More “What Perl can do” With an introduction to BioPerl Ian Donaldson Biotechnology Centre of...
description
Transcript of More “What Perl can do” With an introduction to BioPerl Ian Donaldson Biotechnology Centre of...
More “What Perl can do”
With an introduction to BioPerl
Ian DonaldsonBiotechnology Centre of Oslo
MBV 3070
Much of the material in this lecture is from the “Perl” lecture and lab developed forthe Canadian Bioinformatics Workshops by
Will HsiaoSohrab ShahSanja Rogic
And released under the Creative Commons license
http://creativecommons.org/licenses/by-sa/2.5/
More “What can Perl do”
• So far, we’ve had a very brief introduction to Perl
• Next, we want to go a little deeper into
• Use of “strict” • Perl regular expressions• Modules• An introduction to object-oriented Perl
and• BioPerl
strict
Effects of “use strict”• Requires you to declare variables
• Warns you about possible typos in variables
Correct Incorrectmy $DNA;$DNA = “ATCG”;ormy $DNA = “ATCG”;
$DNA = “ATCG”;
No warning Warningmy $DNA = “ATCG”;$DNA =~tr/ATCG/TAGC/
my $DNA = “ATCG”;$DAN =~tr/ATCG/TAGC
Why bother “use strict”
• Enforces some good programming rules• Helps to prevent silly errors• Makes trouble shooting your program
easier• Becomes essential as your code
becomes longer• We will use strict in all the code you see
today and in your assignment• Bottom line: ALWAYS use strict
Exercise 12
Write a program that has one function.
Use a variable named “$some_variable” in thisfunction and in the main body of the program.
Prove that you can alter the value of $some_variable in the function withoutchanging the value of $some_variable in the the main body of the program.
Try it yourself (15 minutes) then check the answer at the end of this lecture.
regular expressions
What is a Regular Expression?• REGEX provides pattern matching ability• Tells you whether a string contains a pattern
or not (Note: it’s a yes or no question!)
“I have a golden retriever”“Yesterday I saw a big black dog”
“My dog ate my homework”
“Yes” or “True” “Yes” or “True” “No” or “False”
Dog! Human’s best friend
“No” since REGEX is case sensitive
Regular Expression looking for “dog”
Regular expressions are “regular”
Look at these names for yeast open reading frame names.
YDR0001WYDR4567CYAL0045WYBL0008C
While they are all different, they all follow a pattern (or regular expression).1. Y means yeast2. some letter between A and L represent a
chromosome3. an ‘R’ or ‘L’ refers to an arm of the chromosome4. a four digit number refers to an open reading frame5. A ‘W’ or a ‘C’ refers to either the Watson or Crick
strand
You can write a regular expression to recognize ALL yeast open reading frame names.
Perl REGEX example
my $text = “The dog ate my homework”;if ($text =~ m/dog/){print “The text contains a dog\n”;
}
• =~ m is the binding operator. It says: “does the string on the left contain the pattern on the right?”
• /dog/ is my pattern or regular expression• The matching operation results in a true or false
answer
Regular Expressions in Perl
• A pattern that match only one string is not very useful!
• We need symbols to represent classes of characters
• For example, say you wanted to recognize ‘Dog’ or ‘dog’ as being instances of the same thing
• REGEX is its own little language inside Perl– Has different syntax and symbols!– Symbols which you have used in perl such as $
. { } [ ] have totally different meanings in REGEX
REGEX Metacharacters
• Metacharacters allow a pattern to match different strings– Wildcards are examples of metacharacters– /.og/ will match “dog”, “log”, “tog”, “ og”,
etc.
– So . Means “any character” – Perl REGEX has much more powerful
metacharacters used to represent classes of characters
Types of Metacharacters. matches any one character or space except
“\n”
[ ] denotes a selection of characters and matches ONE of the characters in the selection. What does [ATCG] match?
\t, \s, \n match a tab, a space and a newline respectively
\w matches any characters in [a-zA-Z0-9]
\d matches [0-9]
\D matches anything except [0-9]
Using metacharacters to build a regular expression
YBL3456W
/Y[A-L][RL]\d\d\d\d[WC]/
Is this a good pattern for a yeast ORF name?
What else does it match?What if the name only has 3 digits?
REGEX Quantifiers• What if you want to match a character
more than once?
• What if you want to match an mRNA with a polyA tail that is at least 5 – 12 A’s?
“ATG……AAAAAAAAAAA”
REGEX Quantifiers
• + matches one or more copies of the previous character
• * matches zero or more copies of the previous character
• ? matches zero or one copy of the previous character
• {min,max} matches a number of copies within the specified range
“ATG……AAAAAAAAAAA”
/ATG[ATCG]+A{5,12}/
REGEX Anchors
• The previous pattern is not strictly correct because:– It’ll match a string that doesn’t start with
ATG– It’ll match a string that doesn’t end with
poly A’s
• Anchors tell REGEX that a pattern must occur at the beginning or at the end of a string
REGEX Anchors
•^ anchors the pattern to the start of a string
•$ anchors the pattern to the end of a string
/^ATG[ATCG]+A{5,12}$/
REGEX is greedy!
• The revised pattern is still incorrect because– It’ll match a string that has more than 12 A’s at the end
• quantifiers will try to match as many copies of a sub-pattern as possible!
/^ATG[ATCG]+A{5,12}$/
“ATGGCCCGGCCTTTCCCAAAAAAAAAAAA”
“ATGGCCCGGCCTTTCCCAAAAAAAAAAAA”
Curb that Greed!• ? after a quantifier prevents REGEX from being
greedy
/^ATG[ATCG]+?A{5,12}$/
“ATGGCCCGGCCTTTCCGAAAAAAAAAAAA”
“ATGGCCCGGCCTTTCCGAAAAAAAAAAAA”
• note this is the second use of the question mark - what is the other use of ? in REGEX?
REGEX Capture
• What if you want to keep the part of a string that matches to your pattern?
• Use ( ) “memory parentheses”
“ATGGCCCGGCCTTTCCGAAAAAAAAAAAA”
/^ATG([ATCG]+?)A{5,12}$/
REGEX Capture
• What’s inside the first ( ) is assigned to $1
• What’s inside the Second ( ) is $2 and so on
• So $2 eq “AAAAAAAAAAAA”
/^ATG([ATCG]+?)(A{5,12})$/
$1 $2
REGEX Modifiers
• Modifiers come after a pattern and affect the entire pattern
• You have seen //g already which does global matching (/T/g) and global replacement(s/T/U/g)
• Other useful modifiers:
//i make pattern case insensitive
//s let . match newline
//m let ^ and $ (anchors) match next to embedded newline
///e allow the replacement string to be a perl statement
REGEX Summary• REGEX is its own little language!!!• REGEX is one of the main
strengths of Perl
• To learn more:• Learning Perl (3rd ed.) Chapters 7, 8, 9• Programming Perl (3rd ed.) Chapter 5• Mastering Regular Expression (2nd ed.) • http://www.perl.com/doc/manual/html/pod/perlre.html• A good cheat sheet is:
http://www.biotek.uio.no/EMBNET/guides/guideRegExp.pdf
Exercise 13
In a text file, write out three strings that matchthe following regular expression
/^ATG?C*[ATCG]+?A{3,10}$/
Write a program that reads each string from the text file and checks your answers.
Try it yourself (30 min) then look at the answer at the end of this lecture.
modules
What are Modules
• a “logical” collection of functions• Using modules has the same advantage as
using functions; i.e., it simplifies code (makes it modular) and facilitates code reuse
• Each collection (or module) has its own “name space”
Name space: a table containing the names of variables and functions used in your code
Why Use Modules?
• Modules allow you to use others’ code to extend the functionality of your program.
• There are a lot of Perl modules.
Finding out what modules you already have
In Perl, each module is a file stored in some directory in your system.
The system that this class is using, stores Perlmodules (like cgi.pm) in one of two directories
C:\bin\Perl\libC:\bin\Perl\site\lib
Finding out what modules you already have
• To find out where modules are installed, type
perl –V
at the command prompt
• To find out what is installed, type
perldoc perllocal
at the command prompt.
Using Modules
• To use a module, you need to include the line:
use modulename;
at the beginning of your program.
• But you already knew that…use strict;
use warnings;
Where to find modules
• You can search for modules (and documentation) that may be useful to your particular problem using http://search.cpan.org/
• CPAN: Comprehensive Perl Archive Network
• Central repository for Perl modules and more
• “If it’s written in Perl, and it’s helpful and free, it’s probably on CPAN”
• http://www.perl.com/CPAN/
Exercise14Open a web browser
Go to http://search.cpan.org/Type in “bioperl Tools BLAST”Follow the link to Bio::Tools::BlastBrowse through this page and the example code
Make a .plx file like this:
#bioperl example codeuse strict;use warnings;
#make the bioperl module (class) accessible to your programuse Bio::Seq;
print"ok - ready to use Bio::Seq";
Does this programme run or return an error?
Bioperl Overview
• The Bioperl project – www.bioperl.org• Comprehensive, well documented set of
Perl modules • A bioinformatics toolkit for:
• Format conversion• Report processing• Data manipulation• Sequence analyses• and more!
• Written in object-oriented Perl
Bioperl Overview
• The last exercise most likely did not work (unless you have BioPerl installed)
• So let’s install it…
How to install modules
• This class is using the active state version of Perl that comes with a program called ppm (Perl Package Manager)
• At the command prompt type
>ppm
And follow the instructions in the exercise 15
How to install modules (without ppm)
• If you are not using active state Perl, youyou can also install modules from CPAN using:
>perl –MCPAN –e “install ‘Some::Module’”
• Module dependency is taken care of automatically
• You’ll (usually) need to be root to install a module successfully
Exercise15
Install bioperl 1. At the command line prompt type
>ppm
2. Then at the ppm prompt type
ppm> search bioperl
3. Then type
ppm> install bioperl
Try this exercise at home. Installing libraries is not possible at UiO computers.
What are objects?• Examples of objects in real life:
– My car, my dog, my dishwasher…• Objects have ATTRIBUTES and METHODS
Some attributes of a my dog Fido:•Color of fur = brown•Height = 20 cm•Owner’s Name = Ian•Weight = 2 Kg•Tail position = up
Some methods of my dog Fido:•Bark•Walk•Run•Eat•Wag tail
Fido
What is a class?• A class is a type of object in the real world:
– Cars, dogs, dishwashers…• Classes have ATTRIBUTES and METHODS
Some attributes of a dog:•Color of fur•Height•Owner’s Name•Weight •Tail position
Some methods of a dog:•Bark•Walk•Run•Eat•Wag tail
The concept
of a “dog”
So an object is an instance of a class
The concept
of “dog”
class
object
Fido
Objects have unique names called “references” and classes have names
too.
Dog
class
object
reference
Fido
Class name
All classes have a method called new that is used to create objects.
Dog
class
object
Fido
Fido = new Dog();
reference
A reference to an object can be used to access its properties or methods.
Dog
class
object
Fidoprint Fido->bark();
woof
A reference to an object can be used to access its properties or methods.
Bio::DB::RefSe
q
class
object
$refseq
$molecule = Some sequence record
$refseq = new Bio::DB::RefSeq;
$molecule = $refseq->get_seq_by_acc(“NP_01014”);
Putting it all together
So now that you understand (sort of)ClassesObjectsAttributes andMethods
What remains is learning what the different classes are that are available in BioPerl and what you can do with them.
For the next exercise, use the documentation at bioperl.org*to figure out what the following code does…
*see www.bioperl.org/wiki/HOWTOs anddoc.bioperl.org (then click on bioperl-live)
Exercise16
#! /usr/local/bin/perl# Create and run a program which creates a Seq object and manipulates it:
use Bio::Seq;
# initiation of Seq object$seq = Bio::Seq->new('-seq' =>'CGGCGTCTGGAACTCTATTTTAAGAACCTCTCAAAACGAAACAAGC', '-desc' => 'An example', '-display_id' => 'NM_005476', '-accession_number' => '6382074', '-moltype' => 'dna');
# sequence manipulations$aa = $seq -> moltype(); # one of 'dna','rna','protein'$ab = $seq -> subseq(5,10); # part of the sequence as string
$ac = $seq -> revcom; # returns an object of the reverse complemented sequence$ac1 = $ac -> seq();
$ad = $seq -> translate; # returns an object of the sequence translation$ad1 = $ad -> seq();
$ae = $seq -> translate(undef,undef,1); # returns an object of the sequence translation (using frame 1) (0,1,2 can be used)$ae1 = $ae -> seq();
print "Molecule Type: $aa\n";print "Sequence from 5 to 10: $ab\n";print "Reverse complemented sequence: $ac1\n";print "Translated sequence: $ad1\n";print "Translated sequence (using frame 1): $ae1\n";
Make the Bio::Seq class available to my program
Create a new Bio::Seq object and initialize
some attributes
Exercise17
Check out the code of several examplesusing BioPerl at:
http://bip.weizmann.ac.il/course/prog2/perlBioinfo/
More Bioperl modules
• Bio::SeqIO: Sequence Input/Output– Retrieve sequence records and write to files– Converting sequence records from one
format to another
• Bio::Seq: Manipulating sequences – Get subsequences ($seq->subseq($start, $end))– Find the length of the object ($seq->length)– Reverse complement a DNA sequence– Translate a DNA sequence ….etc.
• Bio::Annotation: Annotate a sequence– Assign journal references to a sequence,
etc.– Bio::Annotation is associated with an entire
sequence record and not just part of a sequence (see also Bio::SeqFeature)
Some more Bioperl modules
• Bio::SeqFeature: Associate feature annotation to a sequence– “features” describe specific locations in the
sequence– E.g. 5’ UTR, 3’ UTR, CDS, SNP, etc– Using this object, you can add feature
annotations to your sequences– When you parse a genbank file using
Bioperl, the “features” of a record are stored as SeqFeature objects
• Bio::DB::GenBank, GenPept, EMBL and Swissprot: Remote Database Access– You can retrieve a sequence from remote
databases (through the Internet) using these objects
Even more Bioperl modules
• Bio::SearchIO: Parse sequence database search reports– Parse BLAST reports (make custom report)– Parse HMMer, FASTA, SIM4, WABA, etc.– Custom reports can be output to various
formats (HTML, Table, etc)• Bio::Tools::Run::StandAloneBLAST: Run
Standalone BLAST through perl– By combining this and SearchIO, you can
automate and customize BLAST search• Bio::Graphics: Draw biological entities (e.g. a
gene, an exon, BLAST alignments, etc)
Bioperl Summary
• For Online documentation:– For this workshop:
http://doc.bioperl.org/releases/bioperl-1.4/– Tutorial:
http://www.bioperl.org/wiki/HOWTO:Beginners – HOWTOs: http://www.bioperl.org/wiki/HOWTOs– Modules:
http://www.bioperl.org/wiki/Category:Core_Modules• Literature:
– Stajich et al., The Bioperl toolkit: Perl modules for the life sciences. Genome Res. 2002 Oct;12(10):1611-8.PMID: 12368254
• Bioperl mailing list: [email protected]– Best way to get help using Bioperl– Very active list (upwards of 10 messages a day)
• Use with caution: things change fast and without warning (unless you are on the mailing list…)
Perl Documents
• In-line documentation– POD = plain old documents– Read POD by typing perldoc <module name>– E.g. perldoc perl, perldoc Bio::SeqIO
• On-line documentation– http://www.cpan.org– http://www.perl.com– http:/www.bioperl.org
• Books– Learning Perl (the best way to learn Perl if you know
a bit about programming already)– Beginning Perl for Bioinformatics (example based
way to learn Perl for Bioinformatics)– Programming Perl (THE Perl reference book – not for
the faint of heart)
Additional Book References
• Perl Cookbook 2nd edition (quick solutions to 80% of what you want to do)
• Learning Perl Objects, References & Modules (for people who want to learn objects, references and modules in Perl)
• Perl in a Nutshell (an okay quick reference)• Perl CD Bookshelf, Version 4.0 (electronic
version of the above books – best value, searchable, and kill fewer trees)
• Mastering Perl for Bioinformatics (more example based learning)
• CGI Programming with Perl (rather outdated treatment on the subject... Not really recommended)
• Perl Graphics Programming (if you want to generate graphics using Perl; side note – Perl is probably not the best tool for generating graphics)
#!/usr/bin/perluse strict;use warnings;
#TASK: demonstrate the use of “my” in setting the#scope of a variable my $some_variable = 100;
#body of the main program with the function callprint "the value of some_variable is: $some_variable\n";subroutine1();print "but here, some_variable is still: $some_variable\n";
#subroutine using $some_variablesub subroutine1{
my $some_variable = 0;print "in subroutine1,some_variable is: $some_variable\n";
}
#what happens if you comment out "use strict" and #remove "my" from lines 7 and 16
Answer 12
#!/usr/bin/perluse strict;use warnings;
#TASK: check your answers to the regex excercise
#open input and output filesopen(IN,"myanswers.txt");
#read the input file line-by-line#for each line test if it matches a regular expressionwhile(<IN>){
chomp;my $is_correct = does_it_match($_);if ($is_correct){
print "$_ is a match\n";}else{
print "$_ is NOT a match\n";}
}
#close input file and exitclose(IN);exit();
#does it matchsub does_it_match{
my($answer) = @_;my $is_correct = 0;if ($answer =~ m/^ATG?C*[ATCG]+?A{3,10}$/){
$is_correct = 1;}return $is_correct;
}
Answer 13