Plasmid 58 (2007) 167–173

www.elsevier.com/locate/yplas

Monomeric red fluorescent protein as a reporterfor macromolecular localization in Streptomyces coelicolor

Khoa Duy Nguyen, Stephanie H. Au-Young, Justin R. Nodwell *

Department of Biochemistry and Biomedical Sciences, McMaster University, Health Sciences Centre,

1200 Main Street West, Hamilton, Ont., Canada L8N 3Z5

Received 4 January 2007, revised 5 March 2007Available online 4 June 2007

Communicated by Kenn Gerdes

Abstract

The enhanced green fluorescent protein (eGFP) is widely used to investigate cell type specific gene expression andprotein localization in the filamentous streptomycetes. To broaden the scope of cell biological investigation in these organ-isms, we have adapted shuttle vectors for the construction of gene fusions to the monomeric red fluorescent protein(mRFP1) and have tested them in Streptomyces coelicolor. Using fusions of mRFP1 to the cell division proteins DivIVAand FtsZ, we show that mRFP1 is comparable to eGFP for cell biological research in this organism and suggest that thispaves the way for the future use of two-color imaging and FRET.� 2007 Elsevier Inc. All rights reserved.

Keywords: Shuttle vector; Streptomyces; Fluorescence microscopy; Protein localization; mRFP1

1. Introduction

The utility of fluorescence microscopy for investi-gating the subcellular localization of proteins wasbroadened significantly with the discovery of a redfluorescent protein, DsRed, from Discosoma sp.(Matz et al., 1999), and its improved derivative,monomeric red fluorescent protein (mRFP1)(Campbell et al., 2002; Shaner et al., 2004). Thisinnovation provided the tools necessary for simulta-neous imaging of two proteins in living cells whereone is fused to mRFP1 and the other is fused tothe enhanced green fluorescence protein (eGFP).

0147-619X/$ - see front matter � 2007 Elsevier Inc. All rights reserved

doi:10.1016/j.plasmid.2007.03.005

* Corresponding author. Fax: +1 905 522 9033.E-mail address: nodwellj@mcmaster.ca (J.R. Nodwell).

In addition, mRFP1 can be used as an acceptorand eGFP as a donor in fluorescence resonanceenergy transfer (FRET) (Peter et al., 2005), permit-ting the visualization of protein–protein interactionsin vivo (Periasamy, 2001; Selvin, 2000).

Streptomyces coelicolor is the best developedmodel organism for a large family of filamentousbacteria. The streptomycetes are of interest becauseof their complex life cycle and because this genusproduces most of the world’s antibiotics (Bentleyet al., 2002; Chater, 2001; Kelemen and Buttner,1999; Willey et al., 2006). The life cycle of S. coeli-

color initiates with the germination of spores andthe propagation of vegetative ‘substrate hyphae’ orcollectively, a ‘substrate mycelium’. Eventually thecolony produces a second cell type, the ‘aerialhyphae’, that grows up into the air to produce a

.

168 K.D. Nguyen et al. / Plasmid 58 (2007) 167–173

fuzzy surface layer of ‘aerial mycelium’. While mostof the substrate hyphae eventually die, the aerial celltype produce spores. This multiplicity of cell typesand organized colony architecture makes S. coeli-color an excellent subject for cell biological investi-gation of bacteria.

The eGFP was first employed in S. coelicolor in1999 (Sun et al., 1999) and rapidly became a main-stay in the field, finding applications in the study ofcell division (Del Sol et al., 2006; Flardh, 2003a,b;Grantcharova et al., 2005), chromosome segregation(Jakimowicz et al., 2005, 2006; Mazza et al., 2006)and cell type specific gene expression (Kelemenet al., 2001; O’Connor et al., 2002). Two especiallyimportant applications of the eGFP in this bacte-rium have been the visualization of the proteinsDivIVA and FtsZ. DivIVA is important for cell divi-sion in rod-shaped bacteria, but appears to drive fil-amentous growth by somehow coordinating tipextension in S. coelicolor (Flardh, 2003a,b). Theuse of fluorescence microscopy played a critical rolein the demonstration that this protein forms discretefoci that localize stably to the tips of growing cells.Consistent with a role in tip-growth, overexpressedDivIVA drives the formation of supernumerary tips.In contrast, the protein FtsZ plays essentially thesame role in S. coelicolor as in other bacteria, servingas a major component of a ring structure that bringsabout cell division. However, cell division is utilizeddifferently in S. coelicolor than it is in other bacteria.Whereas this process is normally essential for viabil-ity and for vegetative growth, in S. coelicolor it is dis-pensable for viability (McCormick et al., 1994;McCormick and Losick, 1996) and is most impor-tant for spore formation. Thus, FtsZ rings and septaare rare in the vegetative hyphae but are produced ateven intervals in aerial hyphae, driving the forma-tion of the unigenomic pre-spores (Grantcharovaet al., 2003, 2005; Schwedock et al., 1997). Thedynamic localization and assembly of ring structuresby FtsZ during sporulation of S. coelicolor has beenthoroughly studied with the aid of the eGFP (Grant-charova et al., 2005).

In order to facilitate future two-color fluores-cence microscopy experiments in Streptomyces, wehave developed two mRFP1 vectors and tested themin S. coelicolor using fusions to the divIVA, and ftsZ

genes. Our results demonstrate that this fluorescentprotein is an exceptionally good protein localizationmarker for this organism and our work perfectlyreproduces observations with DivIVA and FtsZthat were made previously using the eGFP.

2. Materials and methods

2.1. Cultivation of bacterial strains and media

Streptomyces coelicolor strain M145, and Escherichia

coli strains XL1 Blue and ET12567 (pUZ8002) weremanipulated as described previously (Kieser et al., 2000;Sambrook et al., 1989). Plasmids were introduced intothe methylation-deficient E. coli strain ET12567/pUZ8002 and transferred into S. coelicolor by conjuga-tion (Flett et al., 1997; Kieser et al., 2000).

2.2. Plasmid construction

pmRFP-C1 (Clontech) was used as a template for PCRamplification of the mRFP1 gene. Pfu polymerase (Fer-mentas) and the primers CGCCCATATGGCCTCCTCCGAGGAC and TATGATGCGGCCGCTCAGTTATCTAGATCCGGT generated a fragment including a 5’NdeI restriction site and 3’ NotI restriction site suitablefor replacement of the egfp gene in the plasmid pIJ8660(Sun et al., 1999). The amplified fragment was gel purifiedand ligated to EcoRV-digested pBluescript. The gene wassequenced to confirm the integrity of the open readingframe, excised as an NdeI/NotI fragment, and ligated topIJ8660 cut with the same enzymes to generate pMU-2.

To generate pMU-3, the upstream terminator andmultiple cloning site from pIJ8660, as a HindIII/NdeIfragment, along with the NdeI/NotI mRFP1 fragment,was cloned into the pRT801 backbone, cut with similarrestriction enzymes.

To construct pRdiv-1, the S. coelicolor divIVA gene(including its upstream promoter) was amplified fromM145 chromosomal DNA using Pfu polymerase(Fermentas) and primers TGATCATCGTCTACATCCTGA and CGTACTACCATATGGTTGTCGTC CTCGTCCA, introducing an NdeI restriction site at the startcodon. The amplified DNA was ligated to pBluescript andsequenced (as above), excised as a HindIII–NdeI frag-ment. The fragment was produced by first cutting withHindIII (New England Biolabs), end-filled with Klenow

polymerase (New England Biolabs), and then cut withNdeI. pMU-2 was cut with EcoRV (New EnglandBiolabs) and NdeI (New England Biolabs) and ligatedto the HindIII–NdeI divIVA fragment to generatepRdiv-1. Similarly the S. coelicolor ftsZ gene wasamplified using primers CACCGCCCTCATGAAAGCGA and CGCGCTGTCCATATGCTTCAGGAAGTCCGGCA and introduced into pMU-3, resulting inpRfts-1.

2.3. Fluorescence microscopy

Fluorescence microscopy was performed at theMcMaster University Biophotonics Facility using theLeica DMI 6000B fluorescence microscope equipped with

K.D. Nguyen et al. / Plasmid 58 (2007) 167–173 169

the Texas Red filter set, a Hamamatsu ORCA-ER digitalcamera, and Volocity3 software (Version 3.0; Improvi-sion). All images were acquired by first obtaining the dif-ferential interference contrast (DIC) image using a 100·objective. The fluorescent images were acquired by excit-ing at 584 nm and red fluorescence was captured at607 nm after 300–500 ms exposure. Fluorescence imageswere subjected to deconvolution to improve the signalto noise ratio. Acquired images in TIFF format were ana-lyzed using the Iterative Deconvolution Algorithm fromVolocity3 deconvolution software (Version 3.0; Improvi-sion) and processed using Adobe Photoshop 7.0.

For visualization of the fusion proteins, S. coelicolor

strains carrying appropriate plasmids were grown on glasscoverslips in solid R2YE medium as described previously(Schwedock et al., 1997). For the time-course experiment,spores were germinated and mounted as described previ-ously (Kieser et al., 2000; Flardh, 2003a). Germinatedspores were removed from liquid culture at varioustime-points and visualized by differential interference con-trast (DIC) microscopy and fluorescence deconvolutionmicroscopy.

3. Results and discussion

3.1. mRFP1 shuttle vectors for Streptomyces

To apply mRFP1 to protein localization in S.

coelicolor, we constructed the vector pMU-2 bydeleting the egfp gene from pIJ8660 (Sun et al.,1999) with NdeI and NotI, and replacing it withan mRFP1 gene generated by PCR and having the

Fig. 1. Restriction maps of pMU-2 and pMU-3. Both vectors containterminator from phage k; aac(3)IV, apramycin-resistance gene selectabfrom pUC18; and oriT RK2, origin of transfer from plasmid RK2. pMUsite of the temperate phage UC31, respectively. pMU-3 contains int

temperate phage UBT1, respectively.

same sites. The mRFP1 gene in pMU-2 is flankedby two transcription terminators, tfd and t0 fromphage fd and phage k, respectively, and has severalrestriction sites upstream of the ORF for the intro-duction of cloned promoters or genes. pMU-2 alsocarries an apramycin-resistance gene, acc(3)IV,the pUC18 origin of replication for growth inE. coli, an RK2 origin of transfer for direct conjuga-tion from E. coli to Streptomyces, and the UC31 int

gene and attP site for site-specific integration of thevector into the attB attachment site in the Strepto-

myces chromosome. We created a second vector,pMU-3 in the parent pRT801 vector (Gregoryet al., 2003). It contains the attP-int locus fromphage UBT1 and therefore integrates at a differentattB site than UC31-derived vectors. pMU-3 alsocarries an apramycin-resistance gene, acc(3)IV,and oriT for direct conjugation from E. coli. Onedifference between the two vectors is that pMU-3lacks a transcriptional terminator downstream fromthe mrfp gene; however, we have found that this ismuch less important than the upstream terminatorand its absence has not had any impact on our abil-ity to use this vector. Maps of pMU-2 and pMU-3are shown in Fig. 1 and their correspondingsequences are included as Supplementary data.

3.2. mRFP1 fusions to DivIVA and FtsZ

To test the utility of mRFP1 in Streptomyces weamplified the divIVA and ftsZ genes (including their

tfd, major transcription terminator of phage fd; to, transcriptionle in E. coli and streptomycetes; ori pUC18, origin of replication-2 contains int UC31 and attP, the integrase gene and attachmentUBT1 and attP, the integrase gene and attachment site of the

Fig. 2. Subcellular localization of DivIVA-mRFP1 fusions. TheS. coelicolor strain M145 carrying pRdiv-1. (A) DIC imageshowing a hyphal mass of S. coelicolor grown on a glass cover slipin solid medium for 40 h. (B) Fluorescence image obtained fromthe same field of view. (C) The merged image of A and B.

170 K.D. Nguyen et al. / Plasmid 58 (2007) 167–173

promoters) and inserted them into pMU-2 andpMU-3, respectively, such that each was transla-tionally fused to the mRFP1-encoding gene. Fortechnical reasons, the easiest way to construct theftsZ fusion to mrfp removed the upstream tfd termi-nator from pMU-3; however, this did not seem tohave any impact on our results as the red fluorescentbackground we observed was equally low for boththe DivIVA and FtsZ experiments (see Figs. 2, 3and 4). We introduced these vectors, which we referto as pRdiv-1 and pRfts-1, into S. coelicolor strainM145 and subjected the cells to fluorescence micros-copy. Coverslips containing S. coelicolor cells weremounted onto glass slides and imaged first by differ-ential interference contrast (DIC) microscopy andthen excited at 584 nm and red fluorescence wasvisualized at 607 nm. The fluorescence images wereobtained after 300–500 ms exposure and subjectedto deconvolution to improve the signal to noiseratio (see Section 2).

Spores bearing pRdiv-1 were grown on glasscover slips in solid medium as described previously(Schwedock et al., 1997). The DIC image inFig. 2(A) shows a cluster of hyphal cells including>20 tips. Fluorescence illumination of this field(Fig. 2B) shows at least 23 small red fluorescent foci,and the overlay of the two images (Fig. 2C) showsthat all of the foci are positioned at hyphal tips.Indeed, all but a few of the tips in the image showclear red fluorescence. Control cells, containingpMU-2 lacking an inserted gene, did not exhibitsuch fluorescence (data not shown). These data areconsistent with the observations made previouslyby Flardh using the eGFP (Flardh, 2003a). Smallerspots of weak fluorescence were observed along thelength of the hyphae, probably corresponding tonascent branch points. In general we found thered autofluorescence to be lower than the greenautofluorescence we have experienced when work-ing with eGFP (O’Connor et al., 2002; StephanieAu-Young and Justin Nodwell, unpublishedobservations).

Careful time-course experiments revealed thatgerminating spores express divIVA prior to theemergence of a germ tube and that the DivIVAfocus is associated with the tip of this growing cellfrom the earliest stages throughout growth (Flardh,2003a). To determine whether our mRFP1 fusioncould reproduce this behavior, we germinatedspores in liquid medium and examined the resultingcells as a function of time. Fig. 3 shows images of S.

coelicolor spores at various stages of growth. The

spores were germinated and grown in liquid med-ium then mounted on glass slides and imaged. Asshown in Fig. 3(A), the red fluorescent foci wereabsent in dormant spores. The image in Fig. 3(B)

Fig. 3. A time-course montage showing the different stages of S. coelicolor M145 spore germination, containing pRdiv-1. All imagesshown are overlays of fluorescence images (red) on the DIC images (grayscale). (A–F) Correspond to images of spores germinated for 0, 2,4, 8, 12 and 20 h, respectively.

K.D. Nguyen et al. / Plasmid 58 (2007) 167–173 171

depicts spores after 2 h of germination. By this time,at least one clear red fluorescent focus was presentin each spore. By the fourth hour (Fig. 3C), germ

tubes were clearly visible, and each exhibited a redfluorescent focus at its tip. Distinct hyphae exhibit-ing fluorescence could be seen emerging from the

Fig. 4. Subcellular localization of FtsZ-mRFP1. S. coelicolor

M145 harboring pRfts-1 grown for 85 h on solid media. (A) DICimage of a single filament of M145 cells. (B) Correspondingfluorescence image.

172 K.D. Nguyen et al. / Plasmid 58 (2007) 167–173

spores 8 h after germination (Fig. 3D) and, withcontinued growth and branching, these tip-associ-ated foci were highly stable (Fig. 3E and F).

Spores containing pRfts-1 were grown on glasscover slips in solid rich medium for 85 h. Fig. 4shows a DIC image (A) and the corresponding redfluorescence image (B) of a filamentous cell in theprocess of cell division. Evenly spaced FtsZ ringssuggest that this is an aerial hyphae in the act ofsporulating, coinciding with results from previousstudies carried out with eGFP (Grantcharovaet al., 2005). A control containing pMU-3 did notdisplay similar fluorescence signals, indicatingthat the mRFP1 signal was linked to FtsZexpression.

3.3. Implications for future work

These results establish mRFP1 as an effectivereporter for macromolecular localization in S. coeli-

color. The fact that our observations are essentiallyidentical to those of Flardh and co-workers for bothDivIVA and FtsZ suggests that mRFP1 fusion wasrelatively benign to protein function in both cases.In addition, mRFP1 should be less toxic to the cellsduring fluorescence imaging than eGFP due to itsred shifted nature, as its excitation maxima isoutside of the UV spectrum. Therefore, it suggeststhe possibility that for some applications, mRFP1may prove superior to eGFP. Most importantly,this work establishes this fluorescent protein as aviable tool for sub-cellular protein localizationand should facilitate future two-color imagingexperiments.

Acknowledgments

We thank Dr. Tony J. Collins for his assistancewith microscopy and Dr. Ray Truant for providingus with a mRFP1 clone. This work was supportedby Grant No. MOP-68817 from the Canadian Insti-tutes for Health Research to J. N.

Appendix A. Supplementary data

Supplementary data associated with this articlecan be found, in the online version, at doi:10.1016/j.plasmid.2007.03.005.

References

Bentley, S.D., Chater, K.F., Cerdeno-Tarraga, A.M., Challis,G.L., Thomson, N.R., James, K.D., et al., 2002. Completegenome sequence of the model actinomycete Streptomyces

coelicolor A3(2). Nature 417, 141–147.Campbell, R.E., Tour, O., Palmer, A.E., Steinbach, P.A., Baird,

G.S., Zacharias, D.A., Tsien, R.Y., 2002. A monomeric redfluorescent protein. Proc. Natl. Acad. Sci. 99, 7877–7882.

Chater, K.F., 2001. Regulation of sporulation in Streptomyces

coelicolor A3(2): a checkpoint multiplex? Curr. Opin. Micro-biol. 4, 667–673.

Del Sol, R., Mullins, J.G., Grantcharova, N., Flardh, K., Dyson,P., 2006. Influence of CrgA on assembly of the cell divisionprotein FtsZ during development of Streptomyces coelicolor.J. Bacteriol. 188, 1540–1550.

Flardh, K., 2003a. Essential role of DivIVA in polar growth andmorphogenesis in Streptomyces coelicolor A3(2). Mol. Micro-biol. 49, 1523–1536.

Flardh, K., 2003b. Growth polarity and cell division in Strepto-

myces. Curr. Opin. Microbiol. 6, 564–571.Flett, F., Mersinias, V., Smith, C.P., 1997. High efficiency

intergeneric conjugal transfer of plasmid DNA from Esche-

richia coli to methyl DNA-restricting streptomycetes. FEMSMicrobiol. Lett. 155, 223–229.

Grantcharova, N., Ubhayasekera, W., Mowbray, S.L., McCor-mick, J.R., Flardh, K., 2003. A missense mutation in ftsZ

differentially affects vegetative and developmentally con-trolled cell division in Streptomyces coelicolor A3(2). Mol.Microbiol. 47, 645–656.

Grantcharova, N., Lustig, U., Flardh, K., 2005. Dynamics ofFtsZ assembly during sporulation in Streptomyces coelicolor

A3(2). J. Bacteriol. 187, 3227–3237.Gregory, M.A., Till, R., Smith, M.C.M., 2003. Integration site

for Streptomyces phage UBT1 and development of site-specific integrating vectors. J. Bacteriol. 185, 5320–5323.

Jakimowicz, D., Gust, B., Zakrzewska-Czerwinska, J., Chater,K.F., 2005. Developmental-stage-specific assembly of ParBComplexes in Streptomyces coelicolor Hyphae. J. Bacteriol.187, 3572–3580.

Jakimowicz, D., Mouz, S., Zakrzewska-Czerwinska, J., Chater,K.F., 2006. Developmental Control of a parAB PromoterLeads to Formation of sporulation-associated ParB com-plexes in Streptomyces coelicolor. J. Bacteriol. 188, 1710–1720.

K.D. Nguyen et al. / Plasmid 58 (2007) 167–173 173

Kelemen, G.H., Buttner, M.J., 1999. Initiation of aerial myceliumformation in Streptomyces. Curr. Opin. Microbiol. 1, 656–662.

Kelemen, G.H., Viollier, P.H., Tenor, J., Marri, L., Buttner,M.J., Thompson, C.J., 2001. A connection between stress anddevelopment in the multicellular prokaryote Streptomyces

coelicolor A3(2). Mol. Microbiol. 40, 804–814.Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F., Hopwood,

D.A., 2000. Practical Streptomyces Genetics. The John InnesFoundation, Norwich, United Kingdom.

Matz, M.V., Fradkov, A.F., Labas, Y.A., Savitsky, A.P.,Zaraisky, A.G., Markelov, M.L., Lukyanov, S.A., 1999.Fluorescent proteins from nonbioluminescent Anthozoa spe-cies. Nat. Biotechnol. 17, 969–973.

Mazza, P., Noens, E.E., Schirner, K., Grantcharova, N., Mom-maas, A.M., Koerten, H.K., Muth, G., Flardh, K., vanWezel, G.P., Wohlleben, W., 2006. MreB of Streptomyces

coelicolor is not essential for vegetative growth but is requiredfor the integrity of aerial hyphae and spores. Mol. Microbiol.60, 838–852.

McCormick, J.R., Su, E.P., Driks, A., Losick, R., 1994. Growthand viability of Streptomyces coelicolor mutant for the celldivision gene ftsZ. Mol. Microbiol. 14, 243–254.

McCormick, J.R., Losick, R., 1996. Cell division gene ftsQ isrequired for efficient sporulation but not growth and viabilityin Streptomyces coelicolor A3(2). J. Bacteriol. 178, 5295–5301.

O’Connor, T.J., Kanellis, K., Nodwell, J.R., 2002. The ramC

gene is required for morphogenesis in Streptomyces coelicolor

and expressed in a cell type-specific manner under the directcontrol of RamR. Mol. Microbiol. 45, 45–57.

Periasamy, A., 2001. Fluorescence resonance energy transfermicroscopy: a mini review. J. Biomed. Opt. 6, 287–291.

Peter, M., Ameer-Beg, S.M., Hughes, M.K., Keppler, M.D.,Prag, S., Marsh, M., Vojnovic, B., Ng, T., 2005. Multiphoton-FLIM quantification of the EGFP-mRFP1 FRET pair forlocalization of membrane receptor–kinase interactions. Bio-phys. J. 88, 1224–1237.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. MolecularCloning: A Laboratory Manual, second ed. Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY.

Schwedock, J., McCormick, J.R., Angert, E.R., Nodwell, J.R.,Losick, R., 1997. Assembly of the cell division protein FtsZinto ladder-like structures in the aerial hyphae of Streptomy-

ces coelicolor. Mol. Microbiol. 25, 847–858.Selvin, P.R., 2000. The renaissance of fluorescence resonance

energy transfer. Nat. Struct. Biol. 7, 730–734.Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans,

B.N.G., Palmer, A.E., Tsien, R.Y., 2004. Improved mono-meric red, orange, yellow fluorescent proteins derived fromDiscosoma sp. red fluorescent protein. Nat. Biotech. 22, 1567–1572.

Sun, J., Kelemen, G.H., Fernandez-Abalos, J.M., Bibb, M.J.,1999. Green fluorescent protein as a reporter for spatial andtemporal gene expression in Streptomyces coelicolor A3(2).Microbiol. 145, 2221–2227.

Willey, J.M., Willems, A., Kodani, S., Nodwell, J.R., 2006.Morphogenetic surfactants and their role in the formation ofaerial hyphae in Streptomyces coelicolor. Mol. Microbiol. 59,731–742.