Murine Endothelial Cell Lines as Models of Tumor ...tumor endothelial cell markers, the murine...

Murine Endothelial Cell Lines as Models of TumorEndothelial Cells

Jennifer Walter-Yohrling, Sharon Morgenbesser,Cecile Rouleau, Rebecca Bagley,Michelle Callahan, William Weber, andBeverly A. TeicherGenzyme Corporation, Framingham, Massachusetts

ABSTRACTIdentification of appropriate models for in vivo and in

vitro preclinical testing of inhibitors of tumor angiogenesisand progression is vital to the successful development ofanticancer therapeutics. Although the focus is on humanmolecular targets, most preclinical in vivo efficacy testingoccurs in mice. The goal of the current studies was toidentify a murine endothelial cell line to model tumor endo-thelium for studying the antiangiogenic activity of therapeu-tic compounds in vitro. In situ hybridization was performedon three s.c. grown syngeneic murine tumors (B16 mela-noma, Lewis lung carcinoma, and CT26 colon carcinoma) toassess expression of murine homologs of human tumor en-dothelial cell markers in the vasculature of these tumormodels. Seven murine endothelial cell lines were character-ized for expression of the murine homologs of recognizedendothelial cell surface markers as well as for tumor endo-thelial cell surface markers. The seven murine endothelialcell lines had similar generation times and five of the sevenlines were able to form tubes on Matrigel. Real-time-PCRand flow cytometry analysis were used to evaluate relativemRNA and protein expression of murine homologs of sev-eral recognized endothelial cell surface markers in the sevencell lines. The expression of the mRNA for the murinehomologs of five tumor endothelial cell surface markers wasalso evaluated. The 2H11 cell line expressed all five of thetumor endothelial cell surface markers as well as severalwell-recognized endothelial cells markers. The 2H11 cell lineresponds to known and novel antiangiogenic agents by in-hibition of proliferation and tube formation. These cells canbe used in in vitro angiogenesis assays for evaluating thepotential antiangiogenic properties and interspecies cross-reactivity of novel compounds.

INTRODUCTIONThe mouse has become the critical host organism for the

discovery and development of modern cancer therapeutics.However, it is important that we understand the strengths andlimitations of mouse models of malignant disease (1). The mostfrequently used murine models are transplantable syngeneic orxenograft tumors and transgenic mice that develop autologoustumor nodules during their lifetimes. These models allow thestudy of biological processes associated with tumor growth,including the tumor-host interactions with murine stromal cells.

The abnormality of tumor vasculature has been studiedextensively in mouse models. Modzelewski et al. (2) isolatedand characterized fresh tumor-derived endothelial cells from thesyngeneic RIF-1 fibrosarcoma. The dynamics of blood vesselgrowth, structure, cellular composition and gene expressionhave been followed using the murine syngeneic mammaryMCaIV adenocarcinoma, the murine syngeneic Lewis lung car-cinoma, and the murine transgenic RIP-Tag2 pancreatic isletcell tumor (3–5). The mobilization of bone marrow progenitorcells to circulation, the maturation of these cells into endothelialprecursor cells, and the incorporation of the endothelial precur-sor cells from circulation into tumor vasculature has been elu-cidated largely in mice (6–14). These studies used murinesyngeneic tumors, human tumor and bone marrow xenografts inimmunodeficient mice and genetically engineered mice, andhave been used to recapitulate the dynamics of processes ob-served in human patients.

Cancer therapeutics has moved away from general prolif-eration-related targets such as DNA and tubulin toward morenontraditional pathological processes including angiogenesis orimmunomodulation, as well as more selective molecular targets.In most cases, efficacy in mouse models remains the criticaldeterminant of whether a potential therapeutic moves into de-velopment in clinical trials. However, it has become evident thatthe homology between the murine and human proteins of spe-cific molecular targets is, frequently, not sufficient to depend onefficacy of agents selected for the murine target to translate intohighly effective therapy in the human clinic. This is mostevident in the selection of monoclonal antibodies where it is hasbecome necessary to develop monoclonal antibodies to themurine homologue of the human target (11). Therefore, mouseand human agents need to be developed in parallel, so that thetumor-bearing mouse remains the critical efficacy hurdle. Like-wise, it is important to define cell-based models of murine tumorendothelial cells that can be used to evaluate potential therapeu-tics in cell culture to select those most appropriate for in vivotesting.

The isolation and maintenance of a pure population ofprimary murine endothelial cells has proven to be difficult andhas restricted the use of these cells in angiogenesis assay sys-tems. To overcome these barriers, several groups have generatedmurine endothelial cell lines from cells isolated from the axil-

Received 7/9/03; revised 12/1/03; accepted 12/05/03.The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.Requests for reprints: Beverly A. Teicher, Genzyme Corporation, 1Mountain Road, Framingham, MA 01701, Phone: (508) 271-2843,FAX: (508) 620-1203, E-mail: [email protected].

2179Vol. 10, 2179–2189, March 15, 2004 Clinical Cancer Research

Cancer Research. on November 3, 2020. © 2004 American Association forclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

lary lymph node (15–17), embryonic yolk saks (6), and aorta,brain, and heart capillaries (18). In selecting the appropriatemurine in vitro model of tumor endothelial cells, it is ideal toidentify a murine endothelial cell line that maintains the expres-sion of traditional endothelial cell markers as well as markersfound to be expressed by human tumor endothelial cells (19,20). Thus, in the process of targeted antiangiogenic drug dis-covery, having identified cell-based models expressing the hu-man target and cell-based models expressing the murine targetallows comparison of the sensitivity of the human and mousetargets to therapeutic candidates and allows an informed deci-sion to be made regarding selection of therapeutic candidates fortesting in in vivo models with murine vasculature.

O’Connell et al. (15–17) generated several murine endo-thelial cell lines from endothelial cells isolated from axillary andinguinal lymph nodes of adult C3H/HeJ mice and transformedthe cells using SV40. When implanted in mice, these immor-talized endothelial cells produced nodules that displayed thecharacteristics of Kaposi’s sarcoma, a multifocal malignant neo-plasm consisting of spindle cells and believed to be derivedfrom endothelial cells. The SVEC4–10EE2 cell line was de-rived from the parent SVEC4–10 cell line by the extraction oftumors generated after the injection of the parent cell line innude mice. These cells were then sub-cloned using conditionedmedium from SVEC4–10EE2 to isolate a slower growing mu-rine endothelial cell line designated SVEC4–10EHR1. IP2E4and 3B11 cell lines were sub-cloned from ascites fluid generatedin mice that received implantation with SVEC4–10EHR1 cells.The 2H11 cell line was sub-cloned from a nodular spindle-liketumor derived from the SVEC4–10EHR1 cell line. The 2F2Bcell line was developed from a lobular cutaneous tumor result-ing from the implantation of SVEC4–10EE2 cells. Each of theseven murine endothelial cell lines has distinctive cellular mor-phology as well as different endothelial cell characteristics,including the expression of von Willebrand factor/Factor VIII,the incorporation of acetylated low-density lipoprotein, the up-regulation of class II MHC expression in response to IFN�, andthe formation of tubular networks on Matrigel (15–17).

There are several markers that have proven useful foridentifying endothelial cells in situ and in vitro, including plate-let endothelial cell adhesion molecule-1/CD31, von Willebrandfactor, P1H12, and vascular endothelial growth factor receptor 2(VEGFR2; Refs. 21–24). These cell surface proteins have tis-

sue-type and vasculature-specific expression patterns. Recently,several novel markers have been identified that are specific forhuman tumor endothelial cells (TEM; 19). The TEM expressionpattern for the murine homologue of several of these markerswas determined in murine B16 melanoma and human HCT116colon carcinoma xenografts by in situ hybridization (20). Thesemarkers provide criteria for identification of appropriate murineendothelial cells for studying tumor endothelial properties.

The goal of these studies was to identify by the behavior,as well as the mRNA and protein expression of normal andtumor endothelial cell markers, the murine endothelial cellline(s) that is the most appropriate model of tumor endotheliumfor in vitro study of the biology of tumor angiogenesis.

MATERIALS AND METHODSChemicals. Murine endothelial cell lines, SVEC4–10,

SVEC4–10EE2, SVEC4–10EHR1, 2F2B, 2H11, IP1B, andIP2-E4, were purchased from American Type Culture Collec-tion (Manassas, VA). Human dermal neonatal microvascularendothelial cells (HMVEC) and EGM2-MV were obtained fromCambrex (East Rutherford, NJ). Cell culture media, versene,and fetal bovine serum (FBS) were purchased from InvitrogenCorp. (Carlsbad, CA). Primary antibodies against endothelialcell markers were purchased from PharMingen (San Diego, CA)and Chemicon (Temecula, CA; Table 1). Phycoerythrin andfluorescein-conjugated secondary antibodies were obtainedfrom Jackson ImmunoResearch Laboratories (West Grove, PA).PCR primers that recognize the human and mouse gene werepurchased from Integrated DNA Technologies (Coralville, IA).Trizol was purchased from Sigma (St. Louis, MO), and the RNAExtraction Kit was obtained from Qiagen (Valencia, CA). TheHigh-Capacity cDNA Archive Kit, Taqman rRNA Control Re-agents, Taqman Universal PCR Master Mix, and Sybr GreenPCR Master Mix were purchased from Applied Biosystems(Foster City, CA). Cell Titer Glo was purchased from Promega(Madison, WI).

Cell Culture. The murine endothelial cell lines 2F2B,2H11, 3B11, IP2E4, SVEC4–10, SVEC4–10EE2, and SVEC4–10EHR1 were maintained in DMEM plus 10% fetal bovineserum in a humidified 10% CO2 environment. HMVECs weremaintained in EGM2-MV that includes 5% FBS, vascular en-dothelial growth factor (VEGF), basic fibroblast growth factor,

Table 1 List of endothelial cell markers studied, the antibody used for FACSa analysis, and primer sequences for mRNA expression analysis

EC marker Antibody Forward primer Reverse primer

CD34/sialoucin Pharmingen cat. 553731 gaagacccttattacacgga gctgaatggccgtttctCD36/GPIIIb Chemicon cat. MAB1258 N/A N/ACD105/endoglin Pharmingen cat. 550546 cagcaagcgggagcccgtggt ggtgctctgggtgctcccgatENDRB N/A gcagaggactggccatttgga gcaacagctcgatatctgtcaatactP1H12/CD146 Chemicon cat. MAB16985 N/A N/ATie1 N/A tggagatagtgagccttgga cagtttcgaggctgctccatgcgTie2 Chemicon cat. MAB1148 gagattgttagcttaggaggcac gtctcattagatcatacacctcatcatVCAM1/CD106 Pharmingen cat. 553330 gacctgttccagcgagggtcta cttccatcctcatagcaattaaggtggVEGFR1 N/A ctgggagcctgcacgaagcaa gtcacgtttgctcttgaggtagtVEGFR2 Pharmingen cat. 555308 gcagacagaaatacgtttgagttgg agtgattgccccatgtgga

FACS, fluorescence-activated cell sorter; EC, endothelial cell; ENDRB, endothelin-B receptor; VCAM, vascular cellular adhesion molecule;VEGFR, vascular endothelial growth factor receptor; cat., catalogue number.

2180 Mouse Model of In Vitro Angiogenesis



epidermal growth factor, and insulin-like growth factor, in ahumidified 5% CO2 atmosphere.

Generation Time and Proliferation. To determine cel-lular growth rates, cells from each of the seven murine endo-thelial cell lines (2 � 103) were placed in each well of a 96-wellplate in DMEM supplemented with 0, 2, 5 or 10% FBS. Thecells were collected after 24, 48, 72, and 96 h using Cell TiterGlo and extrapolating cell number from a standard curve foreach cell line. Generation time was calculated by applying anexponential curve fit to the cell number values and calculatingthe time required for the cell number to double. For proliferationexperiments, cells were exposed to each agent for 48 h, and cellnumbers were determined as described above.

In Vitro Tube Formation. Matrigel (BD Biosciences)was added to the wells of a 48-well plate in a volume of 120 �land allowed to solidify at 37°C for 30 min. After the Matrigelsolidified, cells from each of the seven murine endothelial celllines (2 � 104 cells) were added in 200 �l of DMEM supple-mented with 10% FBS. The cells were incubated at 37°C withhumidified 95% air/5% CO2 for 5 h in the presence or absenceof a potential inhibitor.

Quantitative PCR. A confluent T75 flask of cells washarvested and lysed using Trizol. RNA was isolated by phenolchloroform extraction followed by column isolation using theQiagen RNA Extraction Kit. cDNA was generated using theHigh Capacity cDNA Archive Kit. Real-time-PCR for normalendothelial cell markers was performed with Sybr Green PCRMaster Mix using the primers listed in Table 1 on an ABI Prism7700 Sequence Detection System (Applied Biosystems). Rela-tive mRNA expression of normal endothelial cell markers wasdetermined by the �-delta Ct method where the cycle threshold(Ct) of the sample is subtracted by the Ct of 18S and comparedwith the reference expression by HMVEC. Expression of thetumor endothelial cell markers was determined using FAM-labeled probes and Taqman Universal PCR Master Mix, expres-sion was normalized to 18S and compared with the referenceexpression by 2H11 cells.

Flow Cytometry Analysis. Cells were suspended by ex-posure to versene and 0.005% trypsin and then washed withPBS containing 5% FBS. Cells from each of the seven murineendothelial lines (2 � 105) were incubated with 1 �g of primaryantibody diluted in PBS containing 5% FBS in 100 �l totalvolume for 1 h. The cells were washed twice in PBS containing5% FBS and incubated with a 1:50 dilution of the appropriatefluorescently conjugated secondary antibody for 1 h. Sampleswere analyzed using an FACSCaliber flow cytometer (BectonDickinson, Franklin Lakes, NJ). The results were compared withappropriate isotype controls. Positive expression was deter-mined by dividing the number of cells stained with the antibodyby the total number of cells assayed multiplied by 100 (percent-positive cells). Each determination was based on 10,000 events.

In Situ Hybridization. Briefly, cDNA fragments weregenerated by PCR amplification of fragments ranging from 200to 650 bp, using primers with T7 promoters incorporated intothe antisense primers (19, 20). Digoxigenin riboprobes weregenerated by in vitro transcription in the presence of digoxige-nin, according to manufacturer’s instructions (Roche, Indianap-olis, IN). Murine syngeneic tumors, B16 melanoma, Lewis lungcarcinoma, and CT-26 colon carcinoma grown s.c. were har-

vested and prepared as formalin-fixed, paraffin-embedded 3–5�m sections on slides. All treatments were carried out at roomtemperature, unless otherwise stated. Sections were deparaf-finized in xylene, washed in 100% ethanol, then hydrated in 85,75, and 50% ethanol in distilled water. After incubation indiethyl pyrocarbonate-treated water (Quality Biological, Inc.,Gaitherburg, MD), sections were permeabilized by treatmentwith pepsin in 0.2 N hydrochloric acid, washed briefly in PBS,then fixed in 4% paraformaldehyde. Sections were acetylated inacetic anhydride/0.1 M triethanolamine (pH 8.0), equilibrated for10 min in 5� SSC [3 M sodium chloride, 0.3 M sodium citrate(pH 7.0); Invitrogen], and prehybridized for 1 to 2 h at 55°C inmRNA hybridization buffer (DAKO, Carpinteria, CA). Sectionswere hybridized with digoxigenin riboprobes (100–200 ng/ml)in mRNA hybridization buffer (DAKO) overnight at 55°C.After removing unbound riboprobes by washing, sections wereincubated with RNase (Ambion, Austin, TX) to remove anynonspecific-bound riboprobe. Sections were treated with perox-idase block (DAKO) to eliminate any endogenous peroxidase,then blocked with a 1% blocking reagent (DIG nucleic aciddetection kit; Roche), containing rabbit immunoglobulin frac-tion (DAKO), in Tris buffered saline. Rabbit antidigoxigenin-horseradish peroxidase (DAKO) was used to detect the ribo-probes and served to catalyze the deposition of biotinylatedtyramide (Gen-Point, DAKO) according to manufacturer’s in-structions. Additional amplification was accomplished throughadditional rounds of strept-av-horseradish peroxidase (Gen-Point, DAKO) and biotinylated tyramide. Final detection wasaccomplished through rabbit antibiotin conjugated to alkalinephosphatase (DAKO). Alkaline phosphatase was detected withFast Red (DAKO) for 10–60 min at RT, then counterstained inhematoxylin. The nuclei were blued with ammonium hydroxidefor 30 s, then mounted with crystal-mount (BioMeda, FosterCity, CA). For the negative control, sense riboprobes were usedto detect any nonspecific sequences. Additionally, a slide thatwas exposed to RNase to destroy the mRNA was hybridizedwith the antisense riboprobe to detect any nonspecific hybrid-ization.

RESULTSIn situ hybridization was performed on tissue sections of

three murine syngeneic tumors, B16 melanoma, Lewis lungcarcinoma, and CT-26 colon carcinoma grown s.c. in the ap-propriate hosts to determine the mRNA expression of the mu-rine homologs of the known endothelial cell marker, VEGFR2,and the murine homologs of several tumor endothelial cellmarkers in the intratumoral vessels. The tumor endothelial cellswere found to express VEGFR2 as well as murine (m)TEM1,mTEM3, mTEM5, and mTEM8 in all three in vivo mousemodels of tumor vasculature as was previously shown by Car-son-Walter et al. (Ref. 20; Fig. 1). Like Carson-Walter et al., wefound that the B16 melanoma was negative for mTEM7; how-ever, this marker was expressed by the vasculature of both theLewis lung carcinoma and the CT26 colon carcinoma. Theconfirmation that the murine homologs of several markers iden-tified in endothelial cells isolated from human tumors are ex-pressed in these transplantable murine syngeneic tumor modelsvalidates their use in the study of tumor endothelial biology and

2181Clinical Cancer Research



Fig. 1 In situ hybridization of the following s.c. grown syngeneic mouse tumors: B16 melanoma, Lewis lung carcinoma, and CT-26 colon carcinoma.Tissue sections (5 �m) of each tumor were stained with hematoxylin and exposed to riboprobes for mouse vascular endothelial growth factor receptor2 (VEGFR2), murine tumor endothelial cell (mTEM) 1, mTEM 7 (A), and mTEM 8, mTEM 9, and mTEM 3 (B) and visualized by amplification withfast red chromagen. Images were taken at �20 magnification. LLC, Lewis lung carcinoma.




provides guidance for selection of murine endothelial cell linesthat would be appropriate models for tumor angiogenesis in cellculture.

The generation times for each of the seven murine endo-thelial cell lines 2H11, 2F2B, 3B11, IP2E4, SVEC4–10,SVEC4–10EE2, and SVEC4–10EHR1 were determined (Fig.2). The effect of serum on the proliferation of each cell line wasassessed at concentrations of 2, 5, and 10% FBS. Cell numberwas determined at 24, 48, 72, and 96 h using standard curvesderived from a metabolic luminescent end point. The effect ofserum concentration on the cellular proliferation was smallexcept with the slower growing SVEC4–10EHR1 cells withgeneration time increased 1.8-fold when the cells were grown atthe lowest serum concentration. In general the primary deriva-tive cell lines, SVEC4–10EE2 and SVEC4–10EHR1, from theparental SVEC4–10 line were slower growing than the second-ary derivative lines, 2F2B, 2H11, 3B11, and IP2E4. The cell linewith the shortest doubling time was the 2H11 cells with ageneration time of 18.7 h at a serum concentration of 10% FBSand a generation time of 23.8 h at a serum concentration of 2%FBS.

The assembly of cells into tubes/networks on a layer ofextracellular matrix components is characteristic of endothelialcells in culture. The capability of each of the seven murineendothelial cell lines to assemble into tubes/networks was as-sessed in a tube formation assay on a layer of Matrigel over a 5 hperiod (Fig. 3). The parental cell line SVEC4–10 was capable oftube formation. Neither one of the initial derivative lines,SVEC4–10EE2 or SVEC4–10EHR1, were able to form tubeson Matrigel. The second derivative line, 2F2B, that was derivedfrom the SVEC4–10EE2 was able to form tubes on Matrigel,and each of the lines derived from the SVEC4–10EHR1 cellswere also active in the tube formation assay.

The mRNA expression of the murine homologs of recog-nized cell surface endothelial cell markers in each of the sevenmurine endothelial cell lines was compared with the expressionof the same marker in primary HMVEC using primers thatrecognized both murine and human mRNAs (Fig. 4). ThemRNA expression of each marker in the murine endothelial celllines is represented as the expression relative to HMVECs. Theexpression of VEGFR2, VEGFR1, and Tie1 by the murineendothelial cells was similar to the expression in HMVEC. ThemRNA for endgolin/CD105 and endothelin receptor B wasfound at much lower levels in the murine cell lines than inHMVEC, and the mRNA for sialomucin/CD34 was found atmuch higher levels in the murine endothelial cells than inHMVEC. The SVEC4–10 parent cell line expressed VEGFR1,VEGFR2, endothelin receptor B, and Tie1 but not endoglin/CD105 or sialomucin/CD34. The first derivative cell lines,SVEC4–10EE2 and SVEC4–10EHR1, had similar mRNA ex-pression patterns to the parental cell line except that expressionof VEGFR1 is markedly decreased, and expression of endoglin/CD105 is increased in the SVEC4–10EE2 cells. The 2F2B cellline that was derived from the SVEC4–10EE2 cells also hasdecreased expression of VEGFR1 mRNA relative to the othermurine endothelial cell lines. Only the 2H11 cell line and thetwo lines derived from ascites, 3B11 and IP2E4, expressed allsix of the cell surface endothelial cell markers.

Because the goal is to identify a murine endothelial cellline that could be useful as a model for tumor endothelial cells,the mRNA expression of cell surface markers predicted to beselective for tumor endothelial cells was evaluated (Fig. 5). Theexpression of the mouse homologs of five tumor endothelialmarkers identified in endothelial cells isolated from humancolon carcinoma was determined in six murine endothelial celllines, and values are relative to the expression in 2H11 cells.

Fig. 2 Generation times foreach of the seven murine endo-thelial cell lines at three concen-trations of fetal bovine serum(FBS; 2, 5, and 10%) determinedover a 96 h period. Generationtimes (h) were calculated by ap-plying an exponential curve fit tothe growth curve data and extrap-olating cell number doublingtime in the presence of each se-rum concentration. The data arethe means and SD of three inde-pendent experiments.




Overall, the 2H11 cell line was the highest expressor of thesemarkers. The two lines derived from ascites, 3B11 and IP2E4,were also good expressors of all of the markers. The relatedlines SVEC4–10EE2 and 2F2B had variable expression of themarkers and were particularly low expressors of mTEM7 andmTEM1. On the basis of this analysis, the murine 2H11 endo-thelial cell line appeared to be the most promising model fortumor endothelial cells.

Antibodies specific for the murine homologs for severalrecognized endothelial cell surface proteins are available. Thecell surface expression of five endothelial cell markers wasassessed for the seven murine endothelial cell lines and, usinghuman specific antibodies, for HMVEC, by flow cytometry(Table 2). As might be expected from the mRNA expressionresults, none of the seven murine endothelial cell lines expressedendoglin/CD105, although HMVEC had strong expression ofthe endoglin protein. Three of the murine endothelial cell lines,2H11, 3B11 and IP2E4, expressed sialomucin/CD34 protein aswas reflected by the mRNA expression in these same three celllines. All of the murine endothelial cells had some expression ofgPIIIB/CD36. Only the 2H11 cell line expressed P1H12/CD146. Although all of the murine endothelial cell lines ex-pressed vascular cellular adhesion molecule 1 (VCAM1)/CD106, the expression level for VCAM1 by the 2H11 andSVEC4–10EHR1 cell lines was most similar to that of theHMVEC.

The 2H11 mouse endothelial cell line has been tested in

standard endothelial cell functional assays. In a proliferationassay, 2H11 cells were exposed to a control anti-2,4-dinitrophe-nol antibody or to an anti-TEM antibody at a concentration of100 �g/ml or were exposed to SU5416 (10 or 50 �M) for 48 h(Fig. 6). Although neither antibody altered the proliferation ofthe 2H11 cells, SU5416 inhibited proliferation in a concentra-tion-dependent manner. The 2H11 cells form tubes in 4 to 5 h ona Matrigel surface. Exposure of the cells to SU5416 (50 �M)during that time was able to disrupt tube formation (Fig. 6).Exposure of the cells to anti-TEM antibody also disrupted tubeformation although exposure to the control anti-2,4-dinitrophe-nol antibody did not.

DISCUSSIONThe identification of a murine endothelial cell line that has

tumor endothelial marker expression is important for the appro-priate analysis of tumor angiogenesis and potential antiangio-genic anticancer strategies in vitro. These experiments haveidentified the 2H11 immortalized murine endothelial cells to bea relevant murine model for tumor endothelial cells because2H11 cells express many of the murine homologs of standardendothelial cell markers, including sialomucin/CD34, GPIIIB/CD36, endogolin/CD105, P1H12/CD146, and VCAM1/CD106,as well as several murine homologs of tumor endothelial mark-ers. Like normal endothelial cells, the 2H11 cells will form acellular network when grown on extracellular matrices.

Fig. 3 Inverted, phase microscope images of each of the seven murine endothelial cell lines (2 � 104 cells/well) in a tube formation assay on a thicklayer of Matrigel for 5 h at 37°C.




The variety of endothelial cell markers that were studiedrepresent many aspects of endothelial cell function, but not allare specific for endothelial cells. Platelet endothelial cell adhe-sion molecule-1/CD31 is also expressed by platelets, mono-cytes, neutrophils and selected T-cell subsets. The platelet en-dothelial cell adhesion molecule-1/CD31 protein plays a majorrole in the cell-cell interactions of endothelial cells and is widelyaccepted as a pan-endothelial marker of all types of endothelialcells (21, 22). Sialomucin/CD34 also participates in cell-cellinteractions by playing a role in adherens junction formation andis primarily expressed by the tumor neovasculature (23).GPIIIB/CD36 expression has been identified on human dermalmicrovascular endothelial cells as well as other nonendothelialcell types, including platelets and monocytes (24). The GPIIIBglycoprotein binds to extracellular matrix proteins includingthrombospondin and collagen (25, 26) and is believed to play arole in the vascular complications associated with malaria (27).Endoglin/CD105 is related to the transforming growth factor-�type III receptor and has been found to be expressed by endo-thelial cells (28). It has been shown that endoglin/CD105 playsa role in normal vascular architecture and has been found to beelevated in tumor endothelial cells in some systems (29, 30).Using antibodies selective for endothelin receptor B, Shetty et

al. (31) found this receptor on the surface of vascular endothelialand smooth muscle cells and defined its role in mediatingvasoregulatory activity. P1H12/CD146 is involved in calcium-independent homotypic microvascular endothelial cell adhesionand has become a widely used marker for microvascular endo-thelial cells (19, 32, 33). Tie1 and Tie2 are tyrosine kinasereceptors for angiopoietin 1 and 2 believed to be specificallyexpressed on endothelial cells. The angiopoietin/Tie1 and Tie2pathways are involved in embryonic and tumor angiogenesismediating endothelial cell motility and recruitment of peri-endothelial cells (34–37). The adhesion molecule, VCAM-1/CD106, has been used as a marker for endothelial cells. In somesystems, levels of VCAM-1 correlate with vascular injury andtumor progression (33, 38–40). The VEGF pathway includingVEGF and the receptors, VEGFR1 (flt-1) and VEGFR2 (kinaseinsert domain-containing receptor/flk-1), is critical in embry-onic, normal, and tumor angiogenesis (41). The VEGF receptorsare expressed on varied cells, including monocytes (VEGFR1),neuronal precursor cells (VEGFR1 and VEGFR2), and podo-cytes (VEGFR2), but are most highly expressed on resting andactive endothelial cells (42–44).

St. Croix et al. (19) identified genes that were up-regulatedin endothelial cells isolated from a human colon carcinoma as

Fig. 4 Relative mRNA expression of the murine homologs of recognized endothelial cell surface markers determined by real-time-PCR. The resultswere normalized to 18S mRNA expression and compared with the expression of the same human endothelial cell surface markers by humanmicrovascular endothelial cell(s) (HMVEC). The data are the means for two independent experiments. VEGFR, vascular endothelial growth factorreceptor; ENDRB, endothelin-B receptor.




compared with endothelial cells isolated from normal colonmucosa from the same patient. The genes expressed by the colontumor endothelial cells differed significantly from the genesexpressed by HMVEC and human umbilical vein endothelialcell, the cells traditionally used when studying angiogenesis invitro. Therefore, the identification of cells or cell lines with a

gene expression profile more relevant to malignant disease iscritical. Carson-Walter et al. (20) identified several human tu-mor endothelial markers predicted to be associated with the cellsurface and verified the differential expression pattern of thehomologs, mTEM1, mTEM5, and mTEM8 in murine tumorendothelial cells. The immortalized murine endothelial cell line,

Table 2 Flow cytometry detection of murine homologs recognized endothelial cell surface proteins.Murine endothelial cell lines were assessed for the expression of endothelial cell marker proteins using antibodies directed toward the mouse

proteins. The same endothelial cell markers were assessed on HMVECa using antibodies directed toward the human protein. The data are presentedas the percentage of the cell population expressing the protein.

Cell type

Endothelial cell surface marker

SialomucinCD34

GPIIIBCD36

EndoglinCD105

P1H12CD146

VCAM1CD106

2H11 31 31 5 18 202F2B 2 7 2 3 923B11 61 24 2 7 86IP2E4 12 28 4 7 86SVEC4–10 4 22 2 5 97SVEC4-10EE2 2 19 2 5 99SVEC4-10EHR1 2 24 2 9 36HMVEC 0 3 97 96 28

a HMVEC, human microvascular endothelial cell; VCAM, vascular cellular adhesion molecule.

Fig. 5 Relative mRNA expression of the murine homologs of tumor endothelial cell surface markers determined by real-time-PCR. The results werenormalized to 18S mRNA expression and are expressed relative to the expression level of each marker in 2H11 cells. The data are the means for twoindependent experiments. mTEM, murine tumor endothelial cell.




2H11, expresses relatively high levels of mTEM1, mTEM5,mTEM7, and mTEM8, suggesting that these cells may be auseful model of tumor endothelial cells for cell-based assays.

The mouse remains the model species of choice in cancerexperimental therapeutics. It is critical to the selection of po-tential therapeutics to be aware of the similarities and differ-ences between the human and murine molecular targets. Be-cause of the inter-species differences in specific moleculartargets, it is often necessary to development potential therapeu-tic agents directed toward the murine protein. Whether synge-neic murine tumors or human tumor xenograft models are used,the stromal compartment of the tumors is murine. Several strat-egies have been used to transplant functional human endothelialcells into immunodificient SCID mice such as s.c. implantationof a Matrigel matrix, collagen/fibronectin matrices, or polylacticacid sponges containing genetically altered human umbilicalvein endothelial cell or HMVEC (45–49). Alternatively, theSCID mouse has been successfully engrafted with human stemcells (50). Raychaudhuri et al. (51) developed a model thatinvolves the transplantation of human psoriasis plaques into

SCID mice that maintain the hyperproliferative characteristicsof the psoriasis as well as a functional human vasculature. Thesemethods allow human angiogenesis in a murine host but are notmodels of angiogenesis associated with malignant disease.

Animal models including genetically engineered mice andxeno-transplanted mice are being developed to facilitate theassessment of therapies directed toward human angiogenesistargets in the mouse. However, the mouse remains important inearly preclinical development of potential antiangiogenic ther-apies. Cell-based models, including endothelial cell prolifera-tion, migration, and tube formation, are well-established as theprimary screen for potential antiangiogenic activity. Performingthese assays in both human and murine endothelial cells thathave characteristics of human tumor endothelial cells frompatients is the ideal. The immortalized murine 2H11 endothelialcell line appears to be an appropriate murine endothelial cellmodel of tumor angiogenesis. Continuing use of these murinecells in cell-based angiogenesis assays will be needed to estab-lish their usefulness in understanding endothelial cell biologyand drug discovery.

Fig. 6 A, number of 2H11 cells after 48-hexposure to anti-2,4-dinitrophenol (anti-DNP)control antibody (100 �g/ml), anti-tumor en-dothelial cell (anti-TEM) antibody (100 �g/ml), or SU5416 (10 or 50 �M). B, inverted,phase microscope images of each of 2H11murine endothelial cells (2 � 104 cells/well)in a tube formation assay on a thick layer ofMatrigel for 4 h at 37°C alone (PBS) or alongwith exposure to anti-DNP control antibody(100 �g/ml), anti-TEM antibody (100 �g/ml),or SU5416 (50 �M).




REFERENCES1. Teicher BA, editor. Tumor Models in Cancer Res. New Jersey: TheHumana Press, Inc., 2001.

2. Modzelewski RA, Davies P, Watkins SC, Auerbach R, Chang M-J,Johnson CS. Isolation and identification of fresh tumor-derived endo-thelial cells from a murine RIF-1 fibrosarcoma. Cancer Res 1994;54:336–9.

3. Morikawa S, Baluk P, Kaidoh T, Haskell A, Jain RK, McDonaldDM. Abnormalities in pericytes on blood vessels and endothelial sproutsin tumors. Am J Pathol 2002;160:985–1000.

4. Thurston G, Suri C, Smith K, et al. Leakage-resistant blood vesselsin mice transgenically overexpressing angiopoietin-1. Science (Wash DC) 1999;286:2511–4.

5. Brown EB, Campbell RB, Tsuzuki Y, et al. In vivo measurement ofgene expression, angiogenesis and physiological function in tumorsusing multiphoton laser scanning microscopy. Nat Med 2001;7:864–8.

6. Lu L, Wang S, Auerbach R. In vitro and in vivo differentiation intoB Cells, T cells and myeloid cells of primitive yolk sac hematopoieticprecursor cells expanded �100-fold by coculture with a clonal yolk sacendothelial cell line. Proc Natl Acad Sci USA 1996;93:14782–7.

7. Capillo M, Mancuso P, Gobbi A, et al. Continuous infusion ofendostatin inhibits differentiation, mobilization, and clonogenic poten-tial of endothelial cell progenitors. Clin Cancer Res 2003;9:377–82.

8. Shirakawa K, Furuhata S, Watanabe I, et al. Induction of vasculo-genesis in breast cancer models. Br J Cancer 2002;87:1454–61.

9. Luttun A, Carmeliet G, Carmeliet P. Vascular progenitors: frombiology to treatment. Trends Cardiovasc. Med 2002;12:88–96.

10. Shirakawa K, Shibuya M, Heike Y, et al. Tumor-infiltrating endo-thelial cells and endothelial precursor cells in inflammatory breastcancer. Int J Cancer 2002;99:344–51.

11. Lyden D, Hattori K, Dias S, et al. Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blockstumor angiogenesis and growth. Nat Med 2001;7:1194–201.

12. Heissig B, Hattori K, Dias S, et al. Recruitment of stem andprogenitor cells from the bone marrow niche requires MMP-9 mediatedrelease of kit-ligand. Cell 2002;109:625–37.

13. Asahara T, Masuda H, Takahashi T, et al. Bone marrow origin ofendothelial progenitor cells responsible for postnatal vasculogenesis inphysiological and pathological neovascularization. Circ Res 1999a;85:221–8.

14. Asahara T, Takahashi T, Masuda H, et al. VEGF contributes topostnatal neovascularization by mobilizing bone marrow-derived endo-thelial progenitor cells. EMBO J 1999b;18:3964–72.

15. O’Connell KA, Edidin M. A mouse lymphoid endothelial cell lineimmortalized by simian virus 40 binds lymphocytes and retains func-tional characteristics of normal endothelial cells. J Immunol 1990;144:521–5.

16. O’Connell K, Landman G, Farmer E, Edidin M. Endothelial cellstransformed by SV40 T antigen cause Kaposi’s sarcomalike tumors innude mice. Am J Pathol 1991;139:743–9.

17. O’Connell KA, Rudmann AA. Cloned spindle and epitheliodid cellsfrom murine Kaposi’s sarcoma-like tumors are of endothelial origin.J Investig Dermatol 1993;100:742–5.

18. Bastaki M, Nelli EE, Dell’Era P, et al. Basic fibroblast growthfactor-induced angiogenic phenotype in mouse endothelium: a study ofaortic and microvascular endothelial cell lines. Arterioscler ThrombVasc Biol 1997;17:454–64.

19. St. Croix B, Rago C, Velculescu V, et al. Genes expressed in humantumor endothelium. Science (Lond) 2000;289:1197–202.

20. Carson-Walter EB, Watkins DN, Nanda A, Vogelstein B, KinzlerKW, St. Croix B. Cell surface tumor endothelial markers are conservedin mice and humans Cancer Res 2001;61:6649–55.

21. Scholz D, Schaper J. Platelet/endothelial cell adhesion molecule-1(PECAM-1) is localized over the entire plasma membrane of endothelialcells. Cell Tissue Res 1997;290:623–31.

22. Wong D, Dorovini-Zis K. Platelet/endothelial cell adhesion mole-cule-1 (PECAM-1) expression by human brain microvessel endothelialcells in primary culture. Brain Res 1996;731:217–20.

23. Krause DS, Fackler MJ, Civin CI, May WS. CD34: structure,biology, and clinical utility. Blood 1996;87:1–12.

24. Swerlick RA, Lee KH, Wick TM, Lawley TJ. Human dermalmicrovascular endothelial but not human umbilical vein endothelialcells express CD36 in vivo and in vitro. J Immunol 1992;148:78–83.

25. Asch AS, Barnwell JW, Silverstein RL, Nachman RL. Isolation ofthrombospondin membrane receptor. J Clin Investig 1987;79:1054–61.26. Tandon NN, Kralisz U, Jamieson GA. Identification of glycoproteinIV (CD36) as a primary receptor for platelet-collagen adhesion. J BiolChem 1989;264:7576–83.27. Oquendo P, Hundt E, Lawler J, Seed B. CD36 directly mediatescytoadherence of plasmodium falciparum parasitized erythrocytes. Cell1989;58:95–101.28. Ge AZ, Butcher EC. Cloning and expression of a cDNA encodingmouse endoglin, an endothelial cell TGF-� ligand. Gene 1994;138:201–6.29. Arthur HM, Ure J, Smith AJ, et al. Endoglin, an ancillary TGF�receptor, is required for extraembryonic angiogenesis and plays a keyrole in heart development. Dev Biol 2000;217:42–53.30. Miller DW, Graulich W, Karges B, et al. Elevated expression ofendoglin, a component of TGF-�-receptor complex, correlates withproliferation of tumor endothelial cells. Int J Cancer 1999;81:568–72.31. Shetty SS, Okada T, Webb RL, DelGrande D, Lappe RW. Func-tionally distinct endothelin B receptors in vascular endothelium andsmooth muscle. Biochem Biophys Res Comm 1993;191:459–74.32. Solovey AN, Gui L, Chang L, Enenstein J, Browne PV, Hebbel RP.Identification and functional assessment of endothelial P1H12. J LabClin Med 2001;138:322–31.33. Mutin M, Dignat-George F, Sampol J. Immunologic phenotype ofcultured endothelial cells: quantitative analysis of cell surface mole-cules. Tissue Antigens 1997;50:449–58.34. Davis S, Aldrich TH, Jones PF, et al. Isolation of angiopoietin-1, aligand for the TIE2 receptor, by secretion-trap expression cloning. Cell1996;87:1161–9.35. Suri C, Jones PF, Patan S, et al. Requisite role of angiopoietin-1, aligand for the TIE2 receptor, during embryonic angiogenesis. Cell1996;87:1171–80.36. Maisonpierre PC, Suri C, Jones PF, et al. Angiopoietin-2, a naturalantagonist for Tie-2 that disrupts in vivio angiogenesis. Science (Lond)1997;277:55–60.37. Koblizek TI, Weiss C, Yancopolous GD, Deutsch U, Risau W.Angiopoietin-1 induces sprouting angiogenesis in vitro. Curr Biol 1998;8:529–32.38. Grooby WL, Krishnan R, Russ GR. Characterization of ovineumbilical vein endothelial cells and their expression of cell adhesionmolecules: comparative study with human endothelial cells. ImmunolCell Biol 1997;75:21–8.39. Iiyama K, Hajra L, Iiyama M, et al. Patterns of vascular celladhesion molecule-1 and intercellular adhesion molecule-1 expressionin rabbit and mouse atherosclerotic lesions and at sites predisposed tolesion formation. Circ Res 1999;86:199–207.40. Charpin C, Garcia S, Andrac L, Horschowski N, Choux R, LavautMN. VCAM (IGSF) adhesion molecule expression in breast carcinomasdetected by automated and quantitative immunocytochemical assays.Hum Pathol 1998;29:896–903.41. Millauer B, Wizigmann-Voos S, Schnurch H, et al. High affinityVEGF binding and developmental expression suggest FLK-1 as a majorregulator of vasculogenesis and angiogenesis. Cell 1993;72:835–46.42. Sawano A, Iwai S, Sakurai Y, et al. Flt-1, vascular endothelialgrowth factor receptor 1, is a novel cell surface marker for the lineageof monocyte-macrophages in humans. Blood 2001;97:785–91.43. Jin K, Zhu Y, Sun Y, Mao XO, Xie L, Greenberg DA. Vascularendothelial growth factor (VEGF) stimulates neurogenesis in vitro andin vivo. Proc Natl Acad Sci USA 2002;99:11946–50.




44. Fan L, Wakayama T, Yokoyama S, Amano O, Iseki S. Downregu-lation of vascular endothelial growth factor and its receptors in thekidney in rats with puromycin aminonucleoside nephrosis. Nephron2002;90:95–102.45. Bosma MJ, Carroll AM. The SCID mouse mutant: definition,characterization, and potential uses. Ann Rev Immunol 1991;9:323–50.46. Brooks PC, Montgomery AM, Rosenfeld M, et al. Integrin � v � 3antagonists promote tumor regression by inducing apoptosis of angio-genic blood vessels. Cell 1994;79:1157–64.47. Schechner JS, Nath AK, Zheng L, et al. In vivo formation ofcomplex microvessels lined by human endothelial cells in an immuno-deficient mouse. Proc Natl Acad Sci USA 2000;97:9191–6.

48. Nor JE, Christensen J, Mooney DJ, Polverini PJ. Vascular endo-thelial growth factor (VEGF)-mediated angiogenesis is associated withenhanced endothelial cell survival and induction of bcl-e expression.Am J Pathol 1999;154:375–84.49. Yang J, Nagavarapu U, Relloma K, et al. Telomerized humanmicrovasculature is functional in vivo. Nat Biotechnol 2001;19:219–24.50. Greiner DL, Hesselton RA, Shultz LD. SCID mouse models ofhuman stem cell engraftment. Stem Cells 1998;16:166–77.51. Raychaudhuri SP, Sanyal M, Raychaudhuri SK, Dutt S, Farber EM.Sever combined immunodeficiency mouse-human skin chimeras: aunique animal model for the study of psoriasis and cutaneous inflam-mation. Br J Dermatol 2001;144:931–9.




2004;10:2179-2189. Clin Cancer Res Jennifer Walter-Yohrling, Sharon Morgenbesser, Cecile Rouleau, et al. Endothelial CellsMurine Endothelial Cell Lines as Models of Tumor

Updated version

http://clincancerres.aacrjournals.org/content/10/6/2179

Access the most recent version of this article at:

Cited articles

http://clincancerres.aacrjournals.org/content/10/6/2179.full#ref-list-1

This article cites 50 articles, 15 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/10/6/2179.full#related-urls

This article has been cited by 12 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/10/6/2179To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/content/10/6/2179.full#ref-list-1

http://clincancerres.aacrjournals.org/content/10/6/2179.full#related-urls

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



Murine Endothelial Cell Lines as Models of Tumor ...tumor endothelial cell markers, the murine...

Documents

Transcript of Murine Endothelial Cell Lines as Models of Tumor ...tumor endothelial cell markers, the murine...