Mutation Xuhua Xia [email protected] .
-
date post
19-Dec-2015 -
Category
Documents
-
view
215 -
download
1
Transcript of Mutation Xuhua Xia [email protected] .
Xuhua Xia Slide 2
- any detectable change in DNA sequenceeg. errors in DNA replication/repair
- inherited ones of interest in evolutionary studies
Deleterious- will be selected against and lost (purifying selection)
Advantageous- will be fixed in population by natural selection- rare occurrence
Neutral
- will have not effect on phenotype- may be fixed in population by genetic drift
Mutation
Xuhua Xia Slide 3
1. Point mutations
Transition = purine to purine or pyrimidine to pyrimidine
Transversion = purine to pyrimidine
How many possible transitions? transversions?
p.38 “In animal nuclear DNA, ~ 60-70% of all point mutations are TRANSITIONS, whereas if random expect 33%”
Type of Mutations
Xuhua Xia Slide 4
Missense mutation
Nonsense mutation
Synonymous
2. Insertions or deletions (“indels”)
Fig. 1.12
Non-synonymous
- different aa specified by codon
- change from sense codon to stop codon
- amino acid altered
- “silent” change
- frameshift mutations within coding sequences
Types of mutations
Xuhua Xia Slide 5
Spontaneous Point Mutation Rates
Organism G µb µg
Bacteriophage M13 6.4 x 103 7.2 x 10-7 0.0046
Bacteriophage l 4.9 x 104 7.7 x 10-8 0.0038
Bacteriophages T2 and T4 1.7 x 105 2.4 x 10-8 0.0040
Escherichia coli 4.6 x 106 5.4 x 10-10 0.0025
Saccharomyces cerevisiae 1.2 x 107 2.2 x 10-10 0.0027
Neurospora crassa 4.2 x 107 7.2 x 10-11 0.0030Mean 0.0034
G – genome sizeµb – mutation rate per site per generationµg – genomic mutation rate per generation
Table 4 in Drake et al. 1998, Genetics
Xuhua Xia Slide 6
Short insertions or deletions(short “indels”)
Fig.1.18
-rapid evolution change in copy numberof short tandem repeats
eg. if slippage during DNA replication
microsatellites
Slippage and Short Indels
Xuhua Xia Slide 7
Normal and Thalassemia HBb
• Are the two genes homologous?
• What evolutionary change can you infer from the alignment?
• What is the consequence of the evolutionary change?
10 20 30 40 50 60
----|----|----|----|----|----|----|----|----|----|----|----|--
Normal AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU
Thalass. AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU
**************************************************************
70 80 90 100 110 120
--|----|----|----|----|----|----|----|----|----|----|----|----
Normal GGAUGAAGUUGGUGGU-GAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG......
Thalass. GGAUGAAGUUGGUGGUUGAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG......
**************** ***************************************
Xuhua Xia Slide 8
Fig. 6.23
Do you agree or disagree with the following statement? see p.27
“A synonymous mutation may not always be silent.”
Synonymous mutation = silent mutation?
Xuhua Xia Slide 9
- increased copy number of tandem repeats of triplets withingene (or regulatory region)
- certain human genetic (neurodegenerative) diseases
- repeat number strongly correlates with age of onset of diseaseand severity
Gerald Karp 2007. Cell and Molecular Biology: Concepts and Experiments p.435
Repeat copy number in normal = red; orange = carrier; yellow = disease condition
Triplet repeat disorder
DM1: Dystrophia myotonica-protein kinase, DMPK on Chr 19DM2: ZNF9 gene on chromosome 3q21.
Category I: Huntington’s disease (HD) and the spinocerebellar ataxias, CAG in CDS. Category II: expansions tend to be more phenotypically diverse with heterogeneous expansions that are generally small in magnitude, but also found in the exons of genes. Category III: fragile X syndrome, myotonic dystrophy, juvenile myoclonic epilepsy, and Friedreich’s ataxia, non-CDS.
HTT on chr 4q16.3
Xuhua Xia Slide 10
wt
mutant
Bassell GJ, Warren ST (2008). "Fragile X syndrome: loss of local mRNA regulation alters synaptic development and function". Neuron 60 (2): 201–14.
male II-1 asymptomatic hemizygous carrier
daughter III-1 asymptomatic,but expanded repeat in germ line
Fragile X Syndrome
FMRP from FMR1
Xuhua Xia Slide 11
Huntington’s disease
4p16.3
Xuhua Xia Slide 12
- shown as single stranded, but both DNA strands inverted
Fig. 1.20
Inversion
through chromosome breakage & rejoining
Inversions, translocations, etc.
Xuhua Xia Slide 13
Fig. 1.20
- recombinationbetween indirect repeats
Inversion
What would be outcome ofrecombination betweendirect repeats?
Inversions, translocations, etc.
Xuhua Xia Slide 14
A B C D A D… … … …
+
See Fig. 1.17
Deletion
Xuhua Xia Slide 15
- short direct repeats, palindromes
- alternating Pu-Py dimers (Z-DNA)
- CpG in eukaryotes
-deamination of C to U,repaired by uracil-DNA glycolyase
- but 5-methyl C to Tescapes repair
Griffiths Fig. 7.16
patterns & positions ofmutations not random
“Hot spots” of mutation