![Page 26: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/26.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
CONSENSUS SEQUENCING ACCURACYR10 consensus accuracy
Consensus accuracy > Q50
• Accuracy > Q40 at 30X coverage
• Q54 achieved for Staphylococcus aureus (May 2019)
• Significant improvements from the R9 chemistry
Consensus correction trained for R10
• Medaka optimised for new pore chemistry
• Significant uplift in consensus accuracy
• R10 models will be made available
Q score Number of errors
Q40 1 error in 10,000 bases
Q50 1 error in 100,000 bases
Q60 1 error in 1,000,000 bases
30
35
40
45
50
55
25 50 75 100 125 150
coverageco
nse
nsu
s Q
B.Subtilis
E.coli
E.faecalis
L.monocytogenes
S.aureus
S.enterica
R10 consensus accuracy (May 2019)
![Page 27: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/27.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
R101D raw read accuracy and output
Upgrading orders
• Support can upgrade open R9 flow cells orders to R10 or
R10.3
What happens to R9?
• R9.4.1 Available and supported across all devices
• R9.5.1 Available only on MinION / GridION
MinION / GridION R10 flow
cells:In store May Ships in June
PromethION R10 flow cells: In store May Ships in July
Flongle R10 flow cells: In store Sept Ships in Sept
R10 upgrade path
85 90 95 100
1D raw accuracy (%)
R10
R9.4.1
R10 1D raw read accuracy
R10 Output
• MinION/GridION flow cell: 26 Gb
• PromethION flow cell: 112 Gb
![Page 28: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/28.jpg)
28 | © Copyright 2019 Oxford Nanopore Technologies. Oxford Nanopore Technologies products are currently for Research Use Only.
Beyond R10 (R10.3 is available now)
Further improvements to R10
Mutants for better signal-to-noise ratio
Improve purification
– Less blocking: better throughput
Base callers/ models
Tailored consensus tools
Direct RNA-specific improvements
New pores: “R10b”, “R11”
New reader heads with different signal profiles
Different base discrimination
Different signals in homopolymer regions
Even longer reader heads
Future nanopores for further accuracy enhancement
R10
R10b
10xT 10xT 10xT
10xT10xT 10xT
RH1
RH2
Consensus
accuracy
![Page 29: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/29.jpg)
29 | © Copyright 2019 Oxford Nanopore Technologies. Oxford Nanopore Technologies products are currently for Research Use Only.
![Page 30: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/30.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Q60
Sample chemistry
(“8B4”)
Nanopore chemistry
(R10, R11..etc..)
Base callers
(CTC, flip-flop)
Combine pores
(R9 + R10, R10a + R10b)
Major focus on improving accuracy
• Achieving > Q50 with single nanopore option
• Many different paths to higher accuracies
• Algorithms, chemistry, data combinations
Single chemistry options
• Higher accuracy from R10 improvements
• Novel base calling architectures
• Randomised signals with chemistry (e.g. “8B4”)
Multiple data types
• Nanopores capable of multiple chemistries
• Generate different signals and errors
• Could combine different pores, chemistry…etc…
CONSENSUS SEQUENCING ACCURACY – ROUTE TO Q60Combining data from a single platform
![Page 31: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/31.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
What are the advantages for Long reads and Clinical genomics
Sensitivity
Long reads enable you to
detect:
SVs
CNVs
Phasing
STR length
Abnormally spliced
transcripts
Flexibility
Sequence what you want,
when you want
Real time analysis
– No fixed run time -
run until you have
your answer then
stop
Random access
– No batching required
– Reduce TAT for time
critical tests
Multifunctionality
One platform and one
assay can yield:
Aneuploidy
Sub-chromosomal SVs
and CNVs
SNVs
Methylation
Affordability
No capital required to buy
the box:
$1000 gets you started
with a MinION
GridION and
PromethION available
on consumables
purchase models
No need to ‘fill’ the
machine to make the
numbers work
![Page 32: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/32.jpg)
Whole genome sequencing
![Page 33: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/33.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Rapid preimplantation genetic screening (PGS) using a handheld DNA sequencerWei et. al, March 2018, BioRxiv, https://doi.org/10.1101/274563
In this paper, Wei et al. demonstrate a 2.5 hour WGA amplification, 45 minute library preparation and < 2 hour sequencing workflow for
correct detection of aneuploidy.
![Page 34: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/34.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures34
HIGHER-RESOLUTION ANALYSES FROM LOW COVERAGE
Chromosome 5p- deletion detected in Cri-du-chat syndrome cell line
Partial deletion of the short
arm of chromosome 5
These results are a 50/50 mix of sheared gDNA and whole genome
amplified (~500 bases) reads and the coverage is 1.6x
By downsampling we can see the deletion by using:
Non-amplified, sheared gDNA: 0.07x or 25k reads
Whole genome amplified DNA: 0.025x or 70k reads
![Page 35: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/35.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Wigard Kloosterman
Center for Molecular Medicine, UMC Utrecht
Mapping and phasing of structural variation
TECHNIQUES: Structural variants
Using the data:
Comparison between short and long reads identified
the de novo chromothripsis sample
Nanopore reads resulted in:
– de novo breakpoint identified and verified
– Resolution of a deletion and tandem duplication in
two SVs
– Phasing of the > 2000 SVs
Phasing of the de novo chromothripsis sample using
long reads showed SVs were from the father.
![Page 36: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/36.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Deciphering complex SV in neonates with developmental disorders
“…we identified a de novo duplication-inversion-
duplication overlapping CDKL5 in an individual with
neonatal hypoxic-ischaemic encephalopathy. Long-
read sequencing technology used to resolve the
breakpoints demonstrated the presence of both a
disrupted and an intact copy of CDKL5 on the same
allele; therefore, it was classified as a variant of
uncertain significance.”
“…Accurate resolution of cxSVs is essential for
clinical interpretation, and here we demonstrate that
long-read WGS is a powerful technology by which to
achieve this.”
![Page 37: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/37.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Simultaneous profiling of chromatin accessibility and methylation on human cell
lines with nanopore sequencingLee et al., Dec 2018, BioRxiv, https://doi.org/10.1101/504993
Developed nanoNOMe – combined NOMe-seq
detection of methylation and chromatin
accessibility with nanopore sequencing
Combining NOME-seq with long-read nanopore
sequencing obtains long-range information; as
nanopore can directly discriminate methylated
from unmethylated bases, bisulfite conversion
and PCR are unnecessary
Nanopore sequencing enabled the analysis of
methylation, chromatin accessibility and
investigation of structural variants and their
sequencing context in a single assay
Understanding the relationship between the
genome and epigenome with nanoNOMe
![Page 38: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/38.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Systematic analysis of dark and camouflaged genes: disease-relevant genes
hiding in plain sight
The human genome has “dark” regions which
are those that cannot be assembled or aligned
using short-read sequencing.
Ebbert et al., Jan 2019, BioRxiv, https://doi.org/10.1101/514497
These regions could contain mutations
associated with disease so their analysis
would be highly valuable
Long reads were used to try and resolve
“dark” (few mappable reads) and
“camouflaged” (ambiguous alignment e.g. due
to duplication) regions in short-read whole-
genome sequencing data
In short-read data, identified 37,873 dark
regions across 5,857 genes; 28,751
intronic, 2,657 in protein-coding exons
![Page 39: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/39.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Systematic analysis of dark and camouflaged genes: disease-
relevant genes hiding in plain sight
Ebbert et al., Jan 2019, BioRxiv, https://doi.org/10.1101/514497
• SMN1 and SMN2, involved in spinal muscular
atrophy and ALS, reduced from 89.9% and 88.2%
“camouflaged”, respectively,Both genes were 0% camouflaged CDS based
on ONT and PacBio
![Page 40: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/40.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Systematic analysis of dark and camouflaged genes: disease-
relevant genes hiding in plain sight
Ebbert et al., Jan 2019, BioRxiv, https://doi.org/10.1101/514497
• Top-ten Alzheimer’s gene CR1 reduced
from 26.5% “camouflaged” to 0% using
nanopore data
• SMN1 and SMN2, involved in spinal
muscular atrophy and ALS, reduced from
89.9% and 88.2% “camouflaged”,
respectively, 0% using nanopore data
• Top-ten Alzheimer’s gene CR1 reduced from
26.5% “camouflaged” to 0% using nanopore
data
![Page 41: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/41.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Systematic analysis of dark and camouflaged genes: disease-relevant genes
hiding in plain sight Ebbert et al., Jan 2019, BioRxiv, https://doi.org/10.1101/514497
Resolution of “dark” coding sequences =
81.8% in nanopore data, compared to 66.6%
and 54.9% for other long-range technologies
Nanopore ultra-long reads have greater
mapping ability than other long-range
technologies, allowing resolution of difficult
“dark” coding sequences
“Comparing long-read sequencing technologies…the
ONT platform performed best, both when assessing
entire gene bodies, and when considering only CDS*
regions.”
*CDS = coding sequences
![Page 42: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/42.jpg)
Targeted sequencing
![Page 43: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/43.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Detecting and phasing SNPs in GBA for Gaucher’s and Parkinson’s Disease
Results: We detected all known missense
mutations in these samples, including the
common p.N409S (N370S) and p.L483P
(L444P) in multiple samples, and nine rarer
ones, as well as a splicing and a truncating
mutation, and intronic SNPs. We
demonstrated the ability to phase mutations,
confirm compound heterozygosity, and
assign haplotypes.. Rare false positives
were easily identified and filtered, with the
Nanopolish
Conclusion: The Oxford Nanopore MinION
can detect missense mutations and an
exonic deletion in this difficult gene, with the
added advantage of phasing and intronic
analysis.
![Page 44: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/44.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
The workflowSimple, fast
enrichment with
CRISPR- Cas
![Page 45: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/45.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Multiplex CRISPR-Cas enrichment of clinically relevant genomic repeat structuresMartin Elferink (University Medical Center, Utrecht), Nanopore Community Meeting 2018
>40 neurological & neurodegenerative diseases caused by
repeat expansions; can be several kilobases long
– Number of repeats often indicates disease severity
– Long nanopore reads can span entire repeat expansions
Multiplex CRISPR/Cas enrichment of 10 loci in healthy control
sample - Cas9: just under 600x; Cas12a: 200x
– High-specificity cleavage sites
– All alleles & relevant SNPs detected in 7; remaining 3
detected but no informative variants seen
Cas9 workflow tested on patient samples: all but one
(degraded) sample >100x coverage of ROIs
– Identified alleles agreed with patient’s diagnosis
– repeat expansion counts broadly agreed with those from
traditional assays
Watch Martin’s full talk here: https://nanoporetech.com/resource-centre/martin-elferink-multiplex-crispr-cas-
enrichment-clinically-relevant-genomic-repeat
![Page 46: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/46.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Targeted Nanopore Sequencing with Cas9 for studies of methylation, structural
variants and mutations
Profiling SVs in driver genes from breast cancer cell lines using a low cost, PCR free approach
Gilpatrick et al., April 2019, BioRxiv, http://dx.doi.org/10.1101/604173.
• Probes designed to bind up/down stream of two
known deletions
• Heterozygous vs homozygous deletions could
be distinguished and phased to the parent of
origin in all cases
• Breakpoints were defined and methylation
profiles observed.
![Page 47: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/47.jpg)
Oncology
03
![Page 48: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/48.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Same-day genomic and epigenomic diagnosis of brain tumours using real-time
nanopore sequencing
In the same sequencing run, from native tumour DNA:
Copy number profile
Methylation profile
Structural variation
Point mutations
…after 6 hours of sequencing.
Euskirchen et. al, June 2017, Acta Neuropathologica,10.1007/s00401-017-1743-5
“aiming to make precision medicine
possible for every cancer patient,
even in resource-limited settings”
![Page 49: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/49.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Same-day genomic and epigenomic diagnosis of brain tumours using real-time
nanopore sequencing
“Same-day diagnosis of CN alterations, epigenetic modifications, and single nucleotide
variants using nanopore sequencing is feasible with minimal capital cost and without
need for sophisticated laboratory equipment.
For CNS tumors, molecular features demanded for diagnosis by current guidelines can
be obtained, which, together with histological data and grading, enable accelerated
integrated diagnosis and improve patient care.”
Euskirchen et. al, June 2017, Acta Neuropathologica,10.1007/s00401-017-1743-5
Classification of tumours subjected to R9.4 WGS using ad hoc random forests, 500
trees per sample. Distributions from copy number, methylation and combined profiles.
Indication of time required to reach 1000X
coverage of each target amplicon.Comparison of selected variant
calls nanopore to reference.
![Page 50: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/50.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Long read sequencing reveals a novel class of structural aberrations in lung
cancers
Whole genome and transcriptome profiling of cancer cell lines and clinical samples using
PromethION detects novel complex SVs, novel gene fusions and recurrent SNVs
Sakamoto et al. April 2019, Biorxiv, https://doi.org/10.1101/620047
• Identified known driver SNVs in KRAS and
NRAS
• Pinpointed genomic break point of the
CCDC-RET fusion
• Delineated differences between cell lines in
the size of the deletion of the CDKN2A
gene
![Page 51: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/51.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Long read sequencing reveals a novel class of structural aberrations in lung
cancers
Whole genome and transcriptome profiling of cancer cell lines and clinical samples using
PromethION detects novel complex SVs, novel gene fusions and recurrent SNVs
Sakamoto et al. April 2019, Biorxiv, https://doi.org/10.1101/620047
• Detected “cancerous local
genomic lesions” (CLCLs) that
could not be resolved by short
read seq.
• STK11 gene disrupted by two
inversions and a deletion in a cell
line
• CLCL’s also found using
PromethION seq. of clinical
samples
• Strongly associated with LINE,
SINE and LTR elements
![Page 52: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/52.jpg)
Pore C
![Page 53: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/53.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Pore-C: using nanopore reads to delineate long-range interactions between genomic loci in the human
genome
![Page 54: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/54.jpg)
Clinical and public health microbiology
![Page 55: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/55.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
the advantage of long reads
Nanopore ultra-long reads enable the highest
sensitivity for detection of trends in:
Antimicrobial resistance
Virulence
Vaccine escape
What do I mean by ultra long?
• 10-100’s Kb routinely
• Up to >2 Mb (so far) using ‘ultra long’ DNA prep
methods
• Can cover E. coli genome in as few as 8 reads
PlasmidsSingle-contig assemblies enable comprehensive resistance
and virulence profiling
Repetitive elementsLong reads map across repetitive elements containing
virulence and resistance genes
Complete genomesCreate more accurate and contiguous reference assemblies
PhylogeneticsConstruct longitudinal profiles of strain evolution, track
mobile elements and monitor prevalence trends
![Page 56: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/56.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Resolving the complex Bordetella pertussis genome using barcoded nanopore
sequencingRing et al., Nov 2018, Microbial Genomics, doi: 10.1099/mgen.0.000234
Unlike short reads, nanopore long reads span
repetitive regions, enhancing their resolution
Resolved genomes of five B. pertussis strains
with a single MinION flow cell
Ultra-long duplications detected in two strains
Most accurate assembly method is hybrid
assembly with pre-correction of reads with Canu
followed by Unicycler assembly
Resolving a repeat-rich bacterial genome
with high GC content
“This work expands the recently emergent theme that even the most complex genomes can be
resolved with sufficiently long sequencing reads”
Alignment of the five sequenced strains, showing genomic
rearrangement. The five strains were assembled using a nanopore-
only pipeline, resulting in single, closed-contig, assemblies.
![Page 57: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/57.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Completing your genomes – Hybrid Assembly
“…This approach paves
the way for high-
throughput and cost-
effective generation of
completely resolved
bacterial genomes to
become widely
accessible.”
Wick et al. . M Gen 3(10): doi:10.1099/mgen.0.000132
Li et al. GigaScience, Volume 7, Issue 3, 1 March 2018,
gix132, https://doi.org/10.1093/gigascience/gix132
![Page 58: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/58.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Direct RNA Sequencing of the Coding Complete Influenza A Virus Genome
“…successful sequencing of the
coding complete influenza A virus
genome with 100% nucleotide
coverage, 99% consensus identity, and
99% of reads mapped to influenza A
virus”
Keller et al., Sep 2018, Scientific Reports, https://doi.org/10.1038/s41598-018-32615-8
(A) Influenza A viruses contain highly conserved 12 and 13 nt sequences
at the 3′ and 5′ termini. (B) The key component of Oxford Nanopore direct
RNA sequencing is a Reverse Transcriptase Adapter (RTA) which targets
poly(A) mRNA and is ligated to the 3′ end of the mRNA. A sequencing
adapter is then ligated to the RTA which directs the RNA strand into the
pore for sequencing. (C) The RTA was modified to target the 3′ conserved
12 nt of the influenza A virus genome. (D) The modified RTA hybridizes
and is ligated to vRNA in the first step of direct RNA sequencing.
Used a modified adaptor to target the 3’ of the negative
sense RNA into the nanopore
![Page 59: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/59.jpg)
Metagenomics
![Page 60: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/60.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Nanopore Sequencing as a Surveillance Tool for
Plant Pathogens in Plant and Insect TissuesBadial et al., Aug 2018, Plant Disease,
https://doi.org/10.1094/PDIS-04-17-0488-RE
Metatranscriptome analysis of infected
plant and insect tissues
Candidatus Liberibacter asiaticus or plum pox virus
infection
MinION sequencing identified all target pathogens in the
samples tested
Reads with favourable mapping quality produced
throughout entirety of the run
“Plum pox virus and Ca. L. asiaticus were detected in
both tissue and insect samples near the beginning of
each sequencing run, demonstrating the capability of
this methodology to obtain results rapidly”
![Page 61: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/61.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Why is Lake Hillier pink?
The eXtreme Microbiome Project (XMP) is a global
scientific collaboration to characterize, discover, and
develop new pipelines and protocols for studying novel
microorganisms in extreme environments.
XMP collected and analysed lake water and sediment
samples using a variety of metagenomics techniques
MinION with the WIMP workflow was used for rapid
species identification and characterisation
The analysis revealed a surprising range of microbial
diversity in the lake, and indicated that many algal,
bacterial, and archaeal halophiles contribute to the
persistent pigmentation of this pink paradise
Metagenomics with What’s In My Pot (WIMP)
Courtesy of Ken McGrath
![Page 62: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/62.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Rapid Diagnosis of Lower Respiratory Infection using Nanopore-based Clinical
Metagenomics
Urgent need for rapid microbiological diagnosis for timely, specific antibiotic therapy
Charalampous et al., Aug 2018, BioRxiv, https://doi.org/10.1101/387548
Clinical metagenomics pipeline –
removal of host nucleic acid, nanopore
sequencing on MinION, WIMP analysis
Turn around time 6 hours
Sensitivity of detection 96.6%
Antibiotic resistance analysis using ARMA
$130 per sample (6 samples per flow cell)
INHALE clinical trial (evaluation of pipeline
for diagnosis of hospital-acquired and
ventilator-associated pneumonia)MRSA genome coverage of depleted vs undepleted during two hours of sequencing
![Page 63: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/63.jpg)
© Copyright 2019 Oxford Nanopore Technologies Oxford Nanopore Technologies products are currently for Research Use Only. Not for use in diagnostic procedures
Metagenomic sequencing at the epicenter of the Nigeria 2018 Lassa fever outbreak
L. E. Kafetzopoulou et al., Science, 2019
Performed metagenomic sequencing on
samples from 120 patients over 7 weeks
48 hours sequencing on FLO-MIN106. Up
to 6 samples multiplexed per flow cell along
with a negative control (water blank).
Analysis tools: Canu for de novo assembly.
Called variants using Nanopolish;
performed metagenomic classification
using Centrifuge.
Performed phylogenetic analysis by
comparing all sequences with those
available in GenBank and unpublished
sequences obtained between 2012-2017.
![Page 64: Nanopore Sequencing - The Long and the Short of it](https://reader031.fdocuments.in/reader031/viewer/2022012409/616a446211a7b741a350a3e1/html5/thumbnails/64.jpg)
Please follow us on Twitter: @nanoporetech
Thank you!