Monitoring the Metabolic Status of Geobacter Species...

1

Monitoring the Metabolic Status of Geobacter Species in Contaminated 1

Groundwater by Quantifying Key Metabolic Proteins with Geobacter-Specific 2

Antibodies 3

4

Jiae Yun*, Toshiyuki Ueki, Marzia Miletto, and Derek R. Lovley 5

Department of Microbiology, University of Massachusetts, Amherst, Massachusetts 6

7

8

Running title: Quantifying Geobacter proteins in subsurface bioremediation 9

10

11

*Corresponding Author 12

Present Address: 13

Mailing Address: Center for Agricultural Biomaterials, 203-408, Seoul National University, 1 14

Gwanak-ro, Gwanak-gu, Seoul, 151-921, Republic of Korea 15

Fax: +82-2-873-5095 16

Tel: +82-2-880-4889 17

e-mail: [email protected] 18

19

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00114-11 AEM Accepts, published online ahead of print on 6 May 2011

on August 30, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Abstract 1

2

Simple and inexpensive methods for assessing the metabolic status and bioremediation 3

activities of subsurface microorganisms are required before bioremediation practitioners will 4

adopt molecular diagnosis of the bioremediation community as a routine practice for guiding the 5

development of bioremediation strategies. Quantifying gene transcripts can diagnose important 6

aspects of microbial physiology during bioremediation, but is technically challenging and does 7

not account for the impact of translational modifications on protein abundance. An alternative 8

strategy is to directly quantify the abundance of key proteins that might be diagnostic of 9

physiological state. To evaluate this strategy, an antibody-based quantification approach was 10

developed to investigate subsurface Geobacter communities. The abundance of citrate synthase 11

corresponded with rates of metabolism of Geobacter bemidjiensis in chemostat cultures. During 12

in situ bioremediation of uranium-contaminated groundwater the quantity of Geobacter citrate 13

synthase increased with addition of acetate to the groundwater and decreased when acetate 14

amendments stopped. The abundance of the nitrogen-fixation protein, NifD, increased as 15

ammonium became less available in the groundwater and then declined when ammonium 16

concentrations increased. In a petroleum-contaminated aquifer, the abundance of BamB, an 17

enzyme subunit involved in the anaerobic degradation of mono-aromatic compounds by 18

Geobacter species, increased in zones in which Geobacter were expected to play an important 19

role in aromatic hydrocarbon degradation. These results suggest that antibody-based detection of 20

key metabolic proteins, which should be readily adaptable to standardized kits, may be a feasible 21

method for diagnosing the metabolic state of microbial communities responsible for 22

bioremediation, aiding in the rational design of bioremediation strategies. 23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Introduction 1

2

The development of molecular tools that permit diagnosis of the physiological status of 3

key members of subsurface microbial communities is expected to reduce the degree of ‘trial-4

and-error’ in designing strategies to manipulate microbial activity to enhance bioremediation 5

(27). The uranium bioremediation field study site in Rifle, CO has provided a good opportunity 6

to develop such techniques because the subsurface community during effective uranium 7

bioremediation is not diverse (2, 23, 32). In multiple field experiments at this site microbial 8

reduction of soluble U(VI) to poorly soluble U(IV) has been accelerated with the addition of 9

acetate (2, 32). This consistently stimulates the growth of Geobacter species, which are 10

considered to be responsible for the U(VI) reduction, and can account for over 90 % of the 11

microbial community during the height of uranium bioremediation. High abundances of 12

Geobacter species are often noted in other subsurface environments when dissimilatory metal 13

reduction is an important process (1, 8, 17, 36, 39). The development of molecular strategies for 14

diagnosing the metabolic status of subsurface Geobacter species has been facilitated by the 15

availability of multiple Geobacter species whose genomes are available, and in some cases 16

genome-scale metabolic models (9, 29). 17

Initial attempts to diagnose the physiological status of Geobacter species in the subsurface 18

focused on quantifying the abundance of transcripts for key genes whose expression changes in 19

response to important shifts in metabolic state. For example, studies with Geobacter 20

sulfurreducens demonstrated that transcript abundance for gltA, which encodes the TCA cycle 21

enzyme citrate synthase, was proportional to rates of metabolism and analysis of the transcript 22


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

abundance for the gltA of the subsurface Geobacter community during uranium bioremediation 1

revealed major shifts in metabolism of the subsurface Geobacter community in response to 2

acetate availability (21). Analysis of transcript abundance within the subsurface community for 3

genes with increased expression in response to the need to fix nitrogen (20, 32); a limitation in 4

iron available for assimilation (37); phosphate (33) or ammonium (32) limitation; oxidative (31) 5

or heavy metal (22) stress; and electron donor or acceptor utilization (13, 18) has provided 6

important insights into Geobacter physiology during bioremediation. 7

However, quantifying in situ gene transcript abundance is technically difficult and with 8

present technologies may be better suited as a research tool rather than for routine diagnosis of 9

metabolic status. Furthermore, there may be instances in which changes in transcript abundance 10

are not reflected in similar modifications in protein abundance as the result of post transcriptional 11

regulation. Global analysis of proteins may be an alternative, and application of this approach to 12

the study of uranium bioremediation at the Rifle site has been useful in revealing important 13

changes in Geobacter strains during the bioremediation process (11, 44-45). One limitation of 14

this approach is the requirement for large (500 liters) groundwater samples, making it difficult to 15

sample discreet zones in the subsurface and potentially disrupting subsurface geochemical 16

gradients. Another consideration is that only a few specially equipped laboratories are capable of 17

such sophisticated analyses. Furthermore, determining actual protein concentrations with this 18

approach is problematic. 19

An alternative approach is to quantify the abundance of key proteins expected to be 20

diagnostic of physiological status. Here we report that it is possible to track the abundance of 21

important Geobacter metabolic proteins in groundwater during bioremediation of groundwater 22


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

contaminated with uranium or aromatic hydrocarbons. It is expected that this method should be 1

applicable to other microbial communities involved in bioremediation. 2

3

Materials and Methods 4

5

Bacterial strains and growth conditions. 6

Geobacter bemidjiensis BEM (34), and G. sulfurreducens DL1 (10) were grown 7

anaerobically at 30 °C in NBAF media (12) unless indicated otherwise. 8

Chemostat cultivation. 9

G. bemidjiensis was anaerobically cultivated in chemostats as described previously (15). 10

Acetate and Fe(III) citrate served as the electron donor and acceptor, respectively, with 11

concentrations of 5 and 55 mM in the reservoir feeding the chemostat. Cells at steady-state were 12

harvested by centrifugation. 13

Site description and sample collection. 14

Studies on quantifying Geobacter proteins in the subsurface community during acetate-15

stimulated uranium bioremediation were conducted as part of the Rifle Integrated Field 16

Research challenge (IFRC), at the uranium-contaminated aquifer in Rifle, Colorado. This 17

sampling site, methods for introducing acetate into the subsurface, and groundwater sample 18

collection methods have previously been described in detail (31-32, 45-46). In order to evaluate 19

the abundance of citrate synthase with changes in groundwater acetate concentrations, samples 20

from well D07 in the 2008 field experiment were analyzed because previous studies had 21


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

demonstrated significant changes in the expression of Geobacter citrate synthase genes in 1

response to changing acetate levels (46). Analysis of the abundance of Geobacter NifD was 2

carried out with samples from D05 of the 2007 field experiment because it was previously 3

demonstrated that NifD gene expression increased significantly during low ammonium 4

availability at this site (32). 5

Abundance of BamB, an enzyme subunit involved in anaerobic degradation of 6

monoaromatic compounds in Geobacter species (9), was monitored in petroleum-contaminated 7

groundwater at the previously described (5, 14) U. S. Geological Survey Groundwater Toxics 8

Site in Bemidji, Minnesota. Previous studies have shown that Geobacter species are enriched in 9

zones at this site in which monoaromatic hydrocarbons are anaerobically degraded with the 10

reduction of Fe(III) (1, 14, 40). Groundwater samples were collected along the groundwater 11

flow path in the summer of 2009 with previously described methods (23, 32). 12

Design of antigens. 13

Antibodies were produced against polypeptides that were designed to be specific to the 14

citrate synthase or NifD of Geobacter species in the subsurface clade 1, because the majority of 15

Geobacteraceae 16S rRNA sequences recovered from the uranium-contaminated aquifer 16

clustered in this phylogenetic clade (23). The BamB-specific antibody was designed to be 17

specific to the BamB homologues found in G. metallireducens, G. bemidjiensis, Geobacter sp. 18

M21, and Geobacter daltonii (previously strain FRC-32), which are the Geobacter species 19

known to metabolize mono-aromatic compounds. The selected amino acid sequences of the 20

polypeptides are TDMLEKWAAEGGGRKM for the citrate synthase-specific antibody, 21

ALEIYPEKAKKKEAP for the NifD-specific antibody, and DTELYLGGLGTNAK for the 22


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

BamB-specific antibody. Synthesis of these polypeptides and production of the polyclonal 1

antibodies in rabbits against these polypeptides were performed by New England Peptide, LLC. 2

Purification of the recombinant citrate synthase, NifD and BamB. 3

Purified citrate synthase, NifD and BamB of G. bemidjiensis served as standards for 4

Western blot analyses. The genes of gltA, nifD, and bamB were amplified by using primers of 5

GbemCS1Nd (5’-TCTCATATGACGCAATTAAAAGAGAA-3’) and GbemCS1HisH3 (5’-6

TCTAAGCTTAGTGGTGGTGGTGGTGGTGCATCTTCCTGCCGCC CTCGGCA-3’) for gltA, 7

NifDF_Nd (5’-GGGAGGGGGCATATGCTGAATAAGGAG-3’) and NifDR_H3 (5’- 8

TTAATCTGCAAGCTTAAAGGGCGCCT-3’) for nifD, and BamBF_Nd (5’-9

GGGTAACCATATGAGGTATGCAGAG-3’) and BamBR_H3_His (5’-10

CGTTTTGAAGCTTAGTGGTGGTGGTGGTGGTGCGGCTGTACCCCTCCACT-3’) for 11

bamB. Amplified PCR products were digested with NdeI and HindIII, and ligated to pET24b 12

(Novagen) treated with same enzymes. E. coli BL21 (DE3) (42) cells harboring correctly cloned 13

plasmids were used for expression of His-tagged citrate synthase, NifD or BamB. Purified His-14

tagged proteins were obtained using Ni-NTA agarose (Qiagen) according to the manufacturer’s 15

protocol. 16

Protein extraction and Western blot analyses. 17

BugBuster® Master Mix (Novagen) was used to extract proteins from pure cultures 18

according to the manufacturer’s protocol. To extract proteins from the filters that collected 19

microorganisms in the groundwater samples, approximately 0.4 g of crushed filters were 20

dispended into Lysing Matrix E (MP biomedicals). One mililiter of lysis buffer containing 100 µl 21

of MT Buffer (MP biomedicals) and 2x Complete Mini protease inhibitor cocktail (Roche) in 1x 22

PBS buffer (13.7 mM NaCl, 0.27 mM KCl, 0.8 mM Na2HPO4, and 0.2 mM KH2PO4) was added 23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

to each tube, and mixed by a bead-beater (Mini beadbeater ™, BioSpec Products) for 45 s. After 1

centrifugation for 10 min at 13,000 x g, supernatant was collected, and concentrated by 2

ultrafiltration using Microcon® Centrifugal filter units (cut–off of 10 kD, Millipore). 3

Protein samples extracted as described above were loaded on a 10 % SDS-PAGE gel, and 4

transferred to a PVDF membrane (Millipore). Western blot analyses were performed according 5

to a standard protocol (6) with 1:1 mixture of SuperSignal West Pico Chemiluminescent 6

Substrate and SuperSignal West Femto Chemiluminescent Substrate (Thermo Scientific). 7

Signals were visualized by Typhoon 9210 (GE Healthcare), and intensity of each signal was 8

acquired by using ImageQuant TL software (GE Healthcare). 9

RNA isolation and quantitative RT-PCR (qRT-PCR). 10

Total RNA was isolated from pure cultures with an RNeasy mini kit (Qiagen) according 11

to the manufacturer’s protocol. For groundwater samples, RNA was extracted from the crushed 12

filters with the previously described protocol (20). After DNaseI treatment of the total RNA 13

solution with a Turbo DNA-free kit (Ambion), cDNA was synthesized using

an Enhanced Avian 14

Reverse transcriptase kit (Sigma). Quantification of cDNA was carried out by qRT-PCR using 15

Power SYBR Green PCR Master Mix (Applied Biosystems) and the 7500 Real-Time PCR 16

system (Applied Biosystems). The amplification program consisted of one cycle of 50 °C for 2 17

min, one cycle of 95°C for 10 min, followed by 45 cycles of 95°C for 15 s, and 60°C

for 60 s. 18

The primers used for qRT- PCR include gltAF (5’-CCATTCATCATACAACCTCAA-3’) and 19

gltAR (5’-GATGAAGTACATCCTTGCCA-3’) for gltA, GeonifD58F and GeonifD242R (42) for 20

nifD, and GeorecA147F and GeorecA292R (42) for recA. Quantification of each gene transcript 21

was determined using standard curves acquired by serial dilutions of known amounts of DNA 22

23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

Results and Discussion 1

2

Citrate synthase. 3

It might be expected from previous results on gene transcript abundance (21) that the 4

abundance of the unique citrate synthase of Geobacter species (7) might be linked to rates of 5

their rates of metabolism. Pure culture studies with G. bemidjiensis (34), which is closely related 6

to Geobacter species that predominate at the Rifle site (23, 45-46), demonstrated that, as was 7

previously observed with G. sulfurreducens, transcript abundance of gltA, the gene for citrate 8

synthase, increased in response to higher rates of metabolism (Fig. 1A). In contrast, there was no 9

significant change in transcript abundance for the housekeeping gene recA. When the same 10

amount (0.1 µg) of the total cellular proteins from G. bemidjiensis cultures at the two dilution 11

rates was analyzed with the Geobacter citrate synthase antibody (Fig. 1B), the abundance of the 12

citrate synthase protein at the higher growth rate (105.7 + 7.31 ng / µg total protein; mean + 13

standard deviation, n=3) was ca. twice that at the lower growth rate (48.1 + 3.77 ng / µg total 14

protein), consistent with the difference in transcript abundance (Fig 1A). 15

In order to evaluate the relationship between Geobacter citrate synthase abundance and 16

availability of acetate during bioremediation, citrate synthase abundance was quantified in 17

samples from a uranium bioremediation field experiment in which previous analysis had 18

indicated there was substantial change in the expression of gltA in response to changes in acetate 19

availability (46). Citrate synthase was in low abundance prior to arrival of the added acetate, 20

increased dramatically as acetate arrived, and then declined to the initial level after acetate 21

amendments were stopped (Fig. 1C). These changes in abundance of citrate synthase tracked 22

with changes in transcript abundance for subsurface Geobacter citrate synthase genes (Fig. 1C). 23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

Nitrogen Fixation. 1

Evaluation of 30 species of Geobacteraceae revealed that all of them encode nitrogen 2

fixation genes (19). Geobacter species appear to fix atmospheric nitrogen in some petroleum- 3

and uranium-contaminated subsurface environments (4, 30), and their ability to fix nitrogen may 4

provide a competitive advantage over other Fe(III)-reducing microorganisms that are unable to 5

fix atmospheric nitrogen (48). Cells grown in the absence of ammonium produced a protein that 6

yielded a band on SDS-PAGE, between 50 kD and 75 kD, consistent with the molecular weight 7

of 54 kD for NifD (Fig. 2A). Western blot analysis with the antibody specific to NifD of 8

Geobacter species confirmed that this was NifD (Fig. 2B). 9

A previous study at the Rifle site identified a zone in which ammonium temporarily 10

became limiting for Geobacter species and transcription of the nitrogen fixation gene, nifD, was 11

induced (32). In order to determine whether this increased nifD transcription resulted in an 12

increase in NifD protein, samples from the same field study were evaluated with the Geobacter 13

NifD antibody. NifD concentrations were highest when ammonium was not detected (detection 14

limit approximately 2 µM) and decreased dramatically as ammonium became available (Fig. 2C). 15

This was consistent with transcript abundance data acquired by this study (Fig. 2C) and a 16

previous study (32). 17

Aromatics Metabolism. 18

Geobacter species are involved in the degradation of aromatic compounds in the Fe(III)-19

reduction zone of petroleum-contaminated aquifers (1, 8, 40). Strictly anaerobic 20

microorganisms have a unique enzyme complex that catalyzes an ATP-independent reductive 21

dearomatization of the benzene ring of benzoyl-CoA, a key intermediate in the degradation of 22

monoaromatic compounds (9, 25, 47). BamB is the catalytic subunit for this enzyme in G. 23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

metallireducens (24). Homologs of the BamB gene are also found in the genomes of other 1

Geobacter species known to be able to degrade aromatic compounds (25). The gene for BamB 2

is specifically expressed during growth on aromatic compounds (9, 25, 41, 47). 3

A BamB-specific antibody revealed that BamB was expressed when G. bemidjiensis was 4

grown with benzoate as the electron donor, but not acetate, whereas citrate synthase was 5

detected at comparable amounts in cells grown with either electron donor (Fig. 3A). Benzoate-6

grown cells contained approximately 12 ng of BamB and 45 ng of citrate synthase in 1 µg of the 7

total cell extract. 8

Analysis of samples from the uranium-contaminated site in Rifle, CO failed to detect 9

BamB (data not shown), consistent with the lack of petroleum contamination at this site. 10

However, BamB was present in some locations within the petroleum-contaminated aquifer in 11

Bemidji, MN (Fig. 3B). Analysis of Geobacter citrate synthase indicated that there were low 12

levels of Geobacter species at site 310, which is upgradient of the contaminant plume, and 13

within the zone (site 9801) of most intense contamination, where methane production is expected 14

to be the predominant terminal electron accepting process (Fig. 3C). Geobacter citrate synthase 15

quantities suggested that Geobacter species were more abundant down gradient at sites 533, 531, 16

510 and 515, consistent with previous studies which suggested that these were zones in which 17

Geobacter species were degrading aromatic hydrocarbons with the reduction of Fe(III) (1, 28, 18

40). BamB was most abundant in the first two sampling sites immediately down-gradient from 19

the most heavily contaminated portion of the aquifer and then declined more rapidly than citrate 20

synthase abundance along the groundwater flow path (Fig. 3B). This pattern suggests that 21

aromatic compounds were an important electron donor for Geobacter species closer to the source 22


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

of the aromatic hydrocarbons and that other electron donors were more important in feeding into 1

the TCA cycle at sites further down gradient. 2

Implications. 3

These results demonstrate that it is feasible to quantify key metabolic proteins in 4

groundwater samples in order to obtain insights into the physiological status and metabolic 5

capabilities of subsurface microorganisms. This approach has potential advantages over other 6

methods for diagnosing the physiological status of subsurface microorganisms. Once antibodies 7

for proteins of interest are developed, quantifying proteins is technically simpler than quantifying 8

gene transcript abundance. For the two proteins for which direct comparisons were made, citrate 9

synthase and NifD, the changes in transcript abundance tracked well with changes in the 10

concentrations of the corresponding proteins, suggesting that posttranscriptional regulation was 11

not an important factor. However, this may not be the case for all proteins and directly 12

quantifying enzymes may provide a better indication of metabolic capability than quantifying 13

gene transcripts. Although analysis of the full environmental proteome (11, 44-45) can provide a 14

more global inventory of proteins in the environment, it requires highly specialized equipment 15

that is only available to a few investigators. Antibody detection of proteins can be accomplished 16

with standardized kits (3) and, as reviewed in the Introduction, it is likely that analysis of 17

relatively few key proteins can provide: an indication of rates of metabolism; whether enzymes 18

for the degradation of key contaminants are present; and how microorganisms of interest are 19

responding to nutrient limitations and other stresses. If the abundance of proteins of interest is 20

normalized to the abundance of a housekeeping protein then additional information on how 21

protein levels are changing on a per cell basis might be obtained. However, our attempts to 22

normalize to RpoA, an appropriate housekeeping protein in pure culture studies, have not been 23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

consistent in field studies due to RpoA levels that were often below detection limits (unpublished 1

data). 2

Development of more sensitive and rapid methods would also expand the application of 3

this approach to proteins which are diagostic of important physiological functions, but that are 4

low in abundance. Immuno-PCR (35) might be one option. It is likely that samples from 5

environments which are more organic rich than the sandy aquifers investigated here might 6

require more sample purification to remove humic substances or other possible interferences. 7

Although the studies reported here focused on Geobacter species, the same approach 8

could be applied to other populations known to be important in subsurface bioremediation. For 9

example, numerous studies with Dehalococcoides have suggested key targets likely to be 10

diagnostic for reductive dechlorination and the overall metabolic activity of these organisms (16, 11

26, 38, 43). As genome-scale investigations of microorganisms involved in bioremediation 12

expand such an approach could be routinely applied to many forms of bioremediation (27). 13

Acknowledgments 14

We thank Paula Mouser, Lucie N’Guessan, Hila Elifantz, Dawn Holmes, and Melissa 15

Barlett for collecting samples from Rifle in 2007, and 2008. Also we thank Kenneth Williams, 16

Paula Mouser and Lucie N’Guessan for sharing geochemical data. This research was supported 17

by the Office of Science (BER), U.S. Department of Energy Environmental Remediation Science 18

Program Grant No. DE-FG02-07ER64377 and DE-SC0004814. 19

20

21


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

References 1

1. Anderson, R. T., J. N. Rooney-Varga, C. V. Gaw, and D. Lovley. 1998. Anaerobic benzene 2

oxidation in the Fe(III) reduction zone of petroleum-contaminated aquifers. Environ. Sci. Technol. 3

32:1222-1229. 4

2. Anderson, R. T., H. A. Vrionis, I. Ortiz-Bernad, C. T. Resch, P. E. Long, R. Dayvault, K. 5

Karp, S. Marutzky, D. R. Metzler, A. Peacock, D. C. White, M. Lowe, and D. R. Lovley. 6

2003. Stimulating the in situ activity of Geobacter species to remove uranium from the 7

groundwater of a uranium-contaminated aquifer. Appl. Environ. Microbiol. 69:5884-5891. 8

3. Banada, P. P., and A. K. Bhunia. 2008. Antibodies and immunoassays for detection of bacterial 9

pathogens, p. 567-602. In M. Zourob, S. Elwary, and A. P. F. Turner (ed.), Principles of bacterial 10

detection: biosensors, recognition receptors and microsystems. Springer, New York. 11

4. Bazylinski, D. A., A. J. Dean, D. Schuler, E. J. P. Phillips, and D. R. Lovley. 2000. N2 12

dependent growth and nitrogenase activity in the metal-metabolizing bacteria, Geobacter and 13

Magnetospirillum species. Environ. Microbiol. 2:266-273. 14

5. Bekins, B. A., I. M. Cozzarelli, E. M. Godsy, E. Warren, H. I. Essaid, and M. E. Tuccillo. 15

2001. Progression of natural attenuation processes at a crude oil spill site: II. Controls on spatial 16

distribution of microbial populations. J. Contam. Hydrol. 53:387-406. 17

6. Bollag, D. M., M. D. Rozycki, and S. J. Edelstein. 1996. Protein Methods, 2nd ed. Willey-Liss 18

Inc., New York. 19

7. Bond, D., T. Mester, C. Nesbo, A. Izquierdo-Lopez, F. Collart, and D. Lovley. 2005. 20

Characterization of citrate synthase from Geobacter sulfurreducens and evidence for a family of 21

citrate synthases similar to those of eukaryotes throughout the Geobacteraceae. Appl. Environ. 22

Microbiol. 71:3858 - 3865. 23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

8. Botton, S., M. van Harmelen, M. Braster, J. R. Parsons, and W. F. M. Roeling. 2007. 1

Dominance of Geobacteraceae in BTX-degrading enrichments from an iron-reducing aquifer. 2

FEMS Microbiol. Ecol. 62:118-130. 3

9. Butler, J., Q. He, K. Nevin, Z. He, J. Zhou, and D. Lovley. 2007. Genomic and microarray 4

analysis of aromatics degradation in Geobacter metallireducens and comparison to a Geobacter 5

isolate from a contaminated field site. BMC Genomics 8:180. 6

10. Caccavo, F., D. J. Lonergan, D. R. Lovley, M. Davis, J. F. Stolz, and M. J. McInerney. 1994. 7

Geobacter sulfurreducens sp. nov., a hydrogen- and acetate-oxidizing dissimilatory metal-8

reducing microorganism. Appl. Environ. Microbiol. 60:3752 - 3759. 9

11. Callister, S. J., M. J. Wilkins, C. D. Nicora, K. H. Williams, J. F. Banfield, N. C. 10

VerBerkmoes, R. L. Hettich, A. L. N' Guessan, P. J. Mouser, H. Elifantz, R. D. Smith, D. R. 11

Lovley, M. S. Lipton, and P. E. Long. 2010. Analysis of biostimulated microbial communities 12

from two field experiments reveals temporal and spatial differences in proteome profiles. Environ. 13

Sci. Technol. 44:8897-8903. 14

12. Coppi, M. V., C. Leang, S. J. Sandler, and D. R. Lovley. 2001. Development of a genetic 15

system for Geobacter sulfurreducens. Appl. Environ. Microbiol. 67:3180-3187. 16

13. Elifantz, H., L. A. N'Guessan, P. J. Mouser, K. H. Williams, M. J. Wilkins, C. Risso, D. E. 17

Holmes, P. E. Long, and D. R. Lovley. 2010. Expression of acetate permease-like (apl) genes in 18

subsurface communities of Geobacter species under fluctuating acetate concentrations. FEMS 19

Microbiol. Ecol. 73:441-449. 20

14. Essaid, H. I., B. A. Bekins, W. N. Herkelrath, and G. N. Delin. 2009. Crude oil at the Bemidji 21

Site: 25 years of monitoring, modeling, and understanding. Ground Water:no. doi: 22

10.1111/j.1745-6584.2009.00654.x. 23

15. Esteve-Nunez, A., M. Rothermich, M. Sharma, and Derek Lovley. 2005. Growth of 24

Geobacter sulfurreducens under nutrient-limiting conditions in continuous culture. Environ. 25

Microbiol. 7:641-648. 26


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

16. Fung, J. M., R. M. Morris, L. Adrian, and S. H. Zinder. 2007. Expression of reductive 1

dehalogenase genes in Dehalococcoides ethenogenes strain 195 growing on tetrachloroethene, 2

trichloroethene, or 2,3-dichlorophenol. Appl. Environ. Microbiol. 73:4439-4445. 3

17. Holmes, D. E., K. T. Finneran, R. A. O'Neil, and D. R. Lovley. 2002. Enrichment of members 4

of the family Geobacteraceae associated with stimulation of dissimilatory metal reduction in 5

uranium-contaminated aquifer sediments. Appl. Environ. Microbiol. 68:2300-2306. 6

18. Holmes, D. E., T. Mester, R. A. O'Neil, L. A. Perpetua, M. J. Larrahondo, R. Glaven, M. L. 7

Sharma, J. E. Ward, K. P. Nevin, and D. R. Lovley. 2008. Genes for two multicopper proteins 8

required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression 9

patterns both in the subsurface and on energy-harvesting electrodes. Microbiology 154:1422-10

1435. 11

19. Holmes, D. E., K. P. Nevin, and D. R. Lovley. 2004. Comparison of 16S rRNA, nifD, recA, 12

gyrB, rpoB and fusA genes within the family Geobacteraceae fam. nov. Int. J. Syst. Evol. 13

Microbiol. 54:1591-1599. 14

20. Holmes, D. E., K. P. Nevin, and D. R. Lovley. 2004. In Situ expression of nifD in 15

Geobacteraceae in subsurface sediments. Appl. Environ. Microbiol. 70:7251-7259. 16

21. Holmes, D. E., K. P. Nevin, R. A. O'Neil, J. E. Ward, L. A. Adams, T. L. Woodard, H. A. 17

Vrionis, and D. R. Lovley. 2005. Potential for quantifying expression of the Geobacteraceae 18

citrate synthase gene to assess the activity of Geobacteraceae in the subsurface and on current-19

harvesting electrodes. Appl. Environ. Microbiol. 71:6870 - 6877. 20

22. Holmes, D. E., R. A. O'Neil, M. A. Chavan, L. A. N'Guessan, H. A. Vrionis, L. A. Perpetua, 21

M. J. Larrahondo, R. DiDonato, A. Liu, and D. R. Lovley. 2009. Transcriptome of Geobacter 22

uraniireducens growing in uranium-contaminated subsurface sediments. ISME J. 3:216-230. 23

23. Holmes, D. E., R. A. O'Neil, H. A. Vrionis, L. A. N'Guessan, I. Ortiz-Bernad, M. J. 24

Larrahondo, L. A. Adams, J. A. Ward, J. S. Nicoll, K. P. Nevin, M. A. Chavan, J. P. 25


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

Johnson, P. E. Long, and D. R. Lovley. 2007. Subsurface clade of Geobacteraceae that 1

predominates in a diversity of Fe(III)-reducing subsurface environments. ISME J. 1:663 - 677. 2

24. Kung, J., C. Loffler, K. Dorner, D. Heintz, S. Gallien, A. Van Dorsselaer, T. Friedrich, and 3

M. Boll. 2009. Identification and characterization of the tungsten-containing class of benzoyl-4

coenzyme A reductases. Proc. Natl. Acad. Sci. U.S.A. 106:17687 - 17692. 5

25. Löffler, C., K. Kuntze, J. R. Vazquez, A. Rugor, J. W. Kung, A. Böttcher, and M. Boll. 2011. 6

Occurrence, genes and expression of the W/Se-containing class II benzoyl-coenzyme A 7

reductases in anaerobic bacteria. Environ. Microbiol. 13:696-709. 8

26. Lee, P. K., T. W. Macbeth, K. S. Sorenson, Jr., R. A. Deeb, and L. Alvarez-Cohen. 2008. 9

Quantifying genes and transcripts to assess the in situ physiology of "Dehalococcoides" spp. in a 10

trichloroethene-contaminated groundwater site. Appl. Environ. Microbiol. 74:2728-2739. 11

27. Lovley, D. R. 2003. Cleaning up with genomics: applying molecular biology to bioremediation. 12

Nat. Rev. Microbiol. 1:35-44. 13

28. Lovley, D. R., M. J. Baedecker, D. J. Lonergan, I. M. Cozzarelli, E. J. P. Phillips, and D. I. 14

Siegel. 1989. Oxidation of aromatic contaminants coupled to microbial iron reduction. Nature 15

339:297-299. 16

29. Mahadevan, R., B. O. Palsson, and D. R. Lovley. 2011. In situ to in silico and back: elucidating 17

the physiology and ecology of Geobacter spp. using genome-scale modelling. Nat. Rev. 18

Microbiol. 9:39-50. 19

30. Methe, B. A., J. Webster, K. Nevin, J. Butler, and D. R. Lovley. 2005. DNA Microarray 20

analysis of nitrogen fixation and Fe(III) reduction in Geobacter sulfurreducens. Appl. Environ. 21

Microbiol. 71:2530-2538. 22

31. Mouser, P. J., D. E. Holmes, L. A. Perpetua, R. DiDonato, B. Postier, A. Liu, and D. R. 23

Lovley. 2009. Quantifying expression of Geobacter spp. oxidative stress genes in pure culture 24

and during in situ uranium bioremediation. ISME J. 3:454-465. 25


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

32. Mouser, P. J., A. L. N' Guessan, H. Elifantz, D. E. Holmes, K. H. Williams, M. J. Wilkins, P. 1

E. Long, and D. R. Lovley. 2009. Influence of heterogeneous ammonium availability on 2

bacterial community structure. Environ. Sci. Technol. 43:4386-4392. 3

33. N'Guessan, A. L., H. Elifantz, K. P. Nevin, P. J. Mouser, B. Methe, T. L. Woodard, K. 4

Manley, K. H. Williams, M. J. Wilkins, J. T. Larsen, P. E. Long, and D. R. Lovley. 2010. 5

Molecular analysis of phosphate limitation in Geobacteraceae during the bioremediation of a 6

uranium-contaminated aquifer. ISME J. 4:253-266. 7

34. Nevin, K. P., D. E. Holmes, T. L. Woodard, E. S. Hinlein, D. W. Ostendorf, and D. R. 8

Lovley. 2005. Geobacter bemidjiensis sp. nov. and Geobacter psychrophilus sp. nov., two novel 9

Fe(III)-reducing subsurface isolates. Int. J Syst. Evol. Microbiol. 55:1667-1674. 10

35. Niemeyer, C. M., M. Adler, and R. Wacker. 2005. Immuno-PCR: high sensitivity detection of 11

proteins by nucleic acid amplification. Trends Biotechnol. 23:208-216. 12

36. North, N. N., S. L. Dollhopf, L. Petrie, J. D. Istok, D. L. Balkwill, and J. E. Kostka. 2004. 13

Change in bacterial community structure during in situ biostimulation of subsurface sediment 14

cocontaminated with uranium and nitrate. Appl. Environ. Microbiol. 70:4911-4920. 15

37. O'Neil, R. A., D. E. Holmes, M. V. Coppi, L. A. Adams, M. J. Larrahondo, J. E. Ward, K. P. 16

Nevin, T. L. Woodard, H. A. Vrionis, A. L. N'Guessan, and D. R. Lovley. 2008. Gene 17

transcript analysis of assimilatory iron limitation in Geobacteraceae during groundwater 18

bioremediation. Environ. Microbiol. 10:1218-1230. 19

38. Rahm, B. G., and R. E. Richardson. 2008. Dehalococcoides' gene transcripts as quantitative 20

bioindicators of tetrachloroethene, trichloroethene, and cis-1,2-dichloroethene dehalorespiration 21

rates. Environ. Sci. Technol. 42:5099-5105. 22

39. Roling, W., B. van Breukelen, M. Braster, B. Lin, and H. van Verseveld. 2001. Relationships 23

between microbial community structure and hydrochemistry in a landfill leachate-polluted aquifer. 24

Appl. Environ. Microbiol. 67:4619 - 4629. 25


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

40. Rooney-Varga, J. N., R. T. Anderson, J. L. Fraga, D. Ringelberg, and D. R. Lovley. 1999. 1

Microbial communities associated with anaerobic benzene degradation in a petroleum-2

contaminated aquifer. Appl. Environ. Microbiol. 65:3056 - 3063. 3

41. Schleinitz, K. M., S. Schmeling, N. Jehmlich, M. von Bergen, H. Harms, S. Kleinsteuber, C. 4

Vogt, and G. Fuchs. 2009. Phenol degradation in the strictly anaerobic iron-reducing bacterium 5

Geobacter metallireducens GS-15. Appl. Environ. Microbiol. 75:3912-3919. 6

42. Studier, F. W., A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff. 1990. Use of T7 RNA 7

polymerase to direct expression of cloned genes. Methods Enzymol. 185:60-89. 8

43. Werner, J. J., A. C. Ptak, B. G. Rahm, S. Zhang, and R. E. Richardson. 2009. Absolute 9

quantification of Dehalococcoides proteins: enzyme bioindicators of chlorinated ethene 10

dehalorespiration. Environ. Microbiol. 11:2687-2697. 11

44. Wilkins, M. J., S. J. Callister, M. Miletto, K. H. Williams, C. D. Nicora, D. R. Lovley, P. E. 12

Long, and M. S. Lipton. 2011. Development of a biomarker for Geobacter activity and strain 13

composition; Proteogenomic analysis of the citrate synthase protein during bioremediation of 14

U(VI). Microbial Biotechnol. 4:55-63. 15

45. Wilkins, M. J., N. C. VerBerkmoes, K. H. Williams, S. J. Callister, P. J. Mouser, H. Elifantz, 16

A. L. N'Guessan, B. C. Thomas, C. D. Nicora, M. B. Shah, P. Abraham, M. S. Lipton, D. R. 17

Lovley, R. L. Hettich, P. E. Long, and J. F. Banfield. 2009. Proteogenomic monitoring of 18

Geobacter physiology during stimulated uranium bioremediation. Appl. Environ. Microbiol. 19

75:6591-6599. 20

46. Williams, K. H., P. E. Long, J. A. Davis, M. J. Wilkins, A. L. N' Guessan, L. Yang, D. 21

Newcomer, F. A. Spane, L. J. Kerkhof, L. McGuinness, R. D. Dayvault, and D. R. Lovley. 22

2011. Acetate availability and its influence on sustainable bioremediation of uranium-23

contaminated groundwater. Geomicrobiol. J.:In press. 24


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

47. Wischgoll, S., D. Heintz, F. Peters, A. Erxleben, E. Sarnighausen, R. Reski, A. Van 1

Dorsselaer, and M. Boll. 2005. Gene clusters involved in anaerobic benzoate degradation of 2

Geobacter metallireducens. Mol. Microbiol. 58:1238-1252. 3

48. Zhuang, K., M. Izallalen, P. Mouser, H. Richter, C. Risso, R. Mahadevan, and D. R. Lovley. 4

2011. Genome-scale dynamic modeling of the competition between Rhodoferax and Geobacter in 5

anoxic subsurface environments. ISME J. 5:305-316. 6

7

8

Figure Legends 9

10

Figure 1. Citrate synthase abundance in Geobacter bemidjiensis and groundwater during in 11

situ uranium bioremediation. (A) Transcript abundance of the citrate synthase gene, gltA, and 12

the housekeeping gene, recA, in steady-state cells of G. bemidjiensis grown in chemostats at 13

dilution rates of 0.03 h-1

and 0.07 h-1

. (B) Western blot analysis of citrate synthase standards and 14

of cellular protein from G. bemidjiensis chemostat cultures. The detection limit for citrate 15

synthase was 2.5 ng and the citrate synthase signals were linear between 2.5 ng and 160 ng. (C) 16

Acetate concentration (46) and gltA transcripts and citrate synthase in groundwater during in situ 17

uranium bioremediation. Error bars represent one standard deviation from the mean of triplicate 18

determinations. Inset shows Western blot analysis of the groundwater samples. 19

Figure 2. NifD abundance in Geobacter sulfurreducens and groundwater during in situ 20

uranium bioremediation.(A) SDS-PAGE of G. sulfurrreducens proteins stained with 21

Coomassie Brilliant Blue R250 with unique protein band generated in cells grown in the absence 22

of ammonium designated with the arrow. (B) Western analysis of NifD standards and 23

confirmation of NifD production only in cells grown in the absence of ammonium with Western 24


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

blot analysis. The detection limit for NifD was 2.5 ng and the NifD signals were linear between 1

2.5 ng and 40 ng. (C) Ammonium (32), nifD transcripts, and NifD in groundwater during in situ 2

uranium bioremediation. Error bars represent one standard deviation from the mean of triplicate 3

determinations. Top panel shows Western blot analysis of the groundwater samples. 4

5

Figure 3. BamB in Geobacter bemidjiensis and groundwater from a petroleum-6

contaminated aquifer. (A) Western blot analysis of BamB in G. bemidjiensis growth with either 7

acetate (A) or benzoate (B) as the electron donor for growth with fumarate (Fum) or Fe(III) as 8

the electron acceptor and BamB standards. The detection limit for BamB was 5 ng and the BamB 9

signals were linear between 5 ng and 160 ng. (B) Map designating sampling well locations 10

modified from the maps available at http://mn.water.usgs.gov/projects/bemidji/maps.html.(C) 11

Abundance of Geobacter BamB and citrate synthase in the groundwater. Error bars represent 12

one standard deviation from the mean of triplicate determinations. 13

14


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Monitoring the Metabolic Status of Geobacter Species...

Documents

Transcript of Monitoring the Metabolic Status of Geobacter Species...