MUTATION SCREENING OF DOPAMINE AND SEROTONIN CANDIDATE GENES IN TOURETTE'S SYNDROME ANI) ALCOHOL

DEPENDENT PATIENTS

Miles Thompson

A Thesis submitted in conformity with the requirements for the Degree of Master of Science

Graduate Department of Pharmacology University of Toronto

O Copyright by Miles Thompson

National Library 1*1 of Canada Bibliothéque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395. me Wellington OttawaON K1AON4 Ottawa ON K I A ON4 Canada Canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de

reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or othenvise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

Mutation screening of dopamine and serotonin candidate genes in Tourette's syndrome and alcohol dependent patients

Miles Thompson, M.Sc. 1 997

Department of Pharmacology

University of Toronoto

PhamacoIogical evidence suggests that both dopamine and serotonin system genes may be

involved in the inheritance of Tourette's syndrome (TS) and alcohol dependence. Dopamine

transporter antagoniçts used to treat attention deficit-hyperactivity disorder (AD-HD) worsen

comorbid with TS, emphasizing possible TS dopamine dysregulation. Serotonergic

antidepressants treating obsessive compulsive disorder (OCD) comorbid with TS and dcohol

dependence withdrawal aiso implicating serotonin dysregulation in these disorders. Therefore,

we conducted a candidate gene study of the dopamine D l (DRDI), dopamine transporter

(DAT I ) and serotonin transporter (SHTT) genes in these disorders. The DRD 1 gene was found

to be non-polymorphic in patient and control groups. Comrnon conserved sequence variants of

the DATl gene were identified but were not associated with TS or alcohol dependence. The

short promoter 5HTT gene was significantly more cornrnon in the TS group compared with

controls (X2~=0.04), suggesting that the SHTT gene may be a susceptibility locus in TS.

1 would like to thank Drs. Bnan O'Dowd and Susan George for the oppomuiity to be part of their

research group. 1 thank our collaborators, Drs. George ühl and David Vandenbergh of the

Laboratory of Molecular Neurobiology, NIDA, for their contributions tn my work on the

dopamine transporter gene; Dr. Jeanette Holden, Department of Psychiatry, Queens University

for help interpreting her candidate gene studies; Dr. James Kennedy and Dr. Glen Sunohara,

Neurogenetics Section, Clarke Institute, for invaluable insight into the correct tools required to

smdy the inheritance of complex neuropsychiatrie disorders. 1 thank Mr. Tuan Nguyen, Ms. Mai

Nguyen. Mr. Yang Shen and Mr. Adriano Marchese for their excellent technical advice. Lastly, 1

thank my farnily and friends for encouraging me to pursue graduate studies.

Abstract

Acknowledgments

Table of Contents

List of Tables

List of Figures

Abbreviations

PAGE

i

ii

iii

vii

viii

ix

1. INTRC)DUCTIOIY

1.1 Neurotransmitter G protein coupled-receptors and transporters in disease 1

1.2 Clinical definition of TS, associated disorders and alcohol dependence 3

(a) TS and comorbid neuropsychiatrie disorden 3

(b) Alcohol dependent disorder and associated withdrawal symptoms 4

1.3 The pharmacology of TS, associated disorders and alcohol dependence 5

(a) Typical and atypical neuroleptics implicate dopamine pathways in TS 5

(b) SFüs implicate serotonin pathways in TS-OCD and TS-anxiety 6

(c) Methylphenidate implicates dopamine pathways in TS-AD-HD 7

(d) SRIs implicate serotonergic pathways in alcohol dependence withdrawal 8

(e) Dopamine is implicated in animai models of aicohol consumption 10

1.4 Mode of inheritance of TS, comorbid disorders and alcohol dependence 10

(a) Autosomal dominant mode1 of TS 1 I

i i i

(b) Polygenic models ofTS, AD-HD, OCD and alcohol dependence

Candidate gene hypothesis of TS, comorbidities and alcohol dependence

The dopamine hypotheses of TS, AD-HD and alcohol dependence

(a) The DATI and DRD 1 genes are candidates for TS

(b) The DATl and DRD 1 genes are candidates for AD-HD

(c) The DATl and DRDl genes are candidates for alcohol dependence

The serotonin hypothesis

(a) The 5HTT gene is a candidate for TS

(b) The SHTT gene is a candidate gene for aicohol dependence

Screening candidate genes for sequence variants

(a) Mutation screening by SSCP analysis

Research objective: to screen candidate genes for sequence variants

(a) Isolate DATl gene sequence variants in TS and alcohol dependence

(b) lsolate DRDI gene sequence variants in TS and alcohol dependence

(c) Genotype 5HTT gene sequence variants in TS and alcohol dependence

Research straterrv for candidate gene screenine and association studies

2- * 2.0 Materials

2.1 DNA extraction

2.2 Clinical sarnples

(a) Tourette's syndrome samples

(b) Alcohol dependence samples

(c) Control samples

2.3 PCR amplification of gene fragments subjected to SSCP mutation screening

(a) Amplification of GPR19 gene fragments used to refme SSCP method

(b) Amplification of DRD 1 fragments to be analyzed by SSCP

(c) Amplification of DATl exons to be analyzed by SSCP

(d) Genotyping the DATl 3'VNTR by PCR amplification

(e) Genotyping the SHTT polymorphisms by PCR amplification

2.7 SSCP mutation screening of GPR19, DRD1 and the DATl gene

(a) Overview of the SSCP methodology

(b) SSCP protocol adapted for use with Xcell II apparatus (Novex)

2.8 Identification of sequence variants by chah-termination DNA sequencing

2.9 S tatistical Methods

39 l3IEmLE

3.1 SSCP mutation screening revealed polymorphic variants of the GPRl9 gene

3.2 SSCP mutation screening of the DRD 1 gene

3 -3 SSCP mutation screening of the DAT 1 gene

3.4 Association study of DATl polymorphisms in TS and alcohol dependence

3.5 Association study of SHTT polymorphisms in TS and alcohol dependence

4. DISCUSSION

4.0 Interpreting candidate gene sequence variants in patient and control groups

(a) Conservation of the DRD 1 gene in TS and alcohol dependence

(b) DATl gene sequence variants in TS and alcohol dependence

( c ) Association studies of SHTT variants in TS and alcohol dependence

4.1 Conclusions

TABLE

1. Oligonucleotides Used in PCR-SSCP Analysis of Human GPR19 gene

2. Oligonucleotides Used in PCR-SSCP Analysis of Human DRD 1 gene

-i 3. Oligonucleotides Used in PCR-SSCP Analysis of Human DATl

gene

4. DAT l allele and genotype fiequencies: %'P values compare population fiequencies

5 . SHTT allele and genotype fiequencies: X Z ~ values compare patient and control fiequencies

PAGE

37

38

40

FIGURE

1 .

2.

The principal of PCR-SSCP analysis

PAGE

26

Optimization of SSCP temperature, running time and voltage to resolve 48 variants

The effect of SSCP ninning temperature on the resolution of sequence variants

Resolution of sequence variants in TM3 of GPRl9 50

Resolution of TM3 variant on 10% gels was inferior to that on 4-20% gels 52

Analysis of a fragment (350 bp) of the Dl receptor gene 54

SSCP anaiysis of DATl exon 2 in three control subjects 56

SSCP anaiysis of DAT1 exon 8 in three control subjects 57

SSCP analysis of DATl exon 9 in three TS subjects 58

SSCP analysis of DAT 1 exon 15 in three control subjects 59

PCR genotyping of the DATl 3'VNTR 6 1

Deletion/insertion SHTT promoter polymorphisrn genotyped on 4% agarose 65

Intron 2 VNTR polymorphism genotyped on 4% agarose 66

- 1.1 Neurotransmitter G protein coupled-receptors and transporters in disease

A number of diseases known to be caused by sequence variants in G protek coupled

receptors (GPCRs) have been described (Zastawny et al, 1997). Mutations causing both

loss and gain of receptor fûnction have been reported. Retinitis pigmentosa, one of the

earliest characterized GPCR pathologies. was found to be due to a gain of function

mutation in the rhodopsin gene (Dryja et al, 1990; Dryja et al, 1995). A loss of fünction

mutation in the rhodopsin receptor gene was recently found to cause a form of stationary

night blindness (Yamamoto et al, 1997). Other GPCR mutations have been identified.

These include a mutation in the V2 vasopressin receptor gene which causes nephrogenic

diabetes insipidus type 1 1 (van den Ouweland et al. 1992) and a mutation in the thyroid

stimulating hormone (TSH) receptor gene which causes hyperthyroidism (Kopp et al,

1995). Most recently, a mutation in the CCRS gene. a coreceptor for the hurnan

immunodeficiency virus (HIV) that is expressed on T helper cells, has been found to

confer resistance to HIV infection (Michael et al. 1997). The identification of simian

imrnunodeficiency virus (SIV) G protein-coupled coreceptors (Farzan et al, 1997), GPRl

and GPRI 5 (Heiber et al, 1996; Marchese et al, 1994). suggests that future studies of

GPCR genes in disease States may be relevant and fmitfùl.

Despite the rapidity with which the GPCR genes expressed in the central nervous

system (CNS) have been cloned (Marchese et al, 1997; O'Dowd, 1993; Seeman and Van

Tol, 1993), no mutations in these genes have yet been discovered to contribute to the

inheritance of neuropsychiatrie disorden (Petronis and Kennedy, 1995).

Pharmacogenetic studies have met with some success in identieing dopamine D 4

(DRD4) and serotonin 2A (5HT2A) receptor variants that coder different responses to

atypical neuroleptic drug treatment (Seeman et al, 1997; Rao et al, 1997). However, the

numerous attempts to utilize genetic markers in order to conduct linkage and association

studies of these disorders have not succeeded in convincingly associating GPCRs

expressed in the CNS with a neuropsychiatric disorder (Petronis and Kennedy, 1995).

In the work presented here, therefore, we set out to screen candidate genes implicated

in Tourette's syndrome (TS) and alcohol dependence for sequence variants that might

provide new insight into the inheritance of these disorders. The ernphasis of the work

was to screen DNA from patients with TS and alcohol dependence for mutations in genes

that had not been subjected to mutation screening previously. Therefore, we screened the

GPR19 gene which, while having no known ligand, shows high sequence homology and

similar tissue distribution to dopamine system genes including the dopamine DRD2 gene

(O'Dowd et al, 1996). From among the GPCRs, we also screened the DRûl gene for

sequence variants in two disorders that may have doparninergic etiologies: TS and

alcohol dependence.

We next elected to screen the dopamine transporter (DAT1) gene for sequence

variants in Tourette's syndrome (TS) and alcohol dependence. The final cornponent of

the work presented was based on the results of a similar mutation screening project which

identified a sequence variant in the 5' regulatory region of the serotonin transporter

(SHTT) gene that has been reported to alter 5HTT gene expression in vitro (Heils et al,

1996)

1.2 Clinical definition of TS, associated disorders and alcohol dependence

(a) TS and comorbid neuropsychiatrie disorders

TS is a relatively rare psychiatrie disorder affecting between 0.1 and 0.5 per thousand

people throughout the world. The cluster of symptoms that underlie TS have their onset

between the ages of 2 and 15. The diagnostic critena include recurrent, involuntary, rapid

motor movements with no purpose (tics) that affect multiple muscle groups. Symptoms

may Vary over weeks or months or may be suppressed in the short term but m u t be

otherwise unremittinz for at least a year in order to diagnose TS. The disorder is usually

IifeIong.

The tics are the essential feature of TS. Motor tics comrnonly involve the head, tono

and upper limbs. Vocal tics include sounds such as clicks, g m t s , yelps, barks, sniffs,

coughs and words. An irresistible urge to utter obscenities, coprolalia, is present in 60%

of cases. Symptoms are exacerbated by stress but disappear during sleep and absorbing

tas ks.

Associated features of TS include echokinesis, irnitating the movements of someone

being observed, and palildia, repetition of one's ovm phrases. Obsessive-compulsive or

ritual behaviors rnay also be present. These include obsessive thoughts of doubting,

compulsive rituals including complicated rnovements, impulses to touch objects, retrace

steps, squat and twirl when walking (Diagnostic and Statistical Manual of Mental

Disorders, Fourth Edition, 1 990).

TS is often diagnosed cornorbid with obsessive compulsive disorder (OCD)

(Rapoport and Inoff-Germain, 1997; Swedo and Leonard, 1996) or attention deficit-

hyperactivity disorder (AH-HD) (Castellanos et al. 1997; Schuerholz et al, 1996). Up to

50% of TS patients have been reported to be diagnosed comorbid with OCD. Comorbid

OCD or AD-HD in TS patients presents a challenge to treatment protocols because of the

need to simultaneously treat TS tics and the comorbid OCD or AD-HD. Treatment

modalities for OCD and AD-HD are distinctly different fiom each other and TS

treatments (Peterson, 1996). Major depression (Comings and Comings, 1993; Comings,

1994) and substance abuse disorders, such as alcohol dependence (Muller-Vahi et al,

1997; Comings, 1994), have also been diagnosed comorbid with TS. The contrasting

pharmacological interventions used to treat TS and associated comorbidities may provide

insight into the neuropathies that may underlie TS (Singer et al. 1993) and aicohol

dependence (Tiihonen et al, 1995).

(b) Alcohol dependent disorder and associated withdrawal symptoms

Alcohol dependence involves a pattern of pathologicd alcohol use or impainnents in

social or occupational functions due to alcohol use. The disorder is characterized by the

need for daily alcohol consumption and an inability to stop dnnking that is associated

with the need for markedly increased arnounts of alcohol in order to satisS, alcohol

craving (tolerance) (Diagnostic and Statistical Manual of Mental Disorders, Fourth

Edition, 1990). The consequence of a cessation of alcohol consumption for an alcohol

dependent patient is alcohol withdrawal, which involves severe anxiety, depression,

ataxia and muscle tremors (Lejoyeax, 1996; Anton, 19%; Diagnostic and statistical

manual of mental disorders, Fourth Edition, 1990).

1.3 The pbarmacology of TS, associated disorders and alcohol dependence

The neurotransmitters dopamine and serotonin have both been implicated in the

etiology of TS, associated comorbid disorders and alcohol dependence based on

pharmacological evidence (Lejoyeux et al, 1996; Anton et al, 1996; George et al, 1995,

Samson et al, 1993; Dyr et al, 1993). Treatment of these disorders is complex but only

those aspects salient to understanding the dopaminergic and serotonergic hypotheses of

TS and associated disorders will be reviewed here. However, the range of therapeutic

interventions used to treat these disorden provides strong evidence for their dysregulated

neurotransmitter etiology (Wolf et al, 1996; CastelIanos et al, 1997; Uhlenhuth et al,

1995; Narango and Bremner, 1 994).

(a) Typical and atypical neuroleptics implicate dopamine pathways in TS

Dopamine pathways are considered to be involved in TS pathology due to the

eficacy of typical neuroleptics, such as haloperidol and primozide, in the treatment of the

motor and vocal tics that are central to the disease (Peterson, 1996). Typical neuroleptics

are dopamine D2 receptor antagonists, although halopendol is reported to have some a,-

adrenergic effects, while primozole is reported to have some calcium channel blocking

properties. While side-effects often limit the use of haloperidol (Silva et al, 1996), the

fact that it remains a treatment of choice for managing TS motor and vocal tics (Silva et

al, 1996; Bruun and Budman, 1996; lancu et al, 1995) provides the best clinical rationale

for the hyperdopaminergic hypothesis of TS (Wolf et al, 1996).

The involvement of serotonin pathways in TS has less pharmacologicai evidence in

its support (Peterson, 1996). There is evidence that the atypical neuroleptic risperidone

has some eficacy in treating the tic symptoms of TS (Bruun and Budman, 1996).

Atypical neuroleptics, including rispendone and clozapine, antagonize both dopamine

and serotonin receptors. Risperidone, a 5HT2 receptor antagonist and a weak dopamine

D2 receptor antagonist (Peterson, 1996; Bruun and Budman, 1 W6), relieves the severity

of tics for some patients (Bruun and Budman, 1996), however, in 20% of TS patients

treated with risperidone, treatment is curtailed due to weight gain and sedating side

effects (Peterson, 1996).

Clozapine, the atypical neurolepic which antagonizes both 5HT2A and dopamine D4

receptors (Seeman et al, 1997), has not been shown to effectively treat tics (Caine et al,

1979) even though it is ofien effective in treating schizophrenia (Seeman et al, 1997; Rao

et al, 1996; Meltzer, 1995; Van TOI et al, 1992). In fact, exacerbation of tic symptoms

have been reported in some TS patients undergoing clozapine treatment (Caine et al,

1979). It is unclear whether the side effects of clozapine in TS result From serotonin or

dopamine receptor antagonisrn (Stein et al, 1997; Peterson, 1996). Taken together, there

is clinical and pharmacological evidence of a role for hyperserotonergic dysregulation in

the motor and vocal tics integral to TS.

(b) SRIs implicate serotonin pathways in TS-OCD and TS-anxiety

OCD comorbid with TS is often treated successfully with the combination of a

neuroleptic to control the tics and a serotonin antidepressant to relieve OCD symptoms

(Swedo and Leonard, 1994). Serotonin antidepressants al1 act, at least in part, to correct a

hyposerotonergic state that is hypothesized to underlie depression (Ogilvie et al, 1996;

Heils et al, 1996). By extension, the eficacy of serotonergic antidepressants in treating

OCD suggests that a hyposerotonergic state may also underlie OCD (Uhlenhuth et al,

1 995).

Both tricyclic antidepressants (TCAs) and serotonin reuptake inhibitors (SRIs) are

used to treat OCD comorbid with TS (Stein et al, 1997). The tricyclic antidepressant

(TCA) clornipramine (Stein et al, 1997; Peterson, 1996; Iancu et al, 1995), which

sensitizes serotonin receptors and releases norepinephrine in adrenergic pathways, has

been reported to be effective in treating OCD (Iancu et a[, 1995). The autonomic side

effects of TCA dnigs, however, limit the use of clomipramine treatrnent. Recently, SRI

inhibiton such as fluoxetine and fluoxamine (Stein et al, 1997; Peterson, 1996), which

antagonize the serotonin transporter, have been reported effective in treating OCD. In

order to treat TS-OCD, patients generally require an SRI or TCA for the relief of OCD

symptorns and rispendone augmentation for the relief of the motor and vocal tic

symptoms of TS.

(c) Methylphenidate implicates dopamine pathways in TS-AD-HD

Treatment of AD-HD commonly involves the use of dopamine psychotropic agents,

such as the dopamine transporter antagonist methylphenidate (MP) (Volkow et al, 1996;

Volkow et al, 1995; Geogiou et ai, 1995). AD-HD treatment, however, often complicates

the treatrnent of comorbid TS symptoms (Peterson, 1996). TS patients with comorbid

AD-HD require two contrasting dopaminergic interventions. Often the sedating

properties of typical neuroleptics are used to treat the tics associated with TS and a

dopamine psychotropic agent, such as MP, is used to treat AD-HD (Castellanos et al,

1997; Hetchman et al, 1993).

The tic symptoms in patients with TS-AD-HD are cornmonly reported to worsen

imrnediately after MP treatment commences (Daniels et al, 1996). However, once the

MP becomes effective in treating the AD-HD symptorns, tic exacerbation tends to

disappear. This makes MP the h g of choice for TS-AD-HD. Other dopamine

transporter antagonists, such as dextroarnphetamine, result in unabated tic exacerbation in

TS-AD-HD patients (Castellanos et al, 1997). Cocaine, a dopamine transporter

antagonist with a very high af3nity for the dopamine transporter by cornparison with MP,

results in extreme tic exacerbation (Castellanos et al, 1997). The complex pharmacology

of TS-AD-HD treatment suggests that the doparninergic disregulation in TS-AD-HD may

involve many aspects of doparninergic neurotransrnission .

(d) SRIs implicate serotonergic pathways in alcohol dependence withdrawai

SRIs are currently indicated not only for the treatment of obsessive compulsive

disorder (Peterson, 1996) but also depression (Ogilvie et al, 1996) and anxiety (Lesch et

al, 1996). Detoxification following clinical alcohol dependence is ofien associated with

alcohol related anxiety and depression (Lejoyeux, 1996; Anton, 1 996). The cornmon

alcohol dependence comorbidities, including affective disorders, often obscure whether

anxiety and depression cause or are caused by the withdrawal associated with alcohol

dependence (Anton, 1996). Regardless of their etiology. the symptoms of depression and

anxiety associated with detoxification have been reported to be improved when patients

are treated with SRIs (Lojoyewc, 1996; Anton, 1996; Oliver et al, 1993). This suggests

that a hyposerotonergic state underlies alcohol dependence.

Hurnan dxug trials and animal experiments also suggest that SRis may be effective in

reducing aicohol consurnption and implicate serotonin dysregulation in the pathways

involved with alcohol craving. A recent clinical trial of SRIs in non-depressed and

moderately depressed aicoholics found that alcohol consumption was decreased 1520%

in the SRI treatment groups compared to placebo control groups. SRI treatment of

alcohol preferring rats has also been s h o w to result in reduced alcohol consurnption.

However, evidence for long term reduction of alcohol consumption by SRIs is currently

lacking (Narango and Bremner, 1994).

The fhct that not al1 serotonergic antidepressants are reported to treat alcohol

dependence with the effectiveness of SRIs, however, suggests that much is still to be

learned about the significance of serotonergic dysregulation in alcohol dependence

(Lejoyeux, 1 996). Clinicai trials of other serotonergic drugs. including the 5HT 1 A

receptor agonist buspirone, the 5HT3 antagonist ondansetron and the 5HT2 antagonist

ritanserin, have met with less success than the SRIs in neating alcohol withdrawal or

ongoing alcoholism (Narango and Bremner, 1996). Therefore, although S R I drugs may

reverse a hyposerotonergic state that is common in alcoholics, the serotonergic pathology

that rnay underlie alcohol dependence remains unknown (Lejoyeux, 1996; Oliver et ai,

1 993).

(e) Dopamine is implicated in animal models of alcohol consumption

Alcohol dependence may also involve aberrant dopamine pathways (Ng et al, 1997;

Noble, 1996; Thiihonen et al, 1995; Rassnick et al, 1992). Treatment of the hi& ethanol

preferring CS7 mouse with the dopamine Dl receptor antagonist SKF 82958 or the

dopamine D2 antagonist quinpirole results in markedly decreased ethanol consurnption

for 24 hours (Ng et al, 1994). The resumption of ethanol consumption by mice treated

with these antagonists has been attributed to receptor desensitization (Ng el al, 1994;

George a2 et, 1995). While this animal model has been used to show the involvement of

dopaminergic pathways in alcohol consurnption, no neuroleptic treatment is currently

used to treat the primary symptoms of alcohol consurnption or withdrawal in human

alcohol dependent patients. A hypodopaminergic hypothesis of alcohol dependence has

been inferred frorn decreased ethanol consumption in the mouse model following

dopamine D 1 and D2 antagonist treatment (George et ai, 1995; Ng et al, 1994).

1.4 Mode of inheritance of TS, comorbid disorders and alcohol dependence

Debate about whether TS and a range of disorders including OCD, AD-HD and

alcohol dependence are part of a heritable TS spectnun disorder (Comings and Comings,

1993) remains controversial (Pauls et al. 199 1 ; Pauls et al, 1 988; Pauls et ai, 1 986). The

spectrum disorder hypothesis suggests that expression of TS genes results in not only the

tics charactenstic of TS but a broad range of associated behaviors including OCD, AD-

HD and aicohol dependence. Support for this idea cornes fiom a number of sources.

First, there is an unusually high incidence with which these disorders are diagnosed

comorbidly (Castellanos et al, 1 997; Stanley. 1 997; Cornings and Comings, 1993).

Second, pharmacological evidence suggests that this group of disorders share at least

some aspects of dopaminergic and serotonergic dysregulation (Petenon 1996). Third,

evidence exists that relatives of an affected individual are likely to be af5ected by the

same or one of the associated disorders at a rate exceeding that found in pedigrees of

nonpsychiatric individuals (Comings and Comings, 1993; Pauls et al. 1991 : Pauls et al,

1988). To date, however, studies that find evidence for a wide spectnim of related

disorders that share genetic liabilities (Comings et al, 1996) have not been replicated.

(a) Autosomal dominant model of TS

Studies of TS in affected pedigrees have resulted in the hypothesis that TS is inherited

as a single autosomal dominant gene that is subject to incomplete penetrance (Wolf ei al.

1996; Pauls et al, 1986; Comings et al. 1986). The single major locus hypothesis

suggests that the intermediate forms of TS. such as mild tic disorders. may result fiom the

inheritance of a single copy of the susceptibility gent (Comings et al. 1986). Thus. one

copy of the TS gene may confer some nsk while two copies may confer greater risk of

developing the severe tic disorder that characterizes TS (Comings et al. 1986). However.

the range of tic seventy found in TS patients (Pauls et al. 1996). combined with the fact

that tic severity worsens when one or both parents have a tic disorder (Comings ei al.

1986), suggests that TS may better fit a more complex model of inheritance (Walkup et

al, 1996). Models descnbing TS inhentance as semidominant, sernirecessive or as being

an example of incomplete dominance have also been proposed (Patel, 1996)

(b) Polygenic models of TS, AD-HD, OCD and alcohol dependence

Linkage studies on Tourette's syndrome have recently introduced evidence that tends

to exclude the possibility that a single major locus is responsible for the inheritance of TS

(Heutink et al, 1995). Complex segregation analysis suggests that susceptibility for TS is

conveyed by a major locus in concert with a multifactonal background, including

polygenetic and environmental contributions (Walkup et al, 1996). A revised mode1

proposes that the major locus is responsible for half of the observed phenotypic variation

described in the clinical literature of TS (Patel, 1996; Walkup et al, 1996). Models of TS

inheritance must be interpreted with caution, however, because none have yet met with

wide acceptance. The greatest complication to exarnining disorders such as TS is that its

heterogeneity may confound studies of its inheritance (Patel, 1996; Alsobrook and Pauls,

1996; Santengelo et al. 1996; Pauls et al. 199 1).

Similar problems must be accounted for when studying the genetic component of

alcohol dependence (George et al, 1993; Cloninger et al, 1985; Devor and Cloninger,

1989). While Type II alcoholics have been proposed to have a greater genetic liability,

which may include a hyposerotonergic phenotype (Cloninger et al, 1989; Cloninger,

1987), studies of this phenotype have not yet resulted in the identification of novel

candidate genes for alcohol dependence (Gordis, 1997). Studies associating alcohol

dependence with the dopamine Dl (DRDI), dopamine D2 (DRDL), dopamine D4

(DRD4) and DATl genes (to name but a few) al1 remain controversial (Comings et al,

1997; Muramatsu et al, 1995; Carlos et al, 1993; Uhl et al, 1992). The inheritance of

alcohol dependence, like that of TS (Patel, 1996), is likely to involve complex interaction

between many susceptibility loci and environmentai factors (Cloninger, 1987; Persico et

al, 1 993 ; Muramatsu et al, 1 995).

1.5 Candidate gene hypothesis of TS, comorbidities and alcohol dependence

Evidence fiom monozygotic twin studies suggests that a complex genetic liability for

TS, TS associated with AD-HD or OCD and alcohol dependence probably exists (Gordis,

1997; Patel, 1996). Because attempts to isolate candidate genes for TS, AD-HD, OCD

and alcohol dependence by linkage analysis have not been successful (Gordis, 1997;

Heutink et al, 1995; Gelemter et ai, I995), Mendelian inheritance of these disorders is

unlikely. However. failure to detect disease loci by linkage analysis does not exclude

polygenic models of the inheritance of TS or alcohol dependence.

In polygenic models, no single gene that contributes to the inheritance of a disorder is

sufficient in itself to cause the disorder phenotype. Each contributing gene, or

susceptibility loci (Nothen et al, 1992), may contribute additively (Comings et al, 1996)

to the inheritance of a suficient genetic liability to cause a recognizable phenotype.

Therefore, much of the recent work on the inheritance of TS, AD-HD, OCD and alcohol

dependence has abandoned the method of linkage analysis. the standard means of

identiQing candidate genes for a genetic disorder (Nothen et al, 1992; Hodge, 1994), in

favor of association studies (Owens, 1997; Berrettini, 1997; Hodge, 1994; Nothen et al,

I 992).

Association studies involve examining primary candidate genes: genes encoding

proteins that are known to be components of a pathway implicated in the pathology of a

disease. In their simplest fom, association studies involve comparing the frequency of a

genetic marker in patient and control groups (Owens, 1997; Hodge, 1994; Nothen et al,

1992). As a result, association studies are based on parametric models. The use of

parametic models to test the difference between patient ailele and genotype frequencies,

however, is correct only if certain assumption are true (Ott, 1 99 1 ).

Parametic models assume that while parameters cannot be estimated, standard

randorn variables (statistics), such as the X' statistic, can be calculated in order to test

whether significant differences exist between patient and control allele and genotype

frequency data. The X' statistic, the normaiized sum of squares of the differences

between patient and control allele or genotype frequencies, is assumed to fit a x2

distribution (Ott, 1991). The mode1 also assumes that allele and genotype frequencies in

patient and control groups are independent of other variables including the ethnic ongin

and sex of the members of each group (Hodge, 1994; Nothen et al, 1992). The fact that

association studies have often been found to be confounded by variables other than

disease (Kennedy et al, 1995; Barr and Kidd, 1993) suggests that the pararnetric models

used in association studies may not always be appropriate.

Linkage analysis, on the other hand, is a non-pararneuic approach that does not

require data to have a close fit to the normal distribution. Non-parametric models

accomodate complex systems for which only a few of many variables can be measured.

For these reasons, non-parametric linkage analysis is the best approach to isolate

candidate genes for Mendelian traits (Ott, 199 1). For cornplex nomMendelia traits,

however, the non-pararnetric approach has rarely suseeded in identifying susceptability

loci, probably due to the heterogeneity of these disorders (Heutink et al, 1995). The

occasions when linkage analysis has successfully identified susceptibility loci, such as for

severe bipolar disorder (Freimer ef al, 1996), the affected families studied have been

selected for the presence of a founder effect documented to be present by a history of

inter-rnarriage.

Given that linkage analysis of complex traits is only viable under some

circumstances, association studies remain a usefül if limited tool for the analysis of

complex traits. However, care must be taken in sample collection in order to be able to

accommodate the assumptions of the parametric mode1 employed in association studies.

In addition it should be remembered that d i k e linkage studies, association of a rnarker

with a disease, is not evidence that the gene under investigation, or an adjacent gene on

the same chromosome. contributes to the inheritance of a disorder (Berrettini, 1997;

Hodge, 1 994; Nothen et al, 1 992).

In psychiatnc genetic assocaition studies, candidate genes studied ofien encode an

important site of action for either an endogenous ligand or a drug used to relieve the

symptoms of a disorder (Nothen et al, 1992). This is the approach we have used to select

the DRDI, DATl and 5HTT genes for study in TS, AD-HD, OCD and alcohol

dependence. The rationale for selecting each candidate gene will be explained below.

1.6 The dopamine bypotheses of TS, AD-HD and alcohol dependence

Several lines of evidence suggest that TS, AD-HD and alcohol dependence are among

the neuropsychiatric disordee for which a dopamine hypothesis implicates the DRDl

gene and the DATl gene. The critical role of the DRDl and DATl gene products in

sustaining dopaminergic neurotransmission make these genes primary candidates for

neuropsychiatric disorders including TS (Gelemter et al. 1993), AD-HD (Cook et al,

1995; Cook et al, 1997) and alcohol dependence (George et al, 1995).

The DRD l gene, which encodes the dopamine D 1 receptor, is a member of the family

of genes that encode GPCRs. This receptor, while having 10 fold lower affinity for

dopamine than the dopamine D5 receptor (Sunahara et al, 1991), is important to

dopamine neurotransmission because of its greater expression in the striatal, cortical and

subcortical regions of the human brain (Sunahara et al, 1991). These regions are

implicated in ernotion, neuropsychiatric disorders and addictions (Weiner et al, 199 1).

The DATl gene, which encodes the dopamine transporter, is involved in terminating

dopaminergic neurotransmission at the synapse. The human dopamine transporter gene

(DATI) belongs to a family of twelve transmembrane domain ~a and Cl- dependent

neurotransmitter transporters (Uhl and Johnson, 1994). The dopamine transporter, like

the other members of this family. is a presynaptic re-uptake mechanism (Ding et al, 1994;

Nirenbergh et al, 1996) that is integral to the termination of dopaminergic synaptic

transmissions by ~ a + dependent reuptake (Kitayama et ai, 1992, Kilty et al, 199 1 ; Hom,

1990).

The DATI gene is implicated in the inheritance of TS (Comings et al, 1996;

Vandenbergh et al, 1992; Singer et al, 1991; Leckrnan et al, 1988) and alcohol

dependence (Muramatsu and Higushi, 1995; Thiihonen et al, 1995; Devor and Cloninger,

1989), in addition to attention deficit-hyperactivity disorder (AD-HD) (Gill et al, 1997;

Cook et al, 1997; Comings et al, 1996; Cook et al, 1995), Parkinson's disease (Uhl,

1990) and schizophrenia (Bordea-Pean et al, 1995; Daniels et al, 1995; Li et al, 1994;

Penico et al, 1993; Losonczy et al. 1987). Abnormalities of dopamine transporter

fhction have been proposed to contribute to both the hyperdopaminergic (Hom, 1990)

and hypodopaminergic hypotheses of the dopamine pathogenesis of these disorders.

(a) The DATl and DRDl genes are candidates for TS

The effîcacy of D2-iike receptor antagonists, such as haloperidol, in alleviating the

motor and vocal tic symptoms of Tourette's syndrome (Bruun and Budman, 1996; Wong

ef al, 1996; Wolf et al, 1996) suggests that, as in schizophrenia (Van Tol rf al, 1992). a

hyperdopaminergic pathology underlies TS (Barr e t al, 1 996). The possible

hyperdoparninergic state that underlies TS may be due to an increased number of

dopamine receptors, increased receptor affinity for dopamine (Wolf et al, 1996; Cohen er

al, 1978; Butler et al, 1978) or diminished termination of synaptic neurotransmission due

to dopamine transporter pathology (Malison et al, 1995; Vandenbergh er al, 1992; Kilty

et al, 199 1).

The DATl gene is a candidate gene in TS because its sequence variants may be

responsible for the dopamine transporter dysregulation that is proposed to account for the

hyperdopaminergic state that characterizes TS . The potential ro le of the dopamine

transporter in TS is emphasized by the fact that a variety of psychostimulant drugs, such

as cocaine (Kuhar et al, 1990; Wilson et al. 1996) and MP (Volkow et al, 1995) that bind

to the dopamine transporter have been reported to worsen the motor and vocal tics of TS

patients.

The DRDl gene is another candidate gene for TS because the hyperdoparninergic

state that is proposed to underlie TS may reflect the fact that TS patients have altered

dopamine D 1 receptor characteristics. Recent evidence from neuroimaging studies has

revealed that severely affected TS patients may have increased levels of DRD2

expression or aitered dopamine D2 receptor dupamine binding properties (Wong et al,

1997; Robertson, 1996: Wolf et al, 1 996). This suggests that dopamine receptors remain

valid candidates for TS. However, unlike the dopamine D2 receptor, no evidence of

altered DRDl gene expression in TS has yet been documented. The issue of whether

DRDl function is altered in TS can be investigated by attempting to isolate sequence

variants of the DRDl gene in TS patients as has been done previously in schizophrenic

(Ohara et al, 1993) and bipolar patients (Shah et al, 1995).

Dopamine receptor genes have been studied as candidate genes in numerous

association studies of sequence variants with TS. As with al1 association studies,

moderate associations of dopamine receptor sequence variants (markers) have been taken

as evidence that a hnctional polymorphic variant. perhaps in the 5' regulatory region.

was in linkage disequilibrium with the marker. However, studies finding moderate

association of the dopamine D2 (DRDZ), D3 (DRD3) and D4 (DRD4) genes with TS

(Comings et al, 1996; Grice et al, 1996; Comings et al, 1993; Cornings er al, 1991),

remain controversial (Nothen et al, 1994; Barr et al, 1996). No evidence for linkage of

the dopamine D 1 (DRD I ) and D5 (DRDS) genes with TS has yet been found (Gelemter

et al, 199 1 ; Barr et al, 1997).

Association studies. have not been conducted with DRDl in TS. However, snidies of

the 5' flanking region of DRD 1 gene, including the Taq 1A prornoter polymorphism, have

failed to show that the DRD1 gene is associated with schizophrenia (Cichon ei al, 1996)

or bipolar disorder (Coon et al, 1993; Nothen er al, 1992). Point mutation analysis has

recently confirmed that the DRDl gene coding region is non-polymorphic in

schizophrenia (Lui Q et al. 1995) and bipolar disorder (Shah et al, 1995). However,

studies searching for sequence variants of the DRDl gene coding region in TS patients

have not been reported.

(b) The DATl and DRDl genes are candidates for AD-HD

The DRDl and DATl genes have also been implicated in the dopamine pathology

that rnay underlie AD-HD. The hypodoparninergic hypothesis of AD-HD dopamine

pathology (Gill et al, 1997; Cook et al, 1997; Cornings et al, 1996; Cook et al. 1995) has

been inferred from the pharmacological evidence that psychotropic drugs, such as the

dopamine transporter antagonist rnethylphenidate (MP) (Kuhar et al, 1990; Volkow et al,

1995; Wilson et al, 1996), effectively treat AD-HD (Ding et al, 1994; Hetchman et al,

1994). The hypodoparninergic hypothesis suggests that, by antagonizing the dopamine

transporter, MP corrects the low synaptic dopamine levels that characterize AD-HD

(Ding et al, 1994), thereby prolonging dopamine receptor stimulation by dopamine. The

DRDl gene is therefore implicated in AD-HD because it encodes the dopamine Dl

receptor which has high &nity for dopamine (Sunahara et al, 1990) and is highly

expressed in the striatal and cortical brain region implicated in AD-HD (Volkow et al,

1995).

(c) The DATl and DRDl genes are candidates for alcohol dependence

Traits such as dcohol dependence may also involve aberrant dopamine pathways (Ng

er al, 1997; Noble, 1996; Tiihonen et al, 1995; Weiss et al. 1990). Dopaminergic

neurotransmission in the limbic and mesolirnbic pathways of reward located in the

midbrain, nucleus accurnbens and frontal cortex (Adamson et al, 1995) is implicated in

the pathways of dmg reinforcement and reward that characterize alcohol dependence

(Strange. 1993; Sibley et al. 1992; Wise and Rompre. 1989; Koob and Bloom. 1988;

Wise, 1980). A hypodoparninergic hypothesis of alcohol dependence has been advanced

(Ng et al, 1997), that suggests that ethanol releases dopamine in some brain regions.

thereby contributing to the rewarding and addictive properties of ethanol (Imperato and

Di Chiara, 1986; Ng et al, 1997). The identities of the dopamine system genes that may

contribute to alcohol dependence, however, remain obscured by complex environmental

factors (Cloninger, 1987; Persico et al, 1993; Muramatsu et al, 1995).

The DATl and DRDI genes are candidates for alcohol dependence because of their

role in sustaining dopaminergic neurotransmission in brain regions implicated in the

pathways of reward. Recent evidence that striatal dopamine transporter densities rnay be

altered in alcohol dependent subjects (Tiihonen et al, 1995) raises the question of whether

DATl sequence variations contribute to altered dopamine transporter f i c t i on in alcohol

dependence. It is tempting to suggest that DATl or DRDl sequence variants may

contribute to the hypothesized (Ng er al, 1997) effects of dopamine release into the

synapse by ethanol. However, no information on the frequency of DATl coding region

sequence variants is currently availabie. Information on the frequency of DRD 1 sequence

variants in alcohol dependent patients is limited to a mutation screening of eight patients

which, while revealing no mutations (Lui et al, 1995), cannot be considered to be

conclusive given the small sample size.

1.7 The serotonin bypothesis

A number of neuropsychiatric disorders are characterized by serotonergic

abnorrnalities. Severely affected TS patients have been found to excrete 5-

hydroxyindoleacetic acid (SHTAA), the major serotonin metabolite, at higher leveis than

found in controls (Bomstein and Baker, 1991). Post-mortern brain tissue from TS

(Anderson. 199 1) and depressed patients (Mann et al, 1996; Boyer and Feighner, 199 1)

have been found to contain altered concentrations of serotonin compared to control post-

mortem brain tissue. Evidence for serotonin metabolite dysregulation has aiso been

identified in Type II alcohol dependent patients (Goidman, 1999, those with early onset

and high genetic liability (Cloninger et al, 1989; Brown et al. 1985; Cloninger et al,

1985; Linnoila et al, 1983). In addition, serotonergic abnormalities have been noted in

obsessive compulsive disorder (OCD) (Heils et al, 1996; Swedo and Leonard, 1994).

The serotonin transporter (SHTT) gene is a candidate gene in the study of the etioiogy

of neuropsychiatric diseases considered to involve serotonergic abnorrnalities. Due to its

role in clearing serotonin from the synapse, the serotonin transporter is integral to

attenuating serotonergic neurotransmission (Heils et al, 1996). The efficacy of SRIs in

treating neuropsychiatrie disorders, including unipolar depression (Ogilivie et ai. 1996;

Anderson and Tomenson, 19941, OCD, anxiety and depression comorbid with TS (Riddle

et al, 1988), OCD (Swedo and Leonard, 1994) and alcohol dependence (Lejoyeux, 1996;

Narango and Bremer, 1994) suggests that the SHTT gene is a candidate gene in these

disorders.

(a) The SHTT gene is a candidate for TS

The frequency with which TS patients are treated with SRIs in order to control

comorbidities (Swedo and Leonard, 1994; Messiha. 1993), provides the pharmacological

rational for examining the SHTT gene as a candidate gene in TS-OCD patients. Mutation

screening, however, has shown that coding region variants of the 5HTT gene are very

rare (Di Bella et al, 1996) and probably do not contribute to psychiatrie disorders. In this

context the recently reported 44 base pair deletiodinsertion 5HTT promoter

polymorphism is of particular interest because it has been shown to reduce SHTT gene

expression in vitro (Heils et al, 1996; Lesch et al, 1996). Therefore, there is in vivo

evidence that the sequence variant of the 5HTT promoter rnay be a mutation of the

regulatory region of the 5HTT gene. This discovery raises the question of whether a

polymorphism that has Functional significance in vitro. is also functional in vivo

(Paterson, 1997; Heils et QI, 1996).

The hypothesis that the short promoter polymorphism may modulate serotonin

transporter expression. thereby influencing the rate of serotonin clearance from the

synapse in vivo (Heils et al, 1996), has not k e n tested. Evidence that 5HTT mRNA

expression may be increased in schizophrenics under neuroleptic treatment (Hemandez

and Sokolov, 1997) suggests that 5HTT regulatory pathology rnay underlie some

neuropsychiatric disease States. Similar evidence of altered 5HTT mRNA expression or

aitered binding sites for serotonin antidepressant dmgs (Owens and Nemeroff. 1994).

however, is not available for TS-OCD patients. However. nurnerous studies have used

the candidate gene approach to conduct association studies of the 5HTT promoter in

neuropsychiatnc disorder patient groups (Craddock and Owens. 1997).

Associations of the 5HlT gene promoter polymorphism with anxiety traits (Lesch et

al? 1996) and depression (Collier er al. 1996) remain controversial (Ebstein et al. 1997)

and unsupported. A snidy of the 5HTT promoter polymorphism in panic disorder found

no association (Deckert et al. 1997). The serotonin transporter remains a candidate gene

in anviety disorders and depression because of evidence for the efficacy of SRI treatment

(Ogilvie et al. 1996: Lejoyeux 1996) of the serotonin reuptake pathology (Collier et al.

1996; Iny et 02. 1994) that rnay underlie these disorders. The recent tentative association

of the 5HTT with autism (Cook et al, 1997). a disorder fkequently characterized by OCD

and anviety (Gordon et al' 1993; McDougle et al. 1996). suggests that other disorders

treated with SRIs, including TS and its comorbidities. rnay also be associated with

serotonegic dy sregulation (Messiha, 1 993) involving the 5 HlT gene.

(b) The SHTT gene is a candidate gene for alcohol dependence

Alcohol dependence withdrawal is charactenzed by severe anxiety and depression.

Both conditions can be relieved by SRIs. While anxiety has been associated with the

SHTT gene by studies of the 5HTT promoter alleles, depression has been associated with

the 5HTT gene (Ogilvie et al, 1996) not by genotyping the SHTT deletiodinsertion

polyrnorphism, but by genotyping the 5HTT intron 2 variable number tandem repeat

(VNTR). The fiequency of comorbid anxiety and depression in alcohol dependent

patients (Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, 1990)

makes the 5HW gene a candidate for alcohol dependence.

1.8 Screening candidate genes for sequence variants

(a) Mutation screening by SSCP analysis

Single stranded conformational polymorphism (SSCP) analysis is a cornrnonly used

method for the detection of gene sequence variants (Lee et al, 1992; Oto et al, 1993;

Hongyo et al, 1993). Cornrnon variants include single base pair changes, frameshift

mutations, microsatellite polymorphisms and nucleotide insertions. Sequence

information from muation screening is valuable because it provides evidence regarding

the extent of amino acid sequence conservation in disease and control populations in

addition to providing markers usehl in linkage and association studies (Weghorst, 1993;

Calvert et al, 1995). The method is based on the principle that when DNA is denatured,

the single strands containing sequence variants assume a conformation different from

those strands containing no sequence variants. The conformational differences in the

single stranded DNA cm be resolved on polyacrylamide gel (Giavac and Dean. 1995;

Weghorst, 1993) as depicted in Figure 1. When an SSCP band shift is noted, sequence

analysis is then performed in order to identifi the nuture of a sequence variant.

The availability of pre-cast gradient polyacrylamide gels (Novex, San Diego, CA,

USA) that are nin in the Novex Xcell II minice11 system has resulted in improved efficacy

of SSCP analysis (Hongyo et al. 1993). Many current protocols for SSCP, however, have

not been modified to accommodate these gels (Bardeesy and Pelletier. 1995: Lam et ni,

1996). The initial phase of experimental work described here involved optimizing SSCP

conditions for pre-cast gels.

1.9 Research objective: to screen candidate genes for sequence variants

(a) Isolate DATl gene sequence variants in TS and alcohol dependence

We set out to conduct the fint systematic mutation screening of the DATl gene in

controls, TS and alcohol dependent patients. The DATl screening project is the logical

sequel to the recent association of the DATl gene gene with TS (Comings et al. 1996),

AD-HD (Cook et al, 1997; Gill et al, 1997; Cook et al, 1995) and alcohol dependence

(Murarnatsu and Higushi, 1995). This study genotyped a variable number tandem repeat

located 3' (3'VNTR): the only DATl polymorphism reported prior to our effort to screen

the DATl gene (Vandenbergh el al, 1992). Therefore, the sequence information

obtained from screening the DATl gene may be a valuable addition to what is known

(3- Genornic DNA PCR - = - ,

Mutant

Denaturation

Single-stranded Conformations

Figure 1 The principle of PCR-SSCP analysis. Double stranded PCR products are generated for both wild-type (WT) and polymorphic/mutant (M) alleles. Follow-ing denaturation, the single strands refold to form specific secondary structures. Polyrnorphic/mutant single stranded DNA molecules have a different structure than the wild-type molecules. Polyacrylamide gel electrophoresis can resolve the two different wild-type strands and the two different polymorphic/mutant strands (Gdvac and Dean. 1995).

about the DATl gene conservation in human populations (Donovan et al, 1995;

Vandenbergh et al, 1992; Gros et al, 1992). This sequence information will help to

evaluate the contribution of sequence variability in dopamine system genes to the

etiology of neuropsychiatric disorders.

(b) lsolate DRDl gene sequence variants in TS and alcohol dependence

We continued our study of the role of GPCR sequence variants in the etiology of TS

and alcohol dependence (George et al, 1993; Lam et al. 1996) by screening the coding

region of the DRD 1 gene for sequence vaxiants. While linkage analysis has excluded the

DRDl gene From having a major gene effect in TS (Heutink et al. 1995; Gelemter et al,

1993), by genotyping the 5'Taq 1 A polymorphism no mutation screening of the DRDl

coding region in TS has been reported in the literature. Evidence of a role for the DRDl

gene in the inhentance of addictive disorders has recently been reported (Comings et al,

1997) but has not yet been replicated. No study has screened a Iage sarnple of alcohol

dependent patients for sequence variants in the coding region of the DRDl gene (Lui et

al, 1995).

(c) Genotype SHTT gene sequence variants in TS and alcohol dependence

Mutation screening of the SHTT gene in control and neuropsychiatric patient groups,

sirnilar to that which we conducted for the DATl gene, has shown that its amino acid

sequences are conserved in patient and control groups. Di Bella et al, 1996, conducted a

mutation screen in a number of neuropsychiatric patient groups. TS and alcohol

dependent patients, however, were not screened.

The evidence for conservation of SHTT coding region sequences in a number of

neuropsychiatric disorders suggested to us that rather than conducting a mutation

screenilg of the SHTT gene in our patient groups that it would be more f%utfuli to ca ry

out a candidate gene study of the 5HTT gene in TS and alcohol dependence. For this

purpose we genotyped the SHTT deletion.insertion polymorphism 5HTT and the intron 2

VNTR polymorphisms recently identified (Hiels et al. 1996; Lesch et al. 1994). The

5HTT deletionhsertion promoter polymorphism was of special interest because of

evidence of its possible functional relevance. The intron 2 VNTR was genotyped in order

to enable us to conduct haplotype analysis of the 5HTT gene in patient and control

groups.

1.10 Research strategy for candidate gene screening and association studies

The candidate gene studies presented here were conducted in order to identiQ gene

sequence variants unique to or significantly more common in patients compared to

controls. Mutation screening projects inevitably identiQ a plethora of sequence variants

that have no apparent functional significance. We therefore particularly sought to

identify sequence variants of the DATl and DRD 1 genes that would result in alterations

to the structure of their respective gene products. The discovery of novel sequence

changes of undetermined significance requires pharmacological characterization in vitro

by expression in ce11 lines (discussed by Hiels et al, 1996 and Lam el al, 1996) in order to

establish whether altered protien sequence alters its function. Association studies of TS

and alcohol dependence with the novel sequence variants were conducted while we

continued to seek sequence variants leading to altered protien structure for

characterization in vitro systems.

ERIALS AND METHODS

2.0 Materials

Alkaline Phosphatase (Calf intestinal) Pharmacia Biotech (Baie d'Urfe, PQ)

Agarose Bio-Rad Laboratones

Ampicillin Sigma (St. Louis, MO)

Bacto Agar DIFCO Laboratones (Detroit, MI)

Programmable Power Supply Biorad, Mode1 3000Xi

Control DNA (not psychiatric/addicted) Addiction Research Foundation (Toronto,ON)

Control DNA (not psychiatndaddicted) Psychopharmacology and Dependence Unit.

Women-s College Hospital (Toronto, ON) Control DNA (addicted, not psychiatric) Psychopharmacology and Dependence Unit,

Women's College Hospital (Toronto, ON) 7-deaza-deoxy-guanosine tri-phosphate Pharmacia Biotech (Baie d'Urfé, PQ)

Deionized Formamide Fluka (Ronkonkoma, NY)

Dimethyl sulfoxide (DMSO) Fluka (Ronkonkoma, NY)

DIOB Cornpetant Celts

DNA Ligase

Mr. Tuan Nguyen

Pharmacia Biotech (Baie d'Urfe, PQ)

Patient DNA (Tourette's syndrome) City of Hope Medical Centre (Durate, CA)

Patient DNA (Alcohol dependent) Addiction Research Foundation (Toronto, ON)

pBluescnpt Strategene (la Jolla, CA)

PCR Genearnp Kit Perkin-Elmer Cetus (Norwaik, CT)

T7 Sequencing Kit Pharmacia-Biotech (Uppsala, S W)

Polaroid Type 667 Film

Polyacrylamide Gel (6%)

Polynucleotide Kinase, FPLCpureB

Pre-cast 4-20% Acrylamide Gels

Pre-cast 10% Acrylarnide Gels

Restriction Endonucleases

SDS

Taq Polymerase

Temperature Controlled Water Bath

ThennoFlow SSCP System

Eastman Kodak Co. and Polariod

Helixx (Toronot, ON)

Pharmacia-Biotech (Baie d'Urne. PQ)

Novex (La Jolla, CA)

Novex (La Jolla, CA)

Pharrnacia/GIBCO B Ri,

ICN (Dorval. PQ)

GIBCO BRL (Gaithersburg, MD)

Haake (Karlsruhe, DR)

Novex (La Jolla CA)

Sequinase PCR Product Sequencing Kit USB (Cleveland, Ohio)

Ultrapure-dNTP Set Pharmacia-Biotech (Baie d'Urfie, PQ)

Xcell II mini-ceil system Novex (La Jolla CA)

2.1 DNA extraction

Following informed consent, blood samples were obtained from non-psychiatrie

control individuals, patients with TS, TS-AD-HD. TS-OCD and alcohol dependence with

no psychiatric comorbidity. The cnteria whereby these diagnoses were made are

described below. Genomic DNA was extracted using phenol extraction and ethanol

precipitation of DNA fiom patient blood as previously described (Bardeesy and Pelletier.

1995). Briefly. 5-10 ml of blood was added to an equal volume of lysis buffer (50 mbl

HEPES, pH 8. 50 mA4 NaCI. 5 mA4 MgC12. 10% sucrose. 05% Triton X-100) and the

mixture was kept on ice for 10 minutes. The mixture was then centrifùged at 3000 g for

10 minutes. The supernatant was discarded and the pellet was resuspended in a mixture

of TAE buffer and sodium dodecyl sulfate (SDS) before being incubated at 65 O C for 10

minutes. Fi@ ul of 10 mg/ml proteinase K and 50 lil of RNase A were then added before

incubating the mixture at 65 OC for 90 minutes.

Two extractions with equal volumes of phenol were performed by mixing the

phenoVaqueous mixture for 30 minutes on a platform shaker. The aqueous phase fiom

each extraction was saved and extracted rince more with equal volumes of phenol and

chloroform before final extraction with an equal volume of chloroform. A one-tenth

volume of 3 M sodium acetate in ethanol was then added to the aqueous phase. The DNA

was then removed by spooling with a g l a s rod and nnsing in 70% ethanol before

resuspending in TE buffer.

2.2 Clinical sam ples

(a) Tourette's syndrome sarnples

The TS group screened consisted of 109 unrelated patients recruited from the

Tourette's Syndrome Clinic of the City of Hope National Medical Center (COH). Durate.

California (Comings and Comings. 1993: Comings. 1994: Comings et al. 1996). The

patients were selected to be Caucasians of Xorthem and Western European descent. All

patients. and available relatives. completed a detailed behavioral questionnaire panemed

after the Diagnostic Interview Schedule (DIS) (Robbins et al. 1981). The entire DIS

questionnaire. and its use in other midies. is described elsewhere (Comings and Cornings.

1993: Comings et al. 1 996).

For al1 patients screened. the final diagnosis of TS. chronic motor and chronic vocal

tic disorder. was made by assessing the variables required according to the DSM-III-R

(Diagnostic and Statinical 1 Manual of .Mental Disorders. Third Edition-Revised. 1987)

and DS-M-IV (Diagnostic and Statistical .Manual of -Mental Disorders. Fourth Edition.

1990). In addition to the primary diagnosis of TS. 29 of the patients screened were

diagnosed comorbidly uith OCD (TS-OCD) and 33 of the patients were diagnosed

comorbidly with AD-HD (TS-AD-HD) according to the DSM-III-R (Diagnostic and

Statistical Manual of Mental Disorden. Thrd Edirion-Revised. 1987) and DSM-IV

(Diagnostic and Statistical Manual of .Mental Disorders. Fourth Editioa 1990) cnteria

Forty-seven of the TS patients had no comorbid diagnosis. The TS patients screened had

not been included in previous studies (David Comings. personal communication).

The TS sample

34

sizes varied for each gene that was screened or genotyped for two

reasons. First, DNA sarnples were still being obtained during the course of this study:

allowing sample sizes to increase &er the GPR19 and DRDl studies. Second, the PCR

reactions required to complete the SHTT gene study were less robust that those involved

in conducting the DATl study. As a result fewer patients were studied at the 5HTT locus

by cornparison with the DATl locus. The DATl gene was screened in al1 patients. The

DRDl gene was screened in 47 patients with a primary diagnosis of TS in addition to

three additional TS-OCD patients selected to be the next consecutive patients interviewed

(denoted by the COH patient identification nurnber).

(b) Alcohol dependence samples

DNA samples from 72 patients diagnosed with alcohol dependence were obtained

fiom the Addiction Research Foundation (AM) of Ontario. The patients were diagnosed

with alcohol dependence when admitted to the Toronto Hospital between 1989 and 1992

for alcohol-related chronic hedth problems. The assessrnent of alcohol dependence was

made according to DSM-III-R criteria (Diagnostic and Statistical Manual of Mental

Disorders, Third Edition, Revised. 1987). The alcohol dependent group consisted of

unrelated Caucasians of northem and western European descent who resided in the

Metropolitan Toronto Area (George et al. 1993).

A11 72 sarnples were screened for mutations in the GPR19 and DRDl genes. The

DATl gene was screened in 64 patients. The 5HTT gene was genotyped for the same 64

patients. The Bemoulie multiple testing corrections (discussed below) accounted for the

fact that previous studies by our group have genotyped the DRD4 exon 3 polymorphism

(George et al, 1993) and the DRD2 Taq 1A polymorphism in the alcohol dependent

group.

(c) Control samples

The GPR19 and DRDl mutation screening projects involved screening 50 non-

psychiatric control sarnples fiom the Addiction Research Foundation (ARF) of Ontario,

Toronto, Ontario. The subjects were described as being healthy volunteen From the

Metropolitan Toronto area with no history of psychiatnc treatment at the tirne blood was

drawn.

For the study of the DATl and 5HTT genes in TS, groups of 67 and 91 non-

psychiatric controls respectively, were selected from the data-base of the

Psychopharmacology and Dependence Research Unit, Women's College Hospital,

Toronto, Ontario. Each control was ethnically matched to the TS group. The controls

were genotyped for the 3'VNTR and the novel polymorphisms in exons 9 and exon 15 of

the DATl gene and the deletionlinsertion and intron 2 VNTR polymorphisms of the

5HTT genes.

For the study of the DATl and SHTT genes in alcohol dependent patients, 64 controls

were genotyped for the 3'VNTR and the novel polymorphisms of exons 9 and 15 of the

DATl gene. Of the total control group, the 15 exons of the DATl gene were screened for

42 controls obtained from the Addiction Research Foundation (ARF) of Ontario, Toronto.

Ontario. These controls were healthy volunteers from the Metropolitan Toronto area with

no history of psychiatnc treatment at the time blood sarnples were taken. The rernaining

22 controls, selected using the same criteria from the data-base of the

Psychopharmacology and Dependence Research Unit, Women's College Hospital,

Toronto, Ontario, were genotyped for the YVNTR and the comrnon novel

polymorphisms in exons 9 and 1 5 of the DAT 1 gene.

2.3 PCR amplification of gene fragments subjected to SSCP muation screening

(a) Amplification of GPR19 gene fragments used to refine SSCP method

SSCP analysis of the GPR19 gene was conducted by amplifying the 1245 base pair

open reading frame (O'Dowd et al. 1996) into five overlapping Fragments using primer

pairs designed designed de novo for this purpose (Table 1). The PCR reactions were

conducted using 1 ug of each oligonucleotide primer (Table l), 2 umol dNTPI 1.5 m o l

MgCI2 and 0.5 U Taq DNA polymerase (Life Technologies, Inc. Gaithersburg, MD) in a

total reaction volume of 100 ul. 200 ng of template was used per reaction. The PCR was

conducted in a Perkin Elmer Therocycler using 40 cycles, at 95 OC for 45 seconds. 55-6 1

OC for 45 seconds. and 72 *C for 1 minute 30 seconds. The arnplified DNA was analyzed

by agarose gel electrophoresis prior to mutation screening.

(b) Amplification of DRDl fragments to be analysed by SSCP

The pnmers used to amplifi the overlapping DRDl gene Fragments were designed de

novo for use in this screening project. SSCP analysis of the DRDl gene encoding the 446

amino acid dopamine Dl receptor (Sunahara et al, 1990) was conducted by arnplifying

the 1338 base pair DRDl gene coding region in five overlapping fragments using the

TABLE. 1 . Oligonucleotides Used in PCR-SSCP Analysis of Hurnan GPR19 ge

Fragrne Anneal S Primer N Primer Sequence (5'-3') (base pa Temp. O

1 1 -UP TTCTTTTCCCCAACCAGAAT 32 1 6 1 2 - D O W GGAATTGCCGAAGATAGAA

2 3-UP ACAGCCAGCATCTTCTTTGG 32 1 58 4-DO WN CCGGTCTATGCAGATGGA

3 5-UP ACTCCAGGTGTCCAGATCTA 32 1 60 6-DO WN TTGGTAAAATAAAATTATGAG

4 7-UP ACTGCCTACACTGTCATCCA 33 1 55 8-DO WN TTTCATCCCTCTCCGAAA

5 9-UP CCTACTCTGTATTCAATTTA 3 1 8 60 1 O-DO W AACAATTGAAAGAATGAG

TABLE. 2. Oligonucleotides Used in PCR-SSCP Analysis of Human DRD 1 ge -

Fragme Anneal S Primer N Primer Sequence (5'-3') (base pa Temp. O

1 Pl-UP CTGCTTAGGAACTTGAGGG 321 60 P2-DOW GAAGCCAGCAATCTCAGCCAC

2 P3-UP CTGGTCATGCCCTGGAAGG 309 55 P4-DO W GGTCTCAGCCAGGGAAGTGGC

3 P5-UP CCAGTGCAGCTCAGCTGGC 414 60 P6-DO W CAAAATGCAGTTCAAGATGAA

4 P7-UP GTGTGCTGTTGGCTACTTTT 352 55 P8-DOW CAGGTCCTCAGAGGAGCCCAC

5 P9-UP AAGGAGTGCAATCTGGTTT 26 1 58 P 1 O-DO GCAAACCCCAGAGCAATCTCC

primer pairs listed in Table 2. The PCR reactions were conducted using 200 ng human

genomic DNA, 1 ug of each oligonucleotide primer (Table 2), 2 m o l dNTP, 1.5 mm01

MgCl2 and 0.5 U Taq DNA polymerase (Life Technologies, Inc. Gaithersburg, MD).

PCR was conducted using 40 cycles, at 95 OC for 30 seconds. 55-60 OC for 40 seconds.

and 72 OC for 40 seconds in a Perkin Elmer Gene Arnp PCR Systern 2400 machine. The

arnplified DNA was analyzed by agarose gel electrophoresis prior to the mutation

screening.

(c) Amplification of DATl exons analyzed by SSCP

The complete set of PCR primers used to ampliS. each DATl exon and the 3 ' and 5'

flanking regions is listed in Table 3. The primers were designed from unpublished

sequence information made available to us through our collaboration with the laboratory

of George Uhl, National fnstitute on Dmg Abuse, Johns Hopkins University School of

Medicine (David Vandenbergh, personal communication). The PCR reactions were

conducted using 200 ng human genomic DNA. 0.5 ug of each oligonucIeotide primer

(Table l), 2 umol dNTP, 1.5 rnrnol MgCl,, 10% DMSO and 0.5 U Taq DNA polymerase

(Life Technologies, Inc. Gaithersburg, MD) (Lam et al, 1996; Heiber et al, 1996;

Marchese et al, 1994). The 15 pairs of PCR primers used to ampli@ each exon are listed

in Table 3. PCR was conducted using 40 cycles, at 95 OC for 30 seconds, 60-68 O C for 40

seconds, and 72 OC for 40 seconds in a Perkin Elmer System 2400 Gene Arnp PCR

machine. The total reaction volume was 50 til.

2C 1 DAT DAT 122s EX3FOR EX3REV EX4FOR EX4REV EXSFOR EXSREV EX6FOR EX6REV EX7FOR EX7REV EX8FOR EXSREV EX9FOR EX9REV Ex 1 ORO EXlORE EX1 lFO EXIlRE EX12FO EX12RE EX13FO EXl3RE EX14For EX 14Rev EXISFO HDAT2 1

CAAAGCCA ATGACGGACAG CGTGGGACTCATGTCTTCCGTGG CCCCGGCTGCACCTACGAC ACGAGGAGAGATGGGCCCITCC GTCACCACCATGATCCGCGC GTTGCTGATGGTGGCTCTGTGCT GTCGCGCCATCTCTCCCG TTCCAGGTGGGTTGACAGCCTC TTGGTGGCCCCATGTCTACAGG CCCACCAAGGGCCCTGCC TGGGAATGCCAGAGCCCCTG CTCAGGTCC'ITTGCCTGTGGC GACCTCTCCCTAGTATTGATGAGGCC ATTGCAGCTGCTGCAGCTCAGC CGGCGCTGGTGCTACACGG GGCAAGCAGGGCGGGTTCTG CGGGCGGTGCGGGTTACTC GGCCCAGGCTGCGGTCAG CCTGACAGTCCCAGCCAGGGC CCCCAGGCTGGGTTTACCTCTGG GAAGGGGAGTGGCACAGCCACC TGTCCAGCATCGGGGGAATG GTGCCAGAGTGGGGGCAGTG CCTGCTTTGTCCTGGCACCG GACACCCACGGAGCCTTTCTGG GGTCCTGACAGTGTGAGTCAGTGGTG GGGCTAAGAACACTGAGCTTGGGATC TGCTCTTAGCCACCTTCAGCTGCTC GGAGTCTTCTGCTTTGTTGTTTGTGTTTTCAG

TABLE. 3. Oligonucleotide Pnmers Used in PCR-SSCP Anaiysis of Human DATl g Frag Anneal

Name Primer Sequence (5'-3') Locati size ( temp " EX2ForB TGCCCTCCGCACCAGGTATG Exon 359 60

(d) Genotyping the DATl3'VNTR by PCR amplification

Amplification of the DATl 3'WTR was conducted using primers consisting of : T3-

SLong, 5'-TGTGGTGTAGGGAACGGCCTGAG-3' and T7-3aLong, 5'-

CTTCCTGGAGGTCACACGGCTCAAGG-3. Concentrations of PCR reagents in the

final reaction mixture were as described for amplification of DATI exons above. The

total PCR reaction volume was 50 irl. PCR was conducted using 40 cycles, at 94 OC for

30 seconds, 6 8 ' ~ for 40 seconds, and 72 OC for 40 seconds in a Perkin Elmer Gene Amp

PCR System 2400 machine. DNA was analyzed by 4% agarose gel electrophoresis in

order to separate VNTR alleles of different sizes. Amplifieci DNA was visualized by

ethidium bromide staining.

(e) Genotyping the SHTT polymorphisms by PCR amplification

The 5HTT promoter variant was arnplified using two sets of oligonucleotide primers.

Eighty-five DNA samples from TS patients and 9 1 TS controls. in addition to 61 of the

64 DNA samples fiom alcohol dependent patients and 32 controls were genotyped at the

5HTT promoter by ampliQing a 4841528-bp fragment using the prïmers stprj. 5'-

GGCGTTGCCGCTCTGPLATGC-3' and S t r P 3 5'-

GAGGGACTGAGCTGGACAACCCAC-3'. The alcohol dependent DNA samples were

genotyped at the SHTT prornoter by amplieing a 4061450-bp fragment using the primers

HTTpZA, 5'-TGAATGCCAGCACCTAACCC-3', and HTTpSB, j * -

TTCTGGTGCCACCTAGACGC-3 ' .

The amplification of the 5HTT promoter was conducted using as little as 100 ng

human genomic DNA. One ug of each oligonucleotide primer, 2.0 mm01 MgClz 0.6 U

Taq DNA polymerase and 1 X PCR buffer (Life Technologies, Inc. Gaithersburg, MD)

were used in each PCR reaction. Each reaction mixture contained 200 rmol of each

dNTP, with the exception of dGTP which was included at a concentration of 100 mole,

plus 100 zmole of 7'-deaza-dGTP. The total PCR reaction volume was 25 ul. PCR was

conducted using 40 cycles, at 94 OC for 30 seconds, 60 OC for 40 seconds. and 72 OC for

40 seconds in a Perkin Elmer Gene Amp PCR System 2400 machine. The amplified

DNA was analyzed by 4% agarose gel electrophoresis and the DNA amplified was

visualized by ethidiurn bromide staining pnor to photography over a UV light source.

The SHTT exon 2 VNTR was amplified for 75 controls matched to TS patients and

32 controls matched to alcohol dependent patients using the primers HTTZX, 5' -

TGGATTTCCTTCTCTCAGTGATTGG-3', and HTT2Y, y-

TCATGTTCCTAGTCTTACGCCAGTG-3'. to ampli@ the 345-bp (9 copy), 360-bp (10

copy) and 390-bp (12 copy) fragments of DNA encompassing the three alleles of the

VNTR. The VNTR of the 85 TS, 64 alcohol dependent, and 16 controls matched to TS

patients was amplified using the pnmers, S-CAATGTCTGGCGCTTCCCCTACATAT-

3' and 5'-GACATAATCTGTCTTCTGGCCTCTCAA-3'. The PCR products were

resolved in 4% acrylarnide gel and visualized by silver staining.

Amplification of the VNTR was conducted using 150 ng human genomic DNA, 1 ug

o f each oligonucleotide primer, 300 umol dNTP, 2.0 mm01 MgCl2, 0.6 U Taq DNA

polymerase and 10% PCR buffer (Life Technologies, Inc. Gaithersburg, MD) per PCR

reaction. The total PCR reaction volume was 25 ul. PCR was conducted using 40 cycles,

at 94 OC for 30 seconds, 57 OC for 40 seconds. and 72 OC for 40 seconds in a Perkin

Elmer Gene Arnp PCR System 2400 machine. DNA was analyzed by 4% agarose or 4%

acrylamide gel electrophoresis and then visualized by ethidium bromide staining or silver

staining respectively.

2.7 SSCP mutation screening of GPR19, DRDl and the DATl gene

(a) Overview of the SSCP methodology

Non-denaturing polyacrylamide gel electrophoresis was conducted on pre-cast 4-20%

gradient gels (Novex) in the Xcell II mini-ce11 system (Novex). In some cases the

ThermoFlow SSCP Electrophoresis System, consisting of an Xcell 11 mini-ce11 system

adapted to allow temperature regulated electrophoresis. was used to optimize SSCP

conditions. The T'hermoFlow re-circulates 1 XTBE buf3er fiom the mini-ceIl through a

condenser coi1 regulated by a temperature controlled water bath (Haake. Karlsruhe,

Gemany). Mutation screening efficiency was optimized (Oto et al. 1993) by screening

each PCR product under at least two temperature conditions by adjusting the TBE buffer

temperature. SSCP was routinely conducted at 4 OC in the cold room and at 24 "C (room

temperature). Intermediate or higher temperature SSCP (see results section) was

conducted in the ThemoFlow.

Initidly, electrophoresis was conducted at 200 volts for 2 hours at 24 O C in the

ThermoFlow as indicated by recent protocols (Calvert et al, 1995). However, the

majority of the SSCP analysis reported here was conducted at between 50-90 volts.

Electrophoresis at 4 OC was conducted at 85 volts for 15-18 hours. At 24 OC the

electrophoresis voltage was dropped to 55 volts in order to compensate for the faster

running time of SSCP conducted at 24 OC.

b) SSCP protocol adapted for use with Xcell II apparatus (Novex)

Between 3 and 6 u1 of the 50 ul PCR reaction was diluted 1 :4 with a formamide based

SSCP loading buffer in individual 0.2 uL micro-amp PCR tubes (O'Dowd et al, 1996).

The denaturing buffer was prepared before SSCP analysis by combining, in a 2 3 ratio, a

stock denaturing solution with a stock stop solution. Both stocks were stored at room

temperature. The denaturing solution was prepared with O. 1% SDS and 10 mM EDTA.

The stop solution was prepared with 95% formamide. 20 m . EDTA, 0.05%

bromophenol blue and 0.05% xylene cyanole FF. Samples were denatured at 95 O C for 5

minutes before being soaked at 4 OC in the PCR machine for 5 minutes prior to loading

on acrylamide geI (O'Dowd et al. 1996).

The entire 20 ul mixture of denaturing buffer and PCR product was loaded into the

separate wells of Novex 4-20 % TBE gels (Novex, La Jolla, California). Most SSCP

was run in the cold room or at room temperature, as described. DC Power was supplied

by a Biorad, Mode1 3000Xi Programmable Power Supply (Richmond, CA). A proportion

of the total PCR products amplified frorn patient and control DNA sarnples were selected

for repeated analysis in the ThemoFlow SSCP Electrophoresis System at other

temperatures. The Novex SilverXpress Staining kit was used to visualize SSCP band

shifts. Sequencing of the PCR products corresponding to SSCP band shifts was done as

descnbed below (O'Dowd et al. 1996).

2.8 Identification of sequence variants by chain-termination DNA sequencing

PCR products identified by SSCP to be potentially polymorphic were subcloned into

pBluescnpt. transformed into E. Coli competant cells (strain DIOB), grown ovemight in

LI3 broth with ampicillin before miniprepping and sequencing the PCR insert as

previously described (Marchese et al. 1994).

2.9 Statisticai Methods

The differences between the genotype and allele fiequencies of the TS and alcohol

dependent groups and theii respective control groups were analyzed by two-tailed a' tests

using the Statistical Package for the Social Sciences (SPSS). version 7. Hardy-

Weinbergh equilibrium for the genotypes at each locus was tested using x2 analysis as

done previously (Kennedy el al, 1995). The Bonferroni correction for multiple testing

was used in order to account for testing associations at three loci of the DATl gene and

two loci of the 5HTT gene (Aickin and Gensler, 1996). Analysis of sample power was

conducted using the Epi Infio, Version 5.01 a (Public Domain Sofrware for Epiderniolo~

and Disease Surveillance, March 199 1). Linkage disequilibriurn between haplotypes

consisting of the cornmon polymorphisms and the 3'VNTR was analyzed using the

maximum likelihood Equilibrium Haplotype (EH) (Terwilliger and On, 1994; Ott, 199 1 )

program.

RES_ULTS

3.1 SSCP mutation screening of the GPRl9 gene

The SSCP rnethodology used to screen candidate genes in this project was refined by

screening GPR19 in the 50 caucasian controls and 72 caucasian alcohol dependent

patients described in the context of the DRDl gene mutation screening project. The

purpose of this preliminary screening work was two-fold. First, we were interested in

establishing the optimal SSCP conditions for screening candidate genes for sequence

variants. Second, we were interested in determining whether polymorphic sequence

variants of GPR19 existed

GPR19 is an intronless gene that encodes a 414 amino acid gene producr. Our

interest in GPR19 stemmed fiom the fact that the GPR19 gene has many of the

chxacteristics of neurotransmitter G protein-coupled receptors (O'Dowd ei al, 1 993).

Hydrophobie analysis suggests that the deduced arnino acid sequence of GPR19 has the

seven transmembrane (TM) regions characteristic of GPCRs. The expression of GPRl9

in the olfactory tubercle, the islands of Calleja, the caudate-putarnen, and the pituitary

suggests that GPR19 encodes a neurotransmitter receptor with a pattern of expression

similar to the dopamine D2 receptor. The fact that 10 1 amino acids of the GPR19 gene

product were identical to those of the dopamine D2 receptor is further evidence that

GPR19 is likely to encode a neurotransmitter receptor. However, no ligand for the

GPR19 receptor has yet been identified.

Screening GRP19 revealed a number of single base pair nucleotide changes. The

combination of extended SSCP gel running time and reduced voltage was found to result

in more consistent resolution of DNA sequence variants by SSCP conducted on 4-20%

pre-cast polyacnlamide gels (Novex). SSCP detected a silent MG polymorphism at

nucleotide 1062 of the GPR19 gene of a control subject when samples were nin at 4 OC at

85 volts for 15 hours. This polymorphism was detected by the presence of an additional

band (Fig. 28, lane 2) in the portion of the SSCP gel resolving both single stranded (SS)

DNA and double stranded (DS) DNA. The polymorphism was poorly resolved, however,

when the samples were electrophoresed at 24 OC at 55 volts for 9 hours (Fig.2 C). The

rapid SSCP protocol (300 volts, 2 hours) did not resolve this polymorphism (Fig. 2A,

lane 2). niese results demcnstrate the importance of controlling temperature and voltage

conditions in order to ensure sensitive resolution.

The effect of SSCP running temperature on the resolution of sequence variants is also

illustrated in Figure 3. SSCP analysis run at 4 OC for 15 hours at 85 Volts resolved band

shifts that were revealed by sequencing to be homozygous (Fig 3A, lane 2) and

heterozygous (Fig 3B, lane 2) forms of a T/C nucleotide change at base pair 250 located

in the portion of GPR19 encoding the putative second transmembrane (TM2) domain.

The nucleotide change resuiting in the band shifis in Fig 3 was detected by SSCP in less

than 2% of the 114 DNA samples screened. The nucleotide change resulted in a

conservative Val l l6Ile amino acid change. The sarne heterozygous polymorphism

resolved in Fig 3B, lane 2 was also resolved by SSCP analysis run at 24 OC. however, the

pattern is very different.

Figure 4 shows the SSCP analysis of the portion of GPR19 encoding the putative

third transmembrane (TM3) domain of the receptor. The SSCP band shifis shown here

Figure 2 Optimization of SSCP temperature, ninning tirne and voltage to resolve variants. SSCP analysis of GPR19, run at 4 OC at 85 volts for 15 hours, detected a polymorphism (B, lane 2). Note the presence of an additional band in the portion of the SSCP gel resolving both single stranded (SS) and double stranded (DS) DNA. The polymorphism was poorly resolved at 24 OC at 55 volts for 9 hours (C, lane 2). Rapid SSCP (300 volts, 2 hours) did not resolve this polymorphism (A, lane 2).

Figure 3 The effect of SSCP ninning temperature on the resolution of sequence variants. The SSCP analysis run at 4 OC resolved band shifts revealed to be homozygous (A, lane 2) and heterozygous (B, lane 2) forms of a T/C nucleotide change in GPR19. The heterozygous polymorphism (B. lane 2) resolved into a different pattern when SSCP was conducted at 24 OC (C, lane 2).

Figure 4 Resolution of sequence variants in TM3 of GPR19. Variants were detected by SSCP nui at 24 OC but not at 4 O C . The SSCP gel was run at 50 volts for 15 hours using the SSCP conditions discussed.

were detected at 24 OC but not at 4 OC. The band shifis were present in nearly 7% of the

DNA sarnples anaiyzed. Sequencing showed that this nucleotide change of CiT at base

pair 300 resulted in a conservative arnino acid change fiom Ile289Val.

In the course of refining the SSCP protocol. various polyacrylamide gels were

compared for their ability to detect a single nucleotide change. Resolution of the

cornmon GPR19 polymorphism on pre-cast polyacrylamide non-gradient 10 % gels was

iderior to resolution on 4-20% gradient gels (Figure 5). The 10 % gels were

electrophoresed with 60% of the voltage used to run SSCP 4-20% graciient gels. however,

high SSCP band shift resolution was not maintained. Therefore, fùrther use of SSCP to

screen for sequence variants in candidate genes was undertaken using 440%

polyacrylarnide gels.

The above results represent our first experience with conducting SSCP on pre-cast

polyacrylamide gels. The resolution appeared superior compared with that used in Our

lab by Lam et al, 1996 to screen the SHTIA receptor for sequence variants in TS patients.

The GPRl9 gene was found to be highly conserved in patients and controls.

3.2 SSCP mutation screening of the DRDl gene

The SSCP analysis involved screening the entire coding region of the DRD 1 gene for

sequence variants using SSCP conditions that were found to be effective in screening the

GPR19 gene for sequence variants. No SSCP band shifts were noted in the TS (n=50),

the TS-AD-HD (n=35), the TS-OCD (n=30) and the alcohol dependent ( ~ 7 2 ) patient

groups when SSCP was conducted at 55 volts for 18 hours at 24 OC or at 100

Figure 5 Resolution of TM3 variant on 10% gels was inferior to that on 4-20% gels. When 10% gels were run at 60% of the voltage used to run gradient gels, SSCP resolution was not maintained.

volts for 18 hours at 4 O C . One band shift was observed in the SSCP analysis of the

portion of the gene coding for the amino terminus of the DRDl gene in one of the 50

controls matched to the Tourette's syndrome population (Figure 6. lane 2). The SSCP

analysis was conducted at 100 volts for 18 hours at 4 OC. Sequence analysis of the DRD 1

gene in 3 representative patients fiom each patient and control group confirmed that the

SSCP band shifi observed for the control subject analysed in figure 6, lane 2 was caused

by a base pair substitution of C for T which resulted in the conservation of 49Ile. This

sequence was not found among the patients screened.

3.3 SSCP mutation screening of the DATl gene

The DATl gene mutation screening project was ambitious because of the size and

complexity of the gene. The DATl cDNA encodes a large 620 amino acid protein.

encoded by 15 exons and introns of which al1 exons but the first are translated. The size

of the DAT 1 introns remains unknown. However, published (Donovan et al, 1995) and

unpublished (Vandenbergh, persona1 communication) intron-exon junction sequence

information enabled us to screen the DATl gene by subjecting the PCR products

amplified using the pnmers listed in Table 3 to SSCP analysis. This procedure presented

difficulties for those primer pairs that amplified more than one DNA product. For this

reason, the pnmers for exons 4, 10 and 12 were designed more than once before the set

presented in Table 3 successfûlly amplified the correct gene fragment.

The structure of the DATl gene was analyzed by SSCP in 225 subjects. Band shifts

were noted in al1 groups when exon 2 (using primer pair EX2ForB and 2C 1, Table

Figure 6 Analysis of a fragment (350 bp) of the D 1 receptor gene. This silent mutation was only detected by electrophoresis conducted at 85 volts for 24 hours at 1 OC. The arrow indicates the pattern of a polymorphic varient.

3) was analyzed by SSCP conducted at 55 volts for 18 hours at 24 OC (Fig. 7 A, lane 1).

Sequence analysis showed that the band shift was due to a sequence variant 171 C/T that

did not result in an amino acid change. The individual analyzed in lane 1 was revealed,

by sequencing, to be heterozygous.

In addition to the silent 171C/T polymorphism, a rare nucleotide change was also

discovered in exon 2 (Fig 7. lane 3) in a single control subject. Sequence analysis

showed that this band shifi was the result of a 164T/C nucleotide substitution that results

in a relatively conserved arnino acid change Va1 164AIa in this control subject.

A second conservative amino acid change was also discovered in another control

subject. Sequencing confirmed that the SSCP band shifi in exon 8 (Fig 8, lane 1).

resolved by 50 volt electrophoresis for 12 hours at 30 OC. resulted from a sequence

variant 1445TK. A Val 1 144Ala amino acid change resulted. The individual analyzed in

Fig 8' lane 1 was heterozygous for this sequence variant.

SSCP band shifts were also noted in al1 groups when exon 9 (Fig 9) and exon 15 (Fig

10) were analyzed by SSCP conducted at 100 volts for 18 hours at 4 OC on 440%

gradient gels. Sequencing revealed that the exon 9 SSCP band shifi (Fig 9, lane 2)

resulted from a hornozygous sequence variant 1215NG that did not result in an amino

acid change. Sequencing identified the individuals in lanes 1 and 3 to be homozygous

non-polymorphic and heterozygous for the polymorphism respectively. The exon 15

SSCP band shift (Fig. 10, lane 1) was confirmed to result fiom a homozygous sequence

variant 1898T/C downstream of the translated portion of exon 15. Sequencing confirmed

Figure 7 SSCP analysis of DATl exon 2 in three control subjects. Sequence analysis showed that the SSCP band shift in lane 1 was due to a silent sequence variant 171 C R . This individual was revealed, by sequencing, to be heterozygous. A rare nucleotide change was also discovered in the patient analysed in lane 3. Sequencing showed that this SSCP band shift reflects a 164TK nucleotide change in exon 2, resulting in a conservative arnino acid change Va1 1 64Ala in this control subject.

Figure 8 SSCP analysis of DATl exon 8 in three control subjects. The band shift in lane 1 was found to reflect a 445T/C sequence variant that results in a Va11 144Ala amino acid change. The individuai analyzed in lane 1 was heterozygous for this sequence variant. Individuals anaiyzed in lanes 2 and 3 were shown by sequencing to be non-polymorphic.

Figure 9 SSCP analysis of DATl exon 9 in d i r e TS subjects. Sequencing revealed that the exon 9 SSCP band shifi in lane 2 resulted from a homoqgous 1215NG sequence variant that did not result in an amino acid change. Sequencing identified the individuals in Ianes 1 and 3 to be hornozygous non-polymorphic and heterozygous for the polymorphism respectively.

Figure 10 SSCP analysis of DATl exon 15 in three control subjects. The band shift in lane 1 was confirmed, by sequencing. to result fiom a homozygous sequence variant 1898TIC Iocated downstream of the translated portion of exon 15. Sequencing confirmed that the individuals analyzed in lanes 2 and 3 were non-polymorphic and heterozygous for the exon 15 poiymorphism respectively.

that the individuals analyzed in lanes 2 and 3 were non-polymorphic and heterozygous

for the exon 1 5 polymorphisrn respectively (Giros er ai, 1992; Vandenbergh et a[, 1992).

In order to complete the project, patients and controls were genotyped for a

polymorphic 3'VNTR marker at the DATl locus (Vandenbergh et al, 1992). Three

alleles of the 3'VNTR were identified (Figure 1 1). Lane I shows the 480 base pair band

identified to be homozygous for the 10 repeat allele (1 0/10) of the 3'VNTR. Lane 2

shows the 480 base pair band and the 442 base pair band below it. This individual was

heterozygous for the 10 repeat and the 9 repeat aileles (1019) of the 3'VNTR. Lane 3

shows a 150 base pair band which identifies an individual homozygous for the 3 repeat

ailele (3/3) of the 3'VNTR.

3.4 Association study of DATl polymorphisms in TS and alcohol dependence

Allele frequencies of the novel polymorphisrns are shown in Table 4. The frequency

of the exon 2 polymorphism was between 3.7% and 6% in the TS (n=47), alcohol

dependent (n=64) and control groups (n=42) (Table 4). Because of its low frequency. we

did not genotype our remaining patient and control samples for the exon 2 polymorphism.

The frequencies of the cornmon polymorphisms in exons 9 and 15 were determined in al1

patient and control groups (Table 4).

The exon 9 A.G fiequencies were 19% and 23% in TS and control groups

respectively. The frequency of the exon 9 T/C polymorphism was 33% in the alcohol

dependent group and 24% in the matched control group. X h a l y s i s (Table 4), however,

Figure 11 PCR genotyping of the DATl 3'VNTR. Lane 1 was found to be a 480 base pair band homozygous for the 10 repeat allele ( 1 0110). Lane 2 shows the sepmation of the 480 base pair band and the 442 base pair band below it. This individual was found to be heterozygous for the 10 repeat and the 9 repeat alleles (1019). Lane 3 shows the 150 base pair band identifying an individual homozygous for the 3 repeat allele (313).

?'-LE 4. DATl allele and genotype frequencies: X'P values compare population frequencies Population Exon 2 N Frequency Genotype Frequencies x 2 p values

C/T 1-1 1 -2 2-2 3 x 2 3x3 Tourette's 1 09 0.037 0.926 0.074 O

Control 42 0.06 0.88 O. 12 O -

Alcoholics 64 0.047 0.906 0.094 O Control O - -

Exon 9 Allele 1 Genotype Frequencies x L p values Population MG N Frequency 1 - 1 1-2 - 3-2 3 x 2 2x2 Tourette's 1 09 0.77 0.59 0.37 O .O3 0.494 0.494

Control 67 0.8 1 0.64 0.3 0.06

Alcoholics 64 0.67 0.42 0.5 0.08 Control 64 0.76 0.53 0.36 0.0 1

Exon 15 Allele 1 Genotype Frequencies x2p values PopuIation T/C N Frequency 1-1 1-2 - 7-1 3 x 2 2 x 2 Tourette's 1 09 0.79 0.63 0.32 0.05 0.677 0.677

Control 67 0.75 0.57 0.37 0.06

Alcoholics 64 0.73 0.5 0.47 0.03 Control 64 0.76 0.56 0.46 0.0 I

S'VNTR 3'VNTR Genotype Frequencies X ~ P Population (48 bp), N 10/10 9/ 10 9/9 2/10 3 9 *Other 3 x 2 3x3 Tourette's 1 09 0.66 0.29 0.05 O O 0.05 0.767 0.767

Control 67 0.6 1 0.3 1 0.06 0.02 O 0.08

Alco holics 64 0.53 0.42 0.0; O 0.02 0.05 0.934 0.933 Control 64 0.56 0.3 8 0.03 0.03 O 0.06

3'VNTR compared by using 10/10, 9/10 and *Other genotpyes to generate X' P value.

indicates that the difference between exon 9 A/G allele frequencies and exon 9 A/G

genotype frequencies was not significant between patient and control groups.

The exon 15 T/C frequencies were between 21% and 27% for both patient (TS and

alcohol dependent) and control groups. X2 analysis (Table 4) indicated that the exon 15

TIC fiequencies and genotype frequencies were not significantly different between

patient and control groups. Genotype and allele fiequencies were also found not to be

significantly different between the TS group with no comorbidity, the TS-OCD group and

the TS-AD-HD ( X 2 ~ values ranging from 0.283 through 0.872). Al1 patient and control

groups were found to fit closely to Hardy-Weinbergh equilibnum at each of the three

polymorphisms genotyped, including the YVNTR. This concurs with the fact that

although the DNA was obtained fkom 4 sources, the patient and control subjects were

ethnicaily matched. The X 2 ~ values ranged fiorn 0.1 (exon 9 A/G in alcohol dependent

patients), through 0.97 (exon 15 T/C in TS).

Linkage disequilibrium between DAT 1 haplotypes was also analyzed. The lO/9

repeat polyrnorphism of the 3'VNTR (VNTR 10/9), found at similar allele and genotype

frequencies in each group (Table 4), was in linkage disequilibriurn with the exon 15

polymorphism in the TS group ( x2=6~ .9 1. 5df, pK1 the alcohol dependent group

(X1=19, jdf, p < l ~ 4 ) and in their respective control groups (X2=27.74. 5df. p<104:

X2=1 8.42, 5df, p<.104). For the exon 15 T/C-VNTR 10/9 haplotype, linkage

disequilibriurn coefficients 6 were O. 1 1 for TS patient and control groups and 0.10 for

alcohol dependent patient and control groups. The modest disequilibrium coefficient 6

values, on an absolute value scale fiom 0-0.25, suggest that, while significant

disequilibrium exists for the exon 15 A/G-VNTR 1019 haplotype, not al1 individuais with

the exon 15 TIC allele have the VNTR IO19 allele on the same chromosome.

In the TS group, linkage disequilibrium was aiso found between the exon 9

polymorphic allele and the 3'VNTR (X2=18.73. 5 df, p<4* 104) and between the exon 9

and exon 1 5 polymorphic alleles (X2= 12.72, 3 df, p<O.O4). The disequilibrium constants

6 were 0.7 and 0.6 for the exon 9 NG-VNTR 1019 and exon 9 NG-exon 15 T/C

haplotypes respectively. The more modest 6 values for these TS haplotypes compared to

those of the exon 15 T/C-VNTR 1019 haplotype suggests that, while statistically

significant, the exon 9 A/G-VNTR 1019 and exon 9 A/G-exon 15 TIC haplotypes are iess

fiequent. No evidence for linkage disequilibriurn was found between these alleles in

either the control groups or the alcohol dependent group.

3.5 Association study of SHTT polymorphisms in TS and alcohol dependeuce

The deletiordinsertion SHTT promoter polymorphism and the 5 H ï T intron 2 VNTR

polymorphism were genotyped in al1 patient and control groups (Figures 12 and 13). The

allele and genotype fiequencies are surnmarized in Table 5 . X 2 analysis showed that

genotype frequencies at both loci fit closely to Hardy-Weinbergh equilibrium for patient

and control groups. For the bi-allelic promoter locus, X Z ~ values ranged fiom 0.26 (for

the alcohol dependent group) to 0.92 (for the TS group). For the tri-allelic intron 2

VNTR locus, X 2 ~ values ranged corn 0.1 1 (for the TS group) to 0.80 (for the alcohol

dependent group).

Figure 12 Deletion/insertion SHTT promoter polymorphism genotyped on 4% agarose. Lane 1 shows the PCR product (-484 bp) of an individual homozygous for the short promoter. Lane 3 shows the PCR product (-528 bp) of an individual homozygous for the long promoter. Lane 2 shows PCR products for the long and short promoter arnplified from an individuai heterozygous for the long and short promoters.

Figure 13 Intron 2 VNTR polymorphism genotyped on 4% agarose. Lane 1 shows a PCR product (-390 bp) homozygous for the 12 copy (390 bp) . Lanes 2 and 3 show two band shifts for a patient heterozygous for the 12 copy and 9 copy (bp) alleles. Lane 4 shows the two band shifts of a patient heterozygous for the 12 copy and 10 copy (bp) alleles.

The SHTT promoter deletion (the short promoter) was significantly more common in

the TS group (51%) compared with the control group (36%) (X2=8.77, 2 df. p=0.04. two

tailed, Bonferroni corrected). Genotype fiequencies were not significantly different

between the TS and control groups (x'=8.45, 2 df. p=0.18, two tailed) afier Bonferroni

correction even though the homozygous shon genotype was twice as cornmon in the TS

group (26%) compared to the control group (13%). Odds Ratio for short promoter allele

association with TS was 1.88 [95% CI 1.2 1-2.931).

The short promoter allele was not significantly more fiequent (X'=1.52. 2 df, p=0.22,

two tailed) in the alcohol dependent group (45%) compared to its matched control group

(37.5%). Although the homozygous shon promoter alleie was more fiequent arnong

alcohol dependent patients (28%) compared with the matched control group (16%), the

genotype Frequencies were also not significantly different benveen the patient and control

groups (X2=1 83.2 df. p=0.40, two tailed).

The allele and genotype frequencies of the intron 2 VNTR were not significantly

different between the TS group and matched control group (X'=4.09. 2 df. ~ 0 . 1 2 9 . two

tailed; X2=6.37, 3 df, p=0.1, two tailed), as reported in Table 5 . Between alcohol

dependent and control groups, however, the allele frequencies (X'=20.56, 1 df, p=7.2* 10-

5 . two tailed, Bonferroni corrected) and genotype frequencies (X'=25.08, 3df, p=0.0006.

two tailed, Bonferroni corrected) were significantly different, as reported in Table 5. The

Odds Ratio for an alcohol dependent patient having the 10 copy allele was 5.80 [95% CI

2.42-14.371.

TABLE 5 . 5HTT allele and genotype frequencies: X'P values compare patient and control frequencies deletion/ N Frequency Genotype Frequencies X 2 p values

Group insertion 1 - 1 1-2 7-3 3 ? 2 2,V Tourette's 91 0.47 O .24 0.50 0.26 0.04 0.18

Control 91 0.64 O .42 0.45 O. 13

Intron 2 VNTR Genotype Frequencies X2p values Group VNTR N 12/12 10/12 10/10 9/ 12 9/10 919 9/AlI 4x2 2 .V Tou rette's 109 0.44 0.37 0.05 O O 0.05 0.05 0.10. O. 13.

Control 67 0.44 0.28 0.08 0.05 O 0.09 O. 14

Alcoholics 64 0.25 0.53 0.18 0.023 0.025 0 0.05 6'10'' 7.2'[0 -5

Control 32 0.62 0.20 0.03 O. 16 O O O- 16

SHTT innon VNTR genotype frequencies (4,V) compared 124'1 2, !O/ 12. i O / I O and 9iAll other alleles to jenerate X- value; SHTT allele frequencies (3x2) compared the fiequency of the 10 copy allele to the combined frequencies of al1 other alleles.

Linkage disequilibrium between the deletiodinsertion polymorphism and the intron 2

VNTR polymorphism was analyzed in each patient and control group. No evidence of

linkage disequilibrium between the polyrnorphisrns was found in the TS group or its

control group (%'=2.5 1. 5 df, p=0.5; X'=0.20, 5 df. p=O.j). Linkage disequilibrium was

significant between the polyrnorphisrns in the alcohol dependent group (X'= 1 5.67, 5 df,

p=0.004) but not in its control group (%'=O. 19, 5 df, p-0.5). In the alcohol dependent

group, the linkage disequilibriurn coefficient S was 0.1 for the haplotype consisting of the

(insertion) long promoter- 10 copy VNTR allele. This modest disequilibrium coefficient

6 value suggests that while statistically significant only partial linkage disequilibrium is

present for the short promoter-10 copy haplotype.

lDlSCUSSION

4.0 Interpreting candidate gene sequence vanants in patient and control groups

(a) Consenration of the DRDI gene in TS and in alcohol dependence

No systematic atternpt to associate strucniral variations in the coding region of the

DRDl gene with TS, aicohol dependence or related disorders has appeared in the

literature. The present midy has largely ruled out the possibility that mutations in the

coding region of the DRDl gene contribute to the etiology of TS or alcohol dependence

in the patients studied. The DRDl sequence conservation among the 72 alcohol

dependent patients reported here confirms the results of a previous study on the DRDI

gene in eight aicohol dependent patients (Lui et al, 1995). The integrity of the DRDl

gene coding region among TS patients confirms the results of a previous study on the role

of the DRDI gene in TS (Gelernter et al, 1993).

The previous work on the DRDl gene in TS was limited. however. by being confined

to analyzing RFLP sites f o n d in the regions flanking the DRDl gene (Gelemter et al.

1993). The present study. by contrast, effectively excludes the possibility that DRDl

coding region mutations contribute to the etiology of TS or aicohol dependence by

systematicdly screening the DRD I gene.

(b) DATl gene sequence variants in TS and in alcohol dependence

The DATl gene mutation screening examined whether sequence variants in the

coding region of this gene underlie the polygenic inheritance of TS (Gelemter et al, 1995:

Comings et al, 1996), AD-HD (Gill et ai, 1997; Cook e i al, 1995) and alcohol

dependence (Persico et al. 1993: Muramitsu et al. 1995). This study has succeeded in

identifying structurai variants in the coding region of the DATl gene that map help to

clari- association studies of the YWTR of the DATl gene with TS (Comings et al.

1996). .4D-HD (Cook et al. 1997: Gill et al. 1997: Cook et al. 1995) and alcohol

dependence (Muramatsu and H i p h i . 1995).

The DATl gene variants. however. are not likely to result in altered dopamine

transporter function. The two lare arnino acid changes. Val54Ala and Val164Ala are

consewative and were found in control subjects. Three common single nucleotide

polymorphisms were identified: exon 2 Cm. exon 9 A/G and exon 15 TIC. These

poly~oorphisms were not found at significantly different allele or genotype frequencies in

the TS or alcohol dependent groups bp %' analpis (Table 4). Therefore. the novel DATl

polymorphisms do not appear to be associated with TS or alcohol dependence. Power

analysis (specifuinp a type II error rate of ad.05 and power of 1 $=O. 80), indicates that

patient and control groups of the size used in this study are large enough to detect

hypothetical odds ratios of 2.3 and 3.35 for the DATI eson 9 A/G and exon 15 TIC

alleles to be risk alleles for TS (n=109) and alcohol dependence (n=64) respecrively.

Future studies should genotype larger patient and control sample groups in order to \-en@

that these polymorphisms are not associated with TS or alcohol dependence.

Previous studies (Comings et al. 1996: Gelemter el al. 1995) suppon the evidence

presented here that the DATl gene is not associated with the vocal and motor tics

considered to be the essential features of TS (Diagnostic and Statistical Manuai of Mental

Disorden. Fourth Edition. 1990). However. the earlier work by Comings et al. 1996. did

associate the DATl VNTR l0/10 genotype with 1-2% of AD-HD diagnosed comorbidly

with TS. In the present study. this association was not detected by analysis of the

frequency of the VNTR 1011 0 genotype in TS patients diagnosed comorbid with AD-KD

(n=33) compared with TS groups with no AD-HD cornorbidity (n=86). Future studies

should examine large samples of TS-AH-HD patients in order to confirm the lack of

association between DATl and TS-AD-HD found here.

Statistically significant, partial linkage disequilibriurn was found for the exon 15 TIC-

VNTR 1019 haplotype in al1 patient and control groups. This suggests that the exon 15

T/C marker may be of use in friture haplotype based Haplotvpe relative nsk (HH-RR)

studies of TS and aicohol dependent trios. Differences in linkage disequilibrium between

patient and control groups were noted. Partial linkage disequilibrium for the exon 9 NG-

VNTR 1019 and exon 9 NG-exon 15 T/C haplotypes was statistically significant in the

TS group but not in either control group or the alcohol dependent group. However.

linkage disequilibrium must be compared with caution between groups of unrelated

individuals because a control group unrelated to the patient group cannot control for

recombination events that result in different linkage disequilibria in different populations

(Tenvilliger and Ott. 1994). The linkage disequilibriurn between the novel DATl

polymorphisms, therefore, should be used to examine the family-based association of TS

with the DATl gene as done previously in studies of AD-HD (Gill et al, 1997; Cook et

al, 1997).

The results of the DATl candidate gene mutation screening represent a necessary step

(Gelman and Gelemter, 1993) toward understanding whether a candidate gene. such as

the DATl gene, contributes to the inheritance of a disease state. Our SSCP anaiysis of

the DATl gene, like the recent SSCP andysis of the norepinephrine transporter (NET)

(Stober et al, 1996), discovered sequence variants comrnon to control and disease States.

These polymorphisms rnay clarie studies of the phmacology of MP, cocaine (Volkow

et al, 1999, antidepressants and endogenous catecholamines (Buck and Amara, 1995)

because there is now evidence that amino acid variants, while comrnon in the NET gene,

are rare in the DATl gene. Research into the selective phmacology of the dopamine

and norepinephrine transporters using transporter chimeras (Buck and Amara, 1 995;

Buck and Amara, 1994) may be particularly usehl in determining the significance of

DATl sequence conservation.

The DATl sequence information, therefore, facilitates M e r studies of dopamine

transporter pharmacology (Volkow et al, 1995), the pharmacogenetics of cocaine

addiction (Gelemter et al, 1994; Persico et al, 1993) and future Iinkage studies of the

DATl gene in TS, alcohol dependence and other neuropsychiatrie disorders including

AD-HD. Should evidence of linkage or Iinkage disequilibrium between disorders and

the DATl gene be confi~rmed, a good case could be made for searching for

polymorphisms in the 5' regulatory sequences that may contribute to the dopamine

transporter pathology (Singer et al, 1991 ; Tiihonen ef al, 1995) that may underlie these

disorders.

(c) Association studies of SHTT variants in TS and in alcohol dependence

We have presented work that provides preliminary evidence that the 5HTT gene may

be a susceptibility loci for TS. X' analysis (Table 5) detected a significant difference

between allele fiequencies ( ~ ~ = 8 . 7 5 , 1 df. p=0.04, two tailed, Bonferroni corrected) but

not genotype fiequencies ($=8.45, 2 df, p=O. 18, two tailed, Bonferroni corrected) of the

5HTT promoter between TS patient and control groups. The Odds-Ratio of 1.88 for TS

patients to have at least one short 5 H ï T promoter allele, suggests that the 5HTT short

prornoter may be a risk ailele for TS. Ninety-five percent confidence intervals of 1.21-

2.73, indicate that the Odds-Ratio is above unity. Power analysis (speciSing a type II

error rate of a=0.05 and power of 1-B=0.80), indicates that patient and control groups of

the size used in this study are large enough to detect an odds ration of 2.4: a value toward

the upper Iimit of the 95% confidence interval of 1.21-2.73 of the Odds-Ratio for a TS

patient to have at least one short 5HTT promoter risk allele.

The discussion of the results of this study of the SHTT prornoter in TS would not be

complete without comparing the frequency of the SHTT short promoter allele in our

control group with that in control groups genotyped for other studies. In the control

group used for this study (n=9 l), the short promoter allele frequency was 36%. However,

other studies have found the short promoter at higher fiequencies. A study of the short

dlele in 90 German controls and 79 Itdian controls found this allele at frequencies of

41% and 42% respectively (Deckert et al, 1997). A study of the short allele in 104

English, 301 Italian and 95 German controls found its frequency to be 45%, 43% and

40% respectively (Collier et al, 1996). Therefore, replication of this work is necessary in

order to confimi the control frequency of the 5HTT short promoter allele in the caucasian

nonpsychiatrk control population. This issue must be considered because a common

weakness of association studies in psychiatric genetics has been the fact that statistically

significant associations can result from genotyping confounded control groups. even

when an attempt to match patients and controls for ethnic origin has been made (Pato et

al, 1993; Barr and Kidd, 1993).

The intron 2 VNTR, previously associated with unipolar depression (Evans et al,

1997; Ogilive et al, 1996) but not associated with manic depressive illness (Bellivier et

al, 1997), was also genotyped for both of our patient and control groups. VNTR allele

and genotype fiequencies were not significantly different in the TS group compared to

the control group, however, both the alleles and genotypes of this locus were significantly

different in the alcohol dependent group (n=64) compared to its control group (n=32)

(~~=22 .79 , 2 df, p=l .2* 1 O-', two tailed, Bonferroni corrected; X2=25.08, 4 df, p=7* 1 O-',

two taileci, Bonferroni corrected).

The control group assigned to the alcohol dependence group was small. Therefore,

we attempted to verify our analysis by comparing the alcohol dependent VNTR allele and

genotype fiequencies to those of the control group (n-91) that was originally assigned to

the TS patient group. This cornparison also found a significant difference between allele

and genotype frequencies (X'=16.64, 2 df, p=0.003, two tailed, Bonferroni corrected;

X2=20.83, 3 3df, p=0.0012, two tailed, Bonferroni corrected), although the X 2 ~ values are

larger. This analysis is not strictly valid because the large control group was not

originally assigned to the alcohol dependence group. However, it serves to codirm that

the VNTR allele and genotype frequencies are different between the alcohol dependent

patient group compared with both of our control groups.

Our VNTR findings for alcohol dependence are different From those reported (Ogilvie

et al, 1996) in the study associating the SHTT VNTR with depression. The depression

study found that the 9 copy VNTR allele was associated with risk for unipolar depression.

Our study, on the other hand, found that an excess of the 10 copy VNTR allele was

significantly more common than the combined 12 and 9 copy VNTR allele group (Table

5) in alcohol dependent patients (n=64) compared to controls (n=32). This analysis was

repeated using the larger control group (n=91) that was not originally assigned to the

alcohol dependent group. Again, the 10 copy VNTR allele was significantly more

cornmon that the combined 12 and 9 copy allele (%'=17-95, Idf, p=0.003, two tailed.

Bonferroni corrected), although the association was less significant ( X ' ~ values were

larger). The Odds Ratios of 5.80 [95% CI 2.42-14.371 and 2.85 [95% CI 1.69-4.8 11 were

calculated for the risk of an alcohol dependent patient having the 10 copy allele,

compared with controls from the small and large groups respectively. Therefore. our

study suggests that the 10 copy allele may confer risk for alcohol dependence by an

unknown mechanism that may invoive adjacent gene stuctures.

The VNTR association should be interpreted with caution, however, because the

intron 2 VNTR has no known effect on the 5HTT gene at the transcription level. While

alleles of the YVNTR of the insulin gene have been shown to correlate with its

transcription (Pugliese et al, 1997), there is no evidence as yet that the SHTT VNTR

alleles have any regulatory fünction (Ogilvie et al, 1996). The role of Activator Protein-l

(AP-1) motifs adjacent to the 5HTT WTR remains speculative (Ogilvie et al, 1996;

Lesch et al. 1994).

In addition, the SHTT intron 2 VNTR has not been genotyped in large enough

numbers (Evans et al, 1997; Ogilvie et al, 1996) to know the VNTR allele fiequency in

the caucasian population. Because depression is frequently comorbid with alcohol

dependence (Anton, 1996), our result showing an excess of the 10 copy VNTR allele in

alcohol dependence may conflict with the previous study showing that an excess of the 9

copy VNTR alleie is associated with depression (Ogilvie et al, 1996). Power analysis

(speciQing a type II error rate of a=0.05 and power of 1-P=0.80), however, suggests that

our alcohol dependent and control sarnples are large enough to be able to detect the Odds

Ratios for the 10 copy VNTR allele calculated. This work needs to be independently

repeated in order confirm these findings because the phenomenon of population

stratification (Barr and Kidd, 1993) has been known to confound studies that have

attempted to use unrelated controls matched for ethnic otigin (Barr and Kidd, 1993;

Kennedy et al, 1995).

It has previously been suggested (Ogilvie et al, 1996) that evidence of 5HTT VNTR

association with disease might indicate linkage disequilibrium of the VNTR with a

functional mutation (Ogilvie et al, 1996). This study found evidence that linkage

disequilibriurn for the short prornoter-VNTR IO copy haplotype is present in the alcohol

dependent group (6=0.1), but not in TS or control groups. However, the association of

the short promoter with alcohol dependence does not reach statistical significance. Power

analysis suggests that alcohol dependent and control groups are large enough to detect an

odds ratio of three if it were present.

While this sîudy does present evidence of linkage disequilibrium in the alcohol

dependent group that may be disease associated, it ought to be remembered that linkage

disequilibrium should be compared with caution between unrelated individuals

(Twenvlliger and Ott, 1994). A fùture study should genotype mother-father-proband

trios in order to assess whether the short promoter-VNTR 10 copy haplotype is associated

with alcohol dependence. Transmission of the short promoter allele in TS trios rnay also

be informative about the role of the 5HTT gene in TS.

4.1 Conclusions

We have succeeded in confirming the practicality of using SSCP to identifi sequence

variants of as little as a single base substitution under the conditions developed to screen

the GPR19 gene. n e fact that SSCP has previously been demonstrated to identim 85-

95% of single base pair substitutions (Jordanova et al, 1997; Schefield et al. 1993;

Weghorst et al, 1993) allows us to conclude that we have identified the majority of the

sequence variants of the candidate genes we screened in patient and control groups. We

have used SSCP to effectively exclude the role of sequence variants in the DATI and

DRDl gene coding regions fiom having a role in the etiology of TS or alcohol

dependence. The deletion/insertion polymorphism and the 10 copy VNTR allele of the

5HTT gene, discovered previously (Hiels et al 1996; Lesch et al, 1994), were found to be

significantly more cornmon in the TS and alcohol dependent groups, respectively,

compared with the control groups genotyped. The greater frequency of the 5HTT

deletiodinsertion polymorphism in the TS group is intriguing because there is in vitro

evidence that it may alter gene expression.

Adamson MD, Kennedy I, Petronis A, Dean M, Virkkunen M, Linnoila M, Goldman D. DRD4 dopamine receptor genotype and CSF monoamine metabolilites in Finnish alcoholics and controls. American Journal of Medical Genetics 60: 199-205 (1 995).

Aickin M, Gensler H. Adjusting for multiple testing when reporting research results: the Bonferroni vs Holm methods. Amencan Journal of Public Health 86: 726-728 ( 1 996).

Alsobrook JP 2 nd, Pauls DL. The genetics of Tourette's syndrome. Neurologie Clinics 15: 381-393 (1997).

Anderson G. Neuropathology studies on Tourette's syndrome brain tissues. In: Fnedhoff AJ, Chase TN (ed) Second I n t e e a l Svmposium on Tourette's svndrom. New York (1 99 1).

Anderson IM, Tomenson BM. The efficacy of selective serotonin re-uptake inhibitors in depression: a rneta-analysis of studies against tricyclic antidepressants. Joumal of Psychopharmacology 8: 238-249 (1 994).

Anton RF. Neurobehavioural basis for the pharmacotherapy of alcoholism: current and future directions 3 1 (suppl 1): 43-53.

Bardeesy N and Pelletier J. Mutational Detection by Single Stranded Conformational Polymorphism. In: Sarkar G (ed) Methods in Neuroscience 26: 163- 183 (1 995).

Barr CL, Kidd KK. Group frequencies of the Al allele at the dopamine D2 receptor locus. Biological Psychiatry 34: 204-209 (1 993).

Barr CL, Wigg KG, Zovko E, Sandor P, Tsui L-C. No evidence for a major gene effect of the dopamine D4 receptor gene in the susceptability to Gilles de la Tourette Syndrome in five Canadian families. American Journal of Medical Genetics 67: 30 1-305 (1 9%).

Barr CL, Wigg KG, Zovko E, Sandor P, Tsui L-C. Linkage study of the dopamine Dj receptor gene and Gilles de la Tourette syndrome. American Joumal of Medical Genetics 74: 58-6 1 (1 997).

Bella D, Arranz MJ, Murray RM, Vallada HP, Bengel D, Muller CR, Roberts GW, Smeraldi L, Kirov G, Sharn P, Lesch KP. A novel fimctionai polymorphism within the promoter of the serotonin transporter gene: possible role in susceptibility to affective disorders. Molecular Psychiatry 1 : 453-460 (1 996).

Bellivier F, Laplanche J-L, Leboyer M, Feingold J, Bottos C, Allilaire J-F, Launay J-M. Serotonin transporter gene and manic depressive illness: an association study. Journal of Biological Psychiatry 41 : 750-752 (1997).

Berrettini W. On the interpretation of association studies in behavioral disorders. Molecular Psychiatry 2: 274-28 1 ( 1 997).

Bodeau-Pean S, Laurent C, Campion D, Jay M, Thibaut F, DoIlfus S, Petit M, Samolyk D, d'Amoto T, Martinez M, Mallet J. No evidence for linkage or assiciation between the dopamine transporter gene and schizophrenia in a French population. Psychiatry Research 59: 1-6 (1 995).

Boyer WF, Feighner P. The serotonin hypothesis: necessary but not sufficient. In: Feighner JP, Boyer WF (eds). Selecti

- . . ve serotonin reuptake inhibitors. John Wiley

& Sons Ltd, Chichester (1 99 1 ).

Bronstein RA, Baker GB. Neuropsychological correlates of urinary amine metabolites in Tourette's syndrome. International Journal of Neuroscience 42: 1 13- 120 ( 1 99 1 ).

Brown GL, Kline WJ, Goyer PF, MinichielIo MD, Knisei MJP, Goodwin FK. Relationship of childhood characteristics to cerebrospinal fluid 5- hydroxyindolacetic acid in aggressive adults. In: Chagass C (ed). Bioloeical P-. Elsevier, New York. (1 985).

Bruun RD, Budman CL. Risperidone as a Treatment for Tourette's syndrome. Journal of Clinical Psychiatry 57: 29-3 1 (1 996).

Buck KS. Amara SG. Chimeric dopamine-norepinephrine transporters delineate structural domains influencing selectivity for catecholamines and 1 methyl-4- phenylpyndinurn. Proceedings of the National Academy of Sciences of the United States of Amenca 9 1 : 12584-8 (1 994).

Buck KS, Arnara SG. Structural domains of catecholamine transporter chimeras involved in selective inhibition by antidepressants and psychomotor stimulants. Molecular

Butler IJ, Koslow SH, Seifert WE, Caprioli RM, Singer HS. Biogenic amine metabo in Tourette's syndrome. Annals of Neurology 6: 37-39 (1 979).

Caine ED, Polinsky EU, Kartzinel R, Ebert MH. The trial use of clozapine for abnonnal involuntary movement disorders. American Journal of Psychiatry 136: 3 17-320 (1 979).

Calvert RJ, Weghorst CM and Buzard GS. PCR Amplification of Silver-Stranded SSCP Bands fiom Cold SSCP Gels. BioTechniques 18: 782-786 (1 995).

Castellanos FX, Giedd IN. Elia J, Marsh WL, Ritchie GF, Hamburger SD, Rapoport L. Controlled stimulant treatment of ADHD and comorbid Tourette's syndrome: effects of stimulant and dose. Journal of the Amencan Academy of Child and Adolescent Psychiatry 36: 589-596 (1 997).

Cichon S, Nothen MM, Stober G, Schroers R, Albus M, Maier W. Rietschel M. Korner 5, Weigelt B, Franzek E, Wildenauer D, Fimmers R. Propping P. Systematic screening for mutations in the 5'-Regdatory region of the human dopamine Dl receptor @RD I ) gene in patients with schizophrenia and bipolar affective disorder. Amencan Journal of Medical Genetics 67:424-428 (1996).

Cloninger CR, Bohman M, Sigvardsson S, Von Knorring AL. Psychopathology in adopted-out children of alcoholics. Recent Developments in Alcoholism 3 : 37 (1 985).

Cloninger C. Neurogenetic adaptive mecbanisms in alcoholism. Science 236: 4 10-41 6 (1 987).

Cloninger CR, Sigvardsson S. GiIligan SB, Von Knorring AL, Reich T, Bohman M. Genetic heterogeneity and the classification of alcoholism. Advances in Alcoholism and Substance Abuse. 7: 3- 1 6 ( 1 989).

Cohn DJ, Schaywitz BA, Caparulo BK, Young JG, Bowers MB. Chronic, multiple tics of Gilles de la Tourette's disease: CSF acid monoamine metabolites afler probencid administration. Archives of General Psychiaûy 35: 245-250 (1 978).

Collier DA, Stober G, Li T, Heils A, Catalano M, Di Bella D, k a n z MJ, Murray RM, Vallada HP, Bengel D, Muller CR, Roberts GW, Smeraldi El Kirov G, Sham P, Lesch PK. A novei functional polymorphism within the promoter of the serotonin transporter gene: possible role in susceptibility to affective disorders. Molecular Psychiatry 1 : 453-460 (1 996).

Comings DE, Comings BG, Devor EJ, Cloninger CR. Detection of a major gene for Gilles de la Tourette syndrome. Arnencan Journal of Human Genetics 36: 586-600 (1 984)

Cloninger C. Neurogenetic adaptive mechanisms in alcoholism. Science 236: 41 0-416 (1 986).

Comings DE. Comings BG, Muhleman D. Dietz G, Shahbahrami B, Tast D, Knell E, Kocsis P, Baumgarten R, Kovacs BW, Levy DL, Smith M, Borison RL, Evans DD, Klein DN, MacMurray J, Tosk SM, Sverd J, Gysin R, Flanagan SD. The dopamine D2 receptor locus as a modiQing gene in neuropsychiatrie disorders. Journal of the Arnencan Medical Association 266: 1793- 1800 (1 99 1).

Comings DE, Comings BG. Cornorbid Behavioral Disorders. In Kurlan R (ed). dbook of Tourette Syndrome and Related Tic and Behavioral Disorders.

Marcel Dekker, New York (1993).

Comings DE. Tourette syndrome: a hereditary neuropsychiatnc spectnun disorder. Annals of Chica l Psychiatry 6: 235-247 (1 994).

Comings DE, Wu S, Chui C, Ring RH, Gade R, Ahn C, MacMurray IP, Dietz G, Muhleman D. Polygenic inheritance of Tourette syndrome,stuttering, attention deticit hyperactivity, conduct and oppositionai defiant disorder: the additive and subtractive effect of the three dopaminergic genes-DRD2, DBH, and DATI. Amencan Journal of Medicai Genetics 67: 264-288 (1996).

Comings DE, Gade R Wu S, Chiu C, Dietz G, Muhieman D, Saucier G. Ferry L, Rosenthai TU, Lesieur HR, Rugle LJ, MacMurray P. Studies in the potential role of the dopamine Dl receptor gene in addictive behaviors. Molecular Psychiatry 2: 44-56 (1 997).

Cook Jr EH, Courchesne R, Lord C, Cox NJ, Yan S, Lincoln A, Haas R. Courchesne E. Leventhal BL. Evidence of linkage between the serotonin transporter and autistic disorder. Molecular Psychiatry 2: 247-250 (1 997).

Cook Jr EH, Stein MA, Krasowski MD, Cox NJ, Olkon DM, Kieffer JE. Leventhal BL. Association of attention-defect disorder and the dopamine transporter gene. Arnerican Journal of Human Genetics 56: 993-998 (1995).

Cook Jr EH, Stein MA, Leventhal BL. Family-Based Association of Attention- Deficitkiyperactivity Disorder and the Dopamine Transporter. In Blum K. Noble EP. Sparks RS, Chen THJ, Cu11 JG (eds): Handbook of Psychiatrie Genetics. CRC Press. Boca Raton (1 997).

Coon H, Jensen S, Hoff M, Holik J, Plaetke R. Reimherr F. Wender P. Leppert M. Byerley W. A Genorne-wide search for genes predisposing to manic-depression. assuming autosomal dominant inheritance. American Journal of Human Genetics 52: 1234- 1249 (1 993).

Craddock N, Owen MJ. Candidate gene association studies in psychiatric genetics: a SERTain future? Molecular Psychiatry 1 : 434-43 6 ( 1996).

Daniels J, Williams JD? Asherton P, McGuffin P, Owen M. No association between schizophrenia and polymorphisms within the genes for debnsoquine 4- hydroxylase (CYP2D6) and the dopamine transporter @AT). Amencan Journal of Medical Genetics 60: 85-87 (1995).

DanieIs J, Baker DG, Norman AB. Cocaine-induced tics in untreated Tourette's syndrome. American Journal of Psychiatry 135: 965 (1 996).

Deckert DJ, Heils CM, Di Bella D, Fness F, Politi E, Franke P. Nothen MM, Maier W. Bellodi L, Lesch KP. Functionai promoter polyrnorphism of the human serotonin transporter: lack of association with panic disorder. Psychiatric genetics 1997; 7: 45- 47.

Devor EJ, Coloninger CR. Genetics of alcoholism. Annual Review of Genetics. 23: 19- 36 (1989).

Di Bella D, Catalano M, Balling UT Smeraldi E, Lesch K-P. Systematic screening for mutations in the coding region of the human serotonin transporter (5-HTT) gene using PCR and DGGE. Amencan Journai of Medical Genetics 67: 54 1-545 ( 1 996).

Diagnostic and Statistical Manual of Mental Disorders. Third Edition-Revised. Washington DC: Arnencan Psychiatric Association, 1 987.

Diagnostic and Statistical Manual of Mental Disorders. Fourth Edition. Washington DC: Arnerican Psychiatric Association, 1990.

Ding Y-S. Fowler JS, Volkow ND, Gately J, Logan J, Dewey SL, Alexoff D. Fazzini E. Wolf AP. Pharmacokinetics and In Vitro Specificity of (' 'c) dl-threo- Methylphenidate for the Presynaptic Doparninergic Neuron. Synapse 1 8: 1 52- 160 (1 994).

Donovan DM, Vandebergh DJ. Perry MP, Bird GS, lngersoll R, Nanthakurnar E, Uhl G. Human and mouse dopamine transporter genes: conservation of Sflanking sequence elements and gene structures. Molecular Brain Research 3 0: 3 27-3 3 5 (1 995).

Dryja TP, Li T. Molecular genetics of retinitis pigmentosa. Human Molecular Genetics 4: 1739-1743 (1995).

Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley GS, Yandell DW, Sandberg MA, Berson EL. A point mutation in the rhodopsin gene in one form of retinitis pigmentosa. Nature 343 : 364-366 (1 990).

Dyr W, McBride WJ, Leurneng L, Li X, Murphy M. Effects of D 1 and D2 dopamine receptor agents on ethanol consumption in high-alcohol-drinking (Hm) line of rats. Alcohol 10: 207-2 12 (1993).

Ebstein RP, Gritsenko 1, Nemanov L, Frisch A, Osher Y, Belmaker RH. No association between the serotonin transporter gene regdatory region polymorphism and the Molecular Psychiatry 2: 224-226 (1 997).

Evans J, Battersby S, Ogilvie AD, Smith CA, Harmar M. Nudd DJ, Goodwin GM. Association studies of short alleles of a VNTR of the serotonin transporter gene with anxiety syrnptoms in patients presenting after deliberate self h m . Neuropharmacology 36: 439-443 ( 1 997).

Farzan M, Choe H, Martin K, Marcon L, Hoharm W, Karisson G, Sun Y, Barett P. Marchand N, Sullivan N, Gerard N, Gerard C. Sodroski J. Two orphan seven- transmembrane segment receptors which are expressed in CD4-positive ceils support simian imrnunodeficiency virus infection. Journal of Experimental Medicine 1 86: 405-4 1 1 (1 997).

Fibiger HC. Drugs and reinforcement mechanisms: A cntical view of catecholamine theory. Annual Review of Pharmacology and Toxicology 18: 37-56 (1 978).

Freimer NB, Reus VI, Escamilla MA, M c I ~ e s AL, Spesny M, Leon P. Service SK, Smith LB, Silva S, Rojas E, Gallegos A, Meza L, Fournier E, Baharloo S, Blankenship K. Tyler DJ, Batki SV, Vinogradov S. Weissenbach J, Barondes SH, Sandkuijl. Genetic mapping using haplotype, association and lhkage methods s uggests a locus for severe bipolar disorder (BPI) at 18q22-q23. Nature Genetics 12: 436-441 (1996).

Galvac D, Dean M. Comarison of the sensitivity of single-stranded conformational polymorphism and heteroduplex methods. In Sarkar G (ed): Methods in Neurosciences 26: 194-209 (1 995).

Gelemter J, Kennedy JL, Grandy DK, Zhou Q-Y, Civelli O, Pauls DL' Pakstis A, Kurlan R, Sunahara RK, Nimik KB, O'Dowd B, Seeman P, Kidd KK. Exclusion of close linkage of Tourette3 syndrome to D, dopamine receptor. American Journal of Psychiatry 150: 449-453 (1 993).

Gelemter J, Kranzler HR, Satel S R Rao PA. Genetic association between dopamine transporter protein alleles and cocaine-induced paranoia. Neuropsychopharmacolpgy 1 1 : 195-200 (1 994).

Gelemter J, Vandenbergh D, Kruger SD, Pauls DL, Kurlan R, Pakstis AJ, Kidd KK. ühi G. The dopamine transporter protein gene (SLC6A3): primary linkage mapping and linkage studies in Tourette syndrome. Genomics 3 0: 459-463 ( 1 995).

Gelman PV, Gelemter J. Muation analysis of candidate genes in psychiatric disorders. American Journal of Medical Genetics 48: 184- 19 1 (1 993).

Geogiou N, Bradshaw JL, Phillips JG, Bradshaw JA, Chiu E. The Simon effect and attention deficits in Gilles de la Tourette's syndrome and Huntington's disease. Brain 118: 1305-13 18 (1995).

George SR, Cheng R, Nguyen T, Israel Y, O'Dowd BF. Polymorphisrns of the D4 dopamine receptor alleles in chronic alcoholism. Biochemical and B iophysical Research Communications 1 96: 1 07- 1 14 (1 993).

George SR, Fan T, Ng G, Jung SY, O'Dowd BF, Naranjo C A. Low endogenous dopamine function in brain responses to high alcohol preferance and consumption: reversal by increasing synaptic dopamine. Journal of Pha rmaco lo~ and Experimental Therapeutics 273 : 373-379 ( 1995).

Gill M, Daly G, Hawi Z, Fitzgerald M. Confirmation of association between attention deficit hyperactivity disorder and a dopamine transporter polymorphism. Molecular Psychiatry 2: 3 1 1-3 13 (1 997).

Giros B, Mestikawy S, Godinot N, Zheng K, Han H, Yang-Feng T, Caron MG. Cioning, pharmacological characterization, and chromosomal assignment of the dopamine transporter. Molecular Phmacology 42: 3 83-3 90 ( 1 992).

Goldman D. Candidate genes in alcoholism. Clinical Neuroscience 1995; 3 : 174- 18 1.

Gordis E. Genes and the environment in complex diseases: a focus on alcoholism. Molecular Psychiatry 2: 282-286 (1 997).

Gordon C, State R Nelson J, Hamburger S, Rapoport JA. Double-blind cornparison of clonpramine, desiprarnine, and placebo in the treatment of autistic disorder. Archives of General Psychiatry 50: 44 1-447 (1 993).

Grice DE, Leckman Ji?, Pauls DL, Kurlan R, Kidd KK, Pakstis AJ, Chang FM, Buxbaurn JD, Cohen DJ, Gelemter J. Linkage disequilibrium between an allele at the dopamine D4 receptor locus and Tourette's syndrome, by the transmission- disequilibrium test. Amencan Journal of Human Genetics 59: 644-652 (1996).

Heiber MI Marchese A, Nguyen T, Heng H, George SR, O'Dowd BF. A novel human gene encoding a G-protien-coupled receptor (GPRI 5) is located on chrosome 3. Genornics 32: 462-465 (1996).

Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel Dietmar D, Lesch KP. Allelic variation of human serotonin transporter gene expression. Journal of Neurochemistry 66: 262 1-2624 (1 996).

Hemandez 1, Sokolov BP. Abnormal expression of serotonin mRNA in the frontal and temporal cortex of schizophrenics. Molecular Psychiatry 2: 57-64 (1 997).

Hetchrnan L. Genetic and neurobiological aspects of attention deficit-hyperactivity disorder. Joumal of Psychiaty and Neuroscience 19: 193-201 (1 993).

Heutuik P, van de Wetenng BJM, Pakstis AJ, Kurlan R, Sandor P, Oostra BA, Sandkuijl LA. Linkage studies on Gilles de la Tourette syndrome: what is the strategy of choice. Amencan Journal of Human Genetics 57: 465-473 (1995).

Hodge SE. What association analysis c m and cannot tell us about the genetics of complex disease. Arnerican Journal of Medical Genetics 54: 3 18-323 (1994).

Hongyo T, Buzard GS, Calvert Ri, Weghont CM. 'Cold SSCP': a simple, rapid and non- radioactive method for optimized single-stranded conformational polymorphism analysis. Nucleic Acids Research 2 1 : 3637-3642 (1 993).

Hom DS. Dopamine uptake: a review of progress in the last decade. Progress in Neurobiology 34: 3 87-400 (1 990).

Imperato A, Di Chiara Di. Preferential stimulation of dopamine release in die nucleus accurnbens of freely moving rats by ethanol. Journal of Pharmacology and Experimentd Therapeutics 239: 2 19-239 ( 1986).

Iancu 1, Kotler M, Bleich A, Lepkifker E. Cloripramine effecacy for Tourette3 syndrome and major depression: a case study. Biological Psychiarty 38: 407-409 (1 995).

Iny LJ, Pecknold J, Suranyi-Cadotte BE, Bernier B, Luthe L, Nair NPV. Meaney MJ. Studies of the neurochemical link between depression, anxiety, and stress frorn (3 H) imipramine and (3H) paroxetine binding on human platelets. Biological Psychiatry 36: 28 1-29 1 (1 994).

Jordanova A, Kalaydjieva L, Savov A, Claustress M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky 1. SSCP analysis: a blind sensitivity trial. Hurnan Mutation 1 0: 65-70 (1 997).

Kennedy JL. Billet EA, Macciardi FM, Massimillano V, Parsons TJ, Meltzer HY, Lieberman J, Buchanan JA . Association study of the D3 receptor gene and schizophrenia. Arnerican Joumal of Medical Genetics 60: 558-62 (1 995).

Kilty JE, Lorang D, Arnara SG. Cloning and expression of a cocaine-sensitive rat dopamine transporter. Science 254: 578-579 (1 99 1).

Kitayarna S, Shimada S, Uhl GR. Parkinsonisrn-inducing Neurotoxin MPP+: Uptake and Toxicity in Nonneuronal COS Cells Expressing Dopamine Transporter cDNA. Annals of Neurology 32: 109- 1 1 1 (1 992).

Koob F, Bloom FE. Cellular and molecular mechanisms of drug dependence. Science 242: 71 5-723 (1988).

Kopp P, van Sande J, Parma J, Duprez L, GerberH, Jmeson JL, Dumont JE, Vassart G. Bnef report: congenetai hyperthyroidism caused by a mutation in the throtropin- receptor gene. New England Jouml of Medicine 332: 150- 154 (1 995).

Kuhar MJ, Sanchez-Roa PM, Wong DF, Dannais RF, Grigoriadis DE, Lew R, Milberger M. Dopamine transporter: Biochemistry, pharmacology and imaging. European Neurology 3 O(supp1): 1 5-20 (1 990).

Lam S, Shen Y, Nguyen T, Messier T, Brann M, Comings D, George SR, O'Dowd BF. A serotonin receptor gene (5HTlA) variant found in a Tourette's syndrome patient. Biochemicai and Biophysical Research Communications 2 19: 853-858 (1 996).

Leckman JP, Riddle MA, Cohn DJ. Pathobiology of Tourette's Syndrome. In Cohn DJ. Bmun RD, Leckman JF (eds): Tourette's Svndrome and Tic Disorders . .

: Clinical d Treatment. John Wiley and Sons, New York (1988).

Lee H-H, Lo W-J, Choo K-B. Mutational analysis by a combined application of the multiple restriction fragment strand conformation polymorphism and the direct linear amplification DNA sequencing protocois. Analytical Biochemistry 205:289- 293 (1992).

Lejoyeux M. Use of serotonin (5-hydroxtryptamine) reuptake inhibitors in the treatment of aicoholism. Alcohol and Alcoholism 3 1 : 69-75 (1996).

Lesch K-P, Bdling U, Gross J, Strauss K, Wolozin B, Murphy D. Riederer P. Organization of the human serotonin transporter gene. Journal of Neural. Transmission 95: 157- 162 (1 994).

Lesch KP, Begnel D, Heils A, Sabol SZ, Greenbergh BD, Petri S, Benjamin J, Muller CR, Hamer DH, Murphy DL. Association of anxiety-related traits with a polymorphisrn in the serotonin transporter gene regdatory region. Science 274: 1527- 135 1 (1 996).

Li T, Yang L, Wiese C, Xu CT, Zeng Z, Giros B, Caron MG, Moises HW, Liu X. No association between aileies or genotypes at the dopamine transporter gene and schizophrenia. Elsevir. 17-23 (1 994).

Linnoila M, Virkkunen M, Scheinin M, Nuutila A, Rimon R Goodwin FK. Low cerebrospinal fluid 5-hydroxyindeolacetic acid concentration differentiates impulsive and nonimpulsive violent. Life Science 3 3 : 2609-26 14 (1 983).

Losonczy MF, Davidson M, Davis KL. The dopamiw h v n o m of schizophrenia. In Meltzer HY (ed): Psychopharmacology: The Third Generation of Progress. Ravan Press, New York.(1987).

Lui Q, Sobell JL, Heston LL, Sommer SS. Screening the dopamine D l receptor genr in I 3 1 schizophrenics and eight aicoholics: identification of polymorphims but lack of fùnctionally significant sequence changes. American Journal of Medical Genetics 60: 165-7 1 (1 995).

Malison RT, McDougle CJ, van Dyck CH, Scahill L, Baldwin RM, Seibyl IP, Price LH, Leckman JF, Innis RB. [123] beta-CIT SPECT imaging of striatal dopamine transporter binding in Tourette's syndrome. American Journal of Psychiatry 152: 1359-1 36 1 (1 995).

Mandras BK, Fahey MA, Bergman J, Canfield DR, Spealman RD. Effects of cocaine and related drugs in nonhuman primates. 1. [3H] Cocaine binds sites in caudate putamen. Jownal of Pharmacology and Experimental Therapeutics 25 1 : 1 3 1 - 14 1 (1 989).

Mann JJ, Hentelett RA, Lagarnita 1, Perper JA, Li S Arango V. Lower '~-~aroxet ine binding in cerebral cortex of suicide victims is partly due to fewer high affinity non-transporter sites. Journal of Neurl. Transmission 1 03: 1 3 3 7- 13 50 (1 996).

Marchese A, Docherty J, Nguyen T, Heiber M, Cheng R, Heng H. Tsui L, Shi X, George SR, O'Dowd BF. Cloning of G-protein-coupled receptors. Genomics 23: 609-6 18 (1 994).

Marchese A, George SR, O'Dowd BF. Cloning of novel G protein-coupied receptor genes: The use of homology screening and the poiymerase chah reaction. In Lynch KR (ed): Identification and expression of G protein-coupled teceptors. Wiley-Liss, New York (in press).

McDougle C, Naylor S, Cohn D, Volkrnar F, Heninger G, Price L. A double-blind, placebo-controlled study of fluoxarnine in adults with autistic disorder. Archives of General Psychiatry 53 : 100 1 - 1 O08 (1 996).

Meltzer HY. Role of serotonin in the action of atypical antipsychotic drugs. Clinical Neuroscience 3: 64-75 (1 995).

Messiha FS. Fiuoxetine: a spectnim of clinical applications and postulates of underlying mechanisms. Neuroscience and Biochemical Reviews L 7: 385-396 (1 993).

Michael NL, Chang G, Louie LG, Mascola JR, Dondero D, Birx DL, Sheppard HW. The role of viral phenotype and CCR-5 gene defects in HIV-1 transmission and disease progression. Nature medicine 3: 338-340.

Muller-Vahl KR., Kolbe Hl Dengler R. Alcohol withdrawal and Tourette's syndrome. Neurology 48: 1478- 1479.

Muramatsu T, Higuchi S, Murayarna M, Matsushita S, Hayashida M. Association between alcoholism and dopamine D4 receptor gene. Journal of Medicai Genetics 33: 113-1 15 (1995).

Muramatsu T, Higushi S. Dopamine transporter gene polymorphism and alcoholism. Biochemicai and Biophysical Research Communication. 2 1 1 : 28-32 (1 995).

Narango CA, Bremner KE. Serotonin-altering medications and desire, consurnption and effects of alcohol-treatment implications. EXS 7 1 : 209-2 1 9 (1 994).

Ng GY, George SR, O'Dowd BF. Studies on dopamine receptors and role in dnig addiction. In Blum K, Noble EP, Chen THJ, Cul1 JG (eds): Handbook of Ps~chiatnc

* .

Genetics. Edited by. CRC Press, Boca Raton (1997).

Ng GYK, O'Dowd BF, George SR. Genotypic differences in brain dopamine receptor function in the DBA/J and C57BL/6J inbred mouse strains. European Journal of Phmacology 269: 349-364 (1994).

Nirenburg MJ, Vaughan RA. Uhl GR, Kuhr MJ, Pickel VM. The dopamine transporter is localized to dendritic and axonal plasma membranes of nigrostriatal doparninergic neurons. The Journal of Neuroscience 16: 436-447 (1 996).

Noble EP. The Gene that Rewards Alcoholism. Scientific American (Science & Medicine) 3: 52-61 (1996).

Nothen MM, Erdrnann J, Komer J, Lanczik M, Fntze J, Fimmers R, Grandy DK, O'Dowd BF, Propping P. Lack of association between dopamine Dl and D2 receptor genes and bipolar affective disorder. Amencan Journal of Psychiatry 149: 199-201 (1992).

Nothen MM, Hebebrand J, Knapp M, Hebebrand K, Camps A, von Gontard A, Wette- Schafer R, Lish S, Cichon S, Poustka F, Schmidt M, Lehmkuhl G, Remschmidt H, Propping P. Association analysis of the dopamine D2 receptor gene in Tourette's syndrome using the haplotype relative risk method. Amencan Journal of Medical Genetics. 54: 249-252 (1 994).

O'Dowd BF. Structures of dopamine receptors. Joumal of Neurochernistry 60: 804-8 16 (1 993).

07Dowd BF, Nguyen T, Lynch KR, Kolakowski LF, Thornpson M, Cheng R Merchese A, Ng G, Heng HHQ, George SR. A novel gene codes for a putative G protein coupled receptor with an abundant expression in brain. FEBS Letters 394: 325-329 (1 996).

Ogilvie AD, Battersby S, Bubb VJ, Fink G, I-iannar AJ, Goodwim GM, Smith CA. Polyrnorphism in the serotonin transporter gene associated with susceptibility to major depression. Lancet 347: 73 1-733 (1996).

Ohara K, Ulpian C, Seeman P, Sunahara RK, Van Tol HHM, Nimik HB. Schizophrenia: dopamine D 1 receptor sequence is normal, but has polymorphisms. Neuropsychopharmacology 8: 13 1- 135 (1 993).

Oliver BI Bosch L. van Hest A, van der Heyden J, Mos J, van der Poe1 G, Schipper J, Tulip M. Preclinical evidence on the psychotropic profile of fluoxamine. Pharmacopsychiatry 26 (suppl 1): 2-9 (1993).

Orita M, Suzuki Y, Sekiya T, and Hayashi K. Rapid and Sensitive Detection of Point Mutations and DNA Polymorphisms Using the Polymerase Chain Reaction. Genomics 5: 874-879 (1 989).

Oto M, Miyake S, Yuasa Y, Optimization of Nonradioisotopic Single Strand Conformation Polymorphism Analysis with a Conventional Gel Electrophoresis Apparatus. Analytical Biochemistry 2 1 : 19-22 (1 993).

Ott L Analysis of Human Linkage. Revised Edition. The Johns Hopkins University Press. Baltimore (1 99 1 ).

Owens MJ. Nemeroff CB. Role of serotonin in the pathophysiology of depression: focus on the serotonin transporter. Clinicla Chemistry 40: 288-295 (1 994).

Patel PI. Invited Editorial: Quest for the elusive genetic basis of Tourette syndrome. Amencan Journal of Human Genetics 59: 980-982 (1 996).

Paterson A. Case-control association studies in cornplex traits-the end of an era? Molecular Psychiatry 2: 277-278 (1 997).

Pato CN, Macciardi F, Pato MT, Verga M, Kennedy JL. Review of the putative association of dopamine D2 receptor and dcoholisrn; a meta analysis. Amencan Journal of Medical Genetics. 48: 78-82 (1 993).

Pauls DL, Hurst CR, Kruger SD, Leckman JF, Kidd KK, Cohen DJ. Gilles de la Tourette's syndrome and attention deficit-hyperactivity disorder with hyperactivity. Evidence against a genetic relationship. Archives of General Psychiatry. 43: 1177-1 179 (1986).

Pauls DL, Leckrnan JF. The inheritance of Gilles de la Tourette's syndrome and associated behaviors. Evidence for an autosornai dominant transmission. New England Journal of Medicine. 3 15: 993-997 (1 986).

Pauls DL, Leckman IF, Raymond CL, Hurst CR, Stevenson JM. A family study of Tourette's syndrome: Evidence against the hypothsis of association with a wide range of psychiatric phenotypes. American Journal of Human Genetics 43: A64 (1988).

Pauls DL, Raymond CL, Stevenson JM. Leckrnan JF. A family shidy of Gilles de la Tourette syndrome 48: 154- 163 (1 99 1).

Persico AM, Vandenbergh DJ, Smith SS, Uhl GR. Dopamine transporter gene rnarkers are not associated with polysubstance abuse. Biological Psychiatry 34: 265-267 ( 1 993).

Peeico AM, Wang ZW, Black DW, Andreasen NC, Uhl GR, Crowe RR. Exclusion of close linkage of the dopamine transporter gene with schizophrenia s p e c t m disorders. Arnerican Journal of Psychiatry 152: 134- 136 (1995).

Peterson BS. Considerations of the natural history and pathology in the psychopharmacology of Tourette's syndrome. Clinical Psychiatry 57 (suppl9): 24-34 (1 996).

Peterson 1, Ohgaki H, Ludeke B, and Kleihues P (1 994). Direct DNA Sequencing Following SSCP Analysis. Analytical Biochemistry 2 18: 478-479 (1 994).

Petronis A, Kennedy JL. Unstable genes-unstable mind? Amencan Journal of Psychiatq 152:164-172 (1995).

Pugliese A, Zeller M, Femandez A, Zalcberg LJ, Bartlen RJ, Ricordi C, Pietropaolo M. Eisenbarth GS, Bennet ST, Patel DD. The insulin gene is transcribed in the hurnan thymus and transcription levels correlate with allelic variation at the I . VNTR- IDDMZ susceptibility locus for type 1 diabetes. Nature Genetics 15: 293-297 (1 997).

Rao PA, Pickar D, Gejman PV, Ram A, Gershon ES, Gelemter J. Alleleic variation in the D4 dopamine receptor (DRD4) gene does not predict response to clozapine. Archives of General Ps ychiatry 5 1 : 9 1 2-9 1 7 ( 1 994).

Rapoport .IL, Inoff-Germain G. Tourette's syndrome. Medical and surgical treatment of obsessive-compulsive disorder. Neurologic Clinics 15: 42 1-428 (1 997).

Rassnick S, Pulvirenti L, Koob GF (1992): Oral ethanol self-administration in rats is reduced by the administration of dopamine and glutamate receptor antagonists into the nucleus accumbens. Psychopharmacology 109: 92-98 ( 1992).

Riddle MA, Leckrnan SF, Hardin MT. Fluoxetine treatment of obsessions and compulsions in patients with Tourette's syndrome. Amencan Journal of Psychiatry 145: 1 173-1 174 (1988).

Ritz MC, Mantione CR, London ED. Spermine interacts with cocaine binding sites on dopamine receptors. Psychopharmacology 1 14: 47-52 (1994).

Robbins LN, Helzer J, Croughan J, Ratclif KS. National Institute of Health diagnostic interview schedule. Archives of General Psychiatry 38: 3 8 1-389 (1 98 1).

Robertson MM. D2 or not to be? Nature Medicine 2: 1076-1 077 (1 996).

Samson HH. Hodge CW, Tolliver GA, Haraguchi M. Effect of dopamine agonists and antagonists on ethano 1 reinforced behavior, the involvement of the nucleus accumbens. Brain Research Bulletin 30: 133- 14 1 (1 993).

Santangelo SL, Pauls DL, Goldstein JM, Faraone SV, Tsuang MT, Leckrnan JF. Tourette's syndrome: what are the influences of gender and comorbid obsessive compulsive disorder. Journai of the Arnerican academy of child and adolescent psychiatry 33: 795-804 (1 994).

Schuerholz LJ, Baumgardner TL. Singer HS, Reiss AL, Denckla MB. Neuropsychological status of children with Tourette's syndrome with and without attention deficit-hyperactivity disorder. Neurology 46: 958-965 (1 996).

Seeman P, Corbett R Van Tol HH. Atypical neuroleptics have low afinity for dopamine D2 receptors or are selective for D4 receptors. Neuropsychopharmacology 16:93- 1 1 O ( 1997).

Seeman P, Ni& HB, Guan H-C, Booth G, Ulpian C. Link between D l and D2 dopamine receptors is reduced in schizophrenia and Huntington's diseased brain. Proceedings of the National Academy of Sciences USA 86: 10 156-10 160 (1 989).

Seeman P, Tailenco T, Corbett R, Van Toi HH, Karnboj RK. Role of dopamine D2, D4 and serotonin (2A) receptors in antipsychotic and anticateleptic action. Journal of Psychopharmacology 1 1 : 15- 17 (1 997).

Seeman P, Van Tol HHM. Dopamine receptor pharmacology. Curent Opinion in Neurology and Neurosurgery 6: 602-608 (1 993).

Shah M. Coon H, Holik .J. Helmer V. Panos PI Byerley W. Mutation scan of the Dl dopamine receptor gene in 22 cases of bipolar 1 disorder. Amencan j o u d of Medical Genetics 60: 150- 153 (1 995).

Sheffield VC, Beck JS. Kwitek AWI Sandstom DK. Stone EM. The sensitivity of single- manded conformational polymorphism analysis for the detection of single base substitutions. Genomics 16: 325-332 (1 993).

Sibley D R ~Monsma FJ. S harn Y. Molecular neurobiology of dopamine receptors. International Review of Neurobiology 35: 39 1 4 1 5 ( 1992).

Silva RR. Munoz DM. Dniel W9 Barickman J. Friedhoff Al. C a w s of haioperidol discontinuation in patients with Tourette3 disorder: management and alternatives. Journal of Clinical Psychiatry 57: 129-1 35 (1996).

Singer HS Reiss AL. Brown JE. Aylward EH. Shih B. Chee B. Harris EL. Reader MJ. Chase GA. Bryan RN. Volumetric MRi changes in basal ganglia of children with Tourette's syndrome. Neurology 43 : 950-956 ( 1993).

Singer HS. Hahn 1-H. Moran T. Abnormal Dopamine Uptake Sites in Postmonem striahm from patients uith Tourette's syndrome. Amak of Neurology 3 0: 538-562 ( 1 99 1 ).

Stanley D. Tourette's disorder: a cross-cultural review. Comprehensive P s y c h i a ~ 38: 6- 16 ( 1 997).

Stein DJ. Bouwer C. Hawkridge S. Emsley M. Risperidone augmantation of serotonin reuptake inhibitors in obsessive compulsive disorders. Journal of Clinical Psychiatry 58: 119-122 (1997).

Stober G. Nothen MM. Porzgen P. Bruss M, Bonisch H. Knapp M. Beckmann H. Propping P. Systematic search for variation in the human norepinephnne transporter gene: Identification of five naturally occuring missense mutations and study of association with major psychiatnv disorders. Arnerican Journal of Medical Genetics 67: 535-532 (1 996).

Strange P. New insights into dopamine receptors in the C M . Neurochemim International 22: 223-23 1 ( 1 993).

Sunahara RK. hliznik HB, Weiner DM. Stormann M, Brann MR. Kennedy IL. Gelemter JE, Romahel R Yang Y, Israel Y. Seernan P. O'Dowd B F. Human dopamine receptor encoded by an intronless gene on chromosome 5. Nature 347: 80-83 ( 1 990).

Sunahara RK, Guan HC, O'Dowd BF, Seeman P. Laurier LG, Ng G. George SR Torcha J, Van TOI HH, Ni& HB. Clonhg of the gene for a hurnan dopamine D5 receptor with higher &nity for dopamine than D 1. Nature 350: 6 14-6 1 9 ( 1 99 1 ).

Swedo SE, Leonard HL Childhood rnovement disorders and obsessive compulsive disorder. Journal of Clinical Psychiatry 55 (3Suppl): 32-3 7 (1 994).

Tenvilliger ID, On J. Handbook of Human Linkage. The Johns Hopkins University Press, Baltimore ( 1 994).

Tenvilliger JD, On J Handbook of Hurnan Linkage. The Johns Hopkins University Press, Baltimore (1 994).

Tiihonen J. Kuikka J, Bergstrom K. Hakola P. Karhu JI Ryynanen O-P. Fohr J. Altered striatal dopamine re-uptake site densities in habihially violent and non-violent alcoholics. Nature Medicine 1 : 654-657 (1 995).

Uhl GR. Parkinson's Disease: Neurotransmitter and Neurotoxin recepton and their genes. European Journal of Neurology 30(suppl 1 ): 2 1-30 (1 990).

lihlenhuth EH, Bdter MB, Ban TA, Yang K. International study of expert judgment on therapeutic use of benzodiazepines and other psychotherapeutic medications: III. Clinical features affecting experts' therpeutic recornrnendations in anviety disorders. Psychopharmacology Bulletin. 3 1 : 289-296 (1 995).

Van TOI HHM, Wu CM, Guan H-C. Ohara K. Bunzow JR. CiveIli O. Kennedy J. Seeman P. Nimik HB. Jovanic V. Multiple dopamine D4 receptor varients in the human population. Nature 358: 149-1 52 (1992).

Vandenbergh DJ, Persico AM. Hawkins AL. Griffin CA, Li X. Jabs EW and Uhl GR. Human Dopamine Transporter Gene (DAT 1 ) Maps to Chromosome 5p 1 5.3 and DispIays a VNTR. Genomics 14: 1 104- 1 1 O6 ( 1992).

Vandenbergh DJ. Persico AM, Ulh GR. A hurnan Dopamine Transporter cDNA predicts reduced glycosylation. displays a novel repetitive element and provides racially- dimorphic Taql RFLPs. Brain Research (Molecular Brain Research) 1 5 : 1 6 1 - 1 66 (1992).

Volkow ND, Ding Y-S. Fowler JS, Wang G J , Logan J. Gatley J. Schlyer DJ. Pappas N. A new PET ligand for the dopamine transporter: studies in human brain. The Journal of NucIear Medicine 36: 2 162-2 168 (1 995).

Volkow ND, Ding Y-S, Fowler JS, Wang G-J. Logan J. Gatley JS, Dewey S. Ashby C, Liebermm J, Hitniann R, Wolf AP. 1s methylphenidate like cocaine. Archives of General Psychiatry 52: 456463 (1 995).

Volkow ND, Wang GJ, Fowler JS, Logan J, Hitzemann R, Ding Y-S, Pappas N, Shea C. Piscani K. Decreases in dopamine receptors but not in dopamine transporters in alcoholics. Alcohol Clinical and Expenmental Research 20: 1594- 1598 (1 996).

W&p JT, LaBuda MC, Singer HS, Brown J, Riddle MA, Hurko O. Family study and segregation analysis of Tourette syndrome: evidence for a mixed mode1 of inheritance. American Journal of Human Genetics 59: 684-693 ( 1 996).

Weghorst CM. Enhanced Single-Stranded Conformational Polymorphism (SSCP) Detection of Point Mutations Utilizing Methylmurcury Hydroxide. BioTechniques 15: 397-399 (1 993).

Weiner DM, Levy AI, Sunahara RK, Nimik HB, O'Dowd BF, Seeman P, Brann MR. D 1 and D2 dopamine receptor mRNA in rat brain. Proceedings of the National Academy of Sciences of the United States of Arnerica 88: 1859-1863 (199 1 ).

Weiss F, Mitchener M. Bloom FE, Koob GF. Free-choice responding for ethano1 versus water in alcohol prefemng (P) and unselected Wistar rats is differentially modifird by naiaxone, bromocriptine and methylsergide. Psychopharmacology 10 1 : 178- 186 (1 990).

Wilson JM, Levey AI, Bergman C, Kalasinsky K, h g L, Perette F, Adams VI, Smialk J. Anderson WR, Shannak K, Deek J, Ni& HB, Kish SJ. Striatal dopamine, dopamine transporter, and viscicular monoamine transporter in chronic cociane users. Annals of Neurology 40: 428-439 (1996).

Wise RA. Catecholamine theories of reward. Brain Research 152: 2 15-2 17 (1 980).

Wise RA, Rompre PP. Brain dopamine and reward. Annual Review of Psychology 40: 19 1-225 (1 989).

Wong DF, Singer HS, Brandt J, Shaya E, Chen C, Brown J, Kimball AW, Gjedde A, Dannais RF, Ravert HT, Wilson PD, Wagner HN. D2-like dopamine receptor density in Tourette's syndrome measured by PET. Journal of Nuclear Medicine 28: 1243-1247 (1997).

van den Ouweland AM, Dreesen JC, Verdijk M, Knoers W , Monnens LA, Rocchi M, van Oost BA. Mutations in the vassopressin type 2 receptor gene (AVPR2) associated with nephrogenic diabetes insipidus. Nature Genetics 2: 99- 102 ( 1992).

Wolf SS, Jones DW, Knable MB, Gorey JG, Lee KS, Hyde TM, Coppola R, Weinberger DR. Tourette Syndrome: Prediction of Phenotypic Variation in Monozygotic Twins by Caudate Nucleus D2 Receptor Binding. Science 273: t 225-1 227 (1996).

Yamamoto S, Sippel KC, Berson EL, Dryja. Defects in the rhodopsin h a s e gene in the Oguchi fom of stationary night blindness. Nature genetics. 1 5: 1 75- 1 78 ( 1997).

Zastawny RL, George SR, Bouvier M, O'Dowd BF. Adrenergic and related G protein- coupled receptors. Encyclopedia of Human Biology 1 : 145-1 55 (1 997).

IMAGE EVALUATION TEST TARGET (QA-3)

APPLIED I W G E , lnc - 1653 East Main Street - -. - - Rochester. NY 14609 USA -- -- - - Phone: 71 6/42-0300 -- -- - - Fa: 71 61288-5989