Proc. Natl. Acad. Sci. USAVol. 94, pp. 8405–8410, August 1997Biochemistry

Monitoring protein–protein interactions in intact eukaryotic cellsby b-galactosidase complementation

FABIO ROSSI, CAROL A. CHARLTON, AND HELEN M. BLAU*Department of Molecular Pharmacology, Stanford University School of Medicine, Stanford, CA 94305-5332

Communicated by Lubert Stryer, Stanford University School of Medicine, Stanford, CA, June 3, 1997 (received for review April 20, 1997)

ABSTRACT We present an approach for monitoring pro-tein–protein interactions within intact eukaryotic cells, whichshould increase our understanding of the regulatory circuitrythat controls the proliferation and differentiation of cells andhow these processes go awry in disease states such as cancer.Chimeric proteins composed of proteins of interest fused tocomplementing b-galactosidase (b-gal) deletion mutants permita novel analysis of protein complexes within cells. In thisapproach, the b-gal activity resulting from the forced interactionof nonfunctional weakly complementing b-gal peptides (Da andDv) serves as a measure of the extent of interaction of thenon-b-gal portions of the chimeras. To test this application oflacZ intracistronic complementation, proteins that form a com-plex in the presence of rapamycin were used. These proteins,FRAP and FKBP12, were synthesized as fusion proteins with Daand Dv, respectively. Enzymatic b-gal activity served to monitorthe formation of the rapamycin-induced chimeric FRAPyFKBP12 protein complex in a time- and dose-dependent manner,as assessed by histochemical, biochemical, and fluorescence-activated cell sorting assays. This approach may prove to be avaluable adjunct to in vitro immunoprecipitation and crosslink-ing methods and in vivo yeast two-hybrid and fluorescence energytransfer systems. It may also allow a direct assessment of specificprotein dimerization interactions in a biologically relevant con-text, localized in the cell compartments in which they occur, andin the milieu of competing proteins.

Specific interactions between proteins in mammalian cells arethe basis of many essential biological processes. For example,protein–protein interactions are involved in the assembly ofenzymes and other protein homodimers and heterodimers thatplay important roles in the regulation of intracellular transportpathways, gene expression, receptor–ligand interactions, andin the therapeutic or toxic effects of administered drugs. Toincrease our understanding of these biological processes, sev-eral techniques have been developed for examining the inter-actions between proteins within cells. Coimmunoprecipitationexperiments with antibodies are suggestive of such interactionsin that they allow a determination of the affinity of a givenprotein for another protein, albeit in vitro following cell lysisunder conditions that cannot determine whether the twoproteins are present within the same compartment or at theconcentrations tested (1–3). Methods for crosslinking proteinswithin the cell and then cofractionating them by chromatog-raphy have also proven useful, although purification, sequenc-ing, and identification of the crosslinked proteins can bedifficult when they are present in small quantities.

In addition to such biochemical techniques, the yeast two-hybrid system has been extremely useful for detecting and iden-tifying protein–protein interactions in vivo (4–6). This systemtakes advantage of the properties of the GAL4 protein of the

yeast Saccharomyces cerevisiae, a transcriptional activator re-quired for the expression of genes encoding enzymes involved ingalactose utilization. The GAL4 protein consists of two separateand identifiable domains, an N-terminal DNA binding domainand a C-terminal transcription activation domain. Separate fusionproteins, each comprising only one of the two GAL4 domainsfused to one of two different test polypeptides, interact throughaffinity of the different test polypeptides, bringing two GAL4domains into close physical proximity and reconstituting GAL4function. A distinct advantage of this approach over biochemicalapproaches is that it allows identification of novel protein partnersat a molecular level. However, the system requires that protein–protein interactions occur in the nucleus of a cell leading totranscriptional activation of a reporter gene and the detection ofa diffusible product. Thus, the assay is indirect and is dependenton other cellular functions. Nonetheless, numerous previouslyunknown protein interactions have been identified using the yeasttwo-hybrid system.

Fluorescence ratio imaging has also been used to studyprotein interactions in live cells (7). This innovative system hasyielded several important new findings. However, it is limitedby the requirement that the fluorescent labels on the inter-acting proteins be sufficiently close to permit efficient energytransfer. Also, the labeled proteins need to be introduced intothe cells at relatively high concentrations. Clearly, a methodthat would allow a direct examination of molecular interactionswith fewer size constraints, at the site where they occur withina eukaryotic cell, would be advantageous.

Here we describe a novel application of the bacterial lacZgene that may allow the direct detection of protein–proteininteractions in situ in a range of cell types and species. Theproduct of the lacZ gene, b-galactosidase (b-gal), has beenused for many years as a reporter gene to measure transcrip-tional activity by histochemical or biochemical assays or by livecell sorting (8–11). A property of the lacZ gene, intracistroniccomplementation, has been known and studied for many yearsin prokaryotes (12–14), but has only recently been adapted foruse in eukaryotes (15). Pairs of inactive b-gal deletion mutantsare capable of complementing one another in trans andassembling to form an active enzyme. Pairs of deletion mutantsthat complement with either high or low efficiency wereidentified (15, 16). In previous studies of myoblast fusion, themost efficient complementing pair was employed to analyzethe putative role of cell adhesion and signal transductionmolecules in this poorly understood process (17).

As reported here, pairs of inactive b-gal deletion mutantswere used to produce chimeric proteins to test whether thecomplemented enzyme could serve as a marker of otherprotein–protein interactions (see Fig. 1). Several features werecritical in the application of this approach. Most important wasthe necessity to select b-gal mutants with sufficiently lowaffinity for each other so that they monitored rather than drove

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked ‘‘advertisement’’ inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

© 1997 by The National Academy of Sciences 0027-8424y97y948405-6$2.00y0PNAS is available online at http:yywww.pnas.org.

Abbreviations: b-gal, b-galactosidase; FACS, fluorescence-activatedcell sorting; FKBP12, FK506-binding protein-12; FRAP, FKBP–rapamycin associated protein.*To whom reprint requests should be addressed.

8405

Dow

nloa

ded

by g

uest

on

Nov

embe

r 29

, 202

1

the association of the test proteins. Our biochemical, histo-chemical, and fluorescence-activated cell sorting (FACS) ex-periments show that appropriate b-gal mutants can be incor-porated into fusion proteins that serve as tracers of protein–protein interactions in intact eukaryotic cells.

MATERIALS AND METHODSConstruction of pWZL FRAP-Da and pWZL FKBP12-Dv

Viruses. To be able to fuse the sequences coding for FKBP12 andthe FKBP12–rapamycin binding domain in-frame with b-gal, anadaptor oligonucleotide (CATGGAGCTCGAGAG) containingan XhoI site was inserted in the NcoI site at the ATG of thepreviously described Da and Dv b-gal mutants (15). Two XhoI–SalI DNA fragments corresponding to amino acids 2025–2114 ofhuman FRAP and to the complete coding sequence of humanFKBP12 (kind gifts of Gerald Crabtree, Stanford UniversitySchool of Medicine) were cloned into the XhoI site of themodified Da and Dv mutants, generating FRAP-Da andFKBP12-Dv. For both constructs, conservation of the appropri-ate reading frame was confirmed by sequencing.

To insert the FRAP-Da and FKBP12-Dv coding sequences inpWZL-neo and pWZL-hygro retroviruses (P. J. Morgenstern,unpublished work), an adaptor oligonucleotide containing NcoIand BamHI sites (GATCACCATGGACGCGTGGATCCC)was inserted in the BamHI and XhoI sites of the pWZL vectors.Both of the original sites were destroyed by this insertion. TheFRAP-Da and FKBP12-Dv coding sequences were then insertedin the modified pWZL vectors as NcoI–BamHI fragments.

Virus Production and Infection Protocol. Proviral constructswere introduced into the Phoenix ecotropic packaging cells (P. L.Achacoso and G. P. Nolan, unpublished work) by calcium phos-phate transfection. The media-containing retrovirus from thepackaging cells was harvested 24–72 hr after transfection andused to infect C2C12 myoblasts (18) in the presence of 8 mgymlpolybrene (Sigma). Singly and doubly infected cells were selectedwith the appropriate drugs. Both G418 and hygromycin were usedat a final concentration of 1 mgyml. The selected cells wereexpanded as populations for subsequent experiments.

Quantitation of b-Gal Activity. Unless otherwise stated, rapa-mycin (Calbiochem) was used at a concentration of 10 ngyml.

Biochemical quantitation of b-gal activity. b-gal activity wasmeasured by chemiluminescence as described (15). Briefly,cells cultured in microtiter plates were lysed in situ in 50 ml ofa 1:1 mixture of lysis and assay buffers containing GalactonPlus substrate from the Galacto-Light Plus assay kit (Tropix,Bedford, MA). Reactions were terminated after 1 hr at roomtemperature. After addition of Light Emission Acceleratorsolution, luminescence was measured using a MicroBeta 1450scintillation counter (Wallac, Gaithersburg, MD).

Histochemical detection of b-gal using fluorescence histo-chemistry (Fluor-X-Gal). Cells were processed as described(15). Briefly, cells grown on glass coverslips were fixed in 4%paraformaldehyde in PBS and rinsed twice with PBS. Fortriple-labeling (actin, b-gal, and nuclei), fixed cells were firststained for actin by incubation in a solution of 1 mM biotin-XX-phalloidin (Molecular Probes) for 30 min at room tem-perature, followed by PBS rinses and incubation in Cy5-labeledstreptavidin (Amersham) (1:250 in PBS, 30 min, room tem-perature). b-gal was detected by incubation of fixed cells in asolution of 25 mgyml 5-bromo-6-chloro-3-indolyl b-D galacto-pyranoside (Fluka) plus 100 mgyml fast red violet LB (Sigma)in PBS for 45 min at 37°C. Coverslips were rinsed 4 times withPBS, nuclei labeled with Hoechst 33258 (Calbiochem; 1:10,000in PBS), rinsed again, mounted in PBS, and sealed to glassslides. Triple-labeled deconvolved images were collected usinga DeltaVision deconvolution microscope (Applied Precision,Mercer Island, WA). Images were represented in false colorusing Adobe Photoshop software. Fluor-X-Gal staining can bedetected with either fluorescein or rhodamine filters; in thiscase, detection was with the rhodamine filter, and is depicted

in green (see Fig. 3 C and D). Cy5 was detected with a Cy5 filterand is depicted in red; Hoechst was detected with a DAPI filterand is depicted in blue (see Fig. 3 C and D). Double-labeledcells were photographed using a Zeiss Axiophot fluorescencemicroscope. Fluor-X-Gal staining was detected with a rhoda-mine filter and appears red; Hoechst was detected with a UVfilter (see Fig. 3 A and B).

FACS. b-gal expression in live cells was determined on a FACSas described (10), except that the fluorescein di-b-D-galactopyr-anoside substrate was used at a concentration of 1 mM.

RESULTSDesign of Fusion Protein Test System for Monitoring Inter-

actions Using Complementing b-Gal Mutants. We have recentlyadapted lacZ intracistronic complementation for use in eukary-otic cells (15). For the purpose of testing the potential applicationof b-gal complementation as a method to monitor protein–protein interactions, a pair of mutants was selected that containedthe domains postulated to be necessary for trans-complementa-tion, but which were impaired in their ability to restore enzymaticactivity upon coexpression in mammalian cells. These mutantswere the classical v donor M15 (hereafter referred to as Da),which lacks amino acids 11–41 of the wild-type molecule, and anunusually long a donor containing the first 788 amino acids ofb-gal (Dv) (15). Since both polypeptides are capable of efficientlycomplementing a third deletion mutant (Dm, lacking 553 aminoacids in the central portion of the molecule), it seemed unlikelythat their poor ability to complement each other was due toinstability or to low expression. Inefficient a donors have longbeen known to exist in prokaryotes, and differences in theirfolded structure that render the a domain unavailable for comple-mentation have been proposed as a basis for their biochemicalproperties (16). One model separates the b-gal complementationmechanism into two steps: rapid formation of a complex betweena and v donor peptides, followed by a slow conformationalchange from an inactive to an active conformation (19, 20).Which of these two steps was impaired in inefficient a donors wasunclear. We reasoned that if complex formation but not catalyticactivity were impaired, it should be possible to obtain efficientcomplementation by promoting the heterodimerization of weaklycomplementing Da and Dv b-gal mutants.

To test this hypothesis, we used a well-characterized proteincomplex (21–24). The intracellular rapamycin binding protein,FK506-binding protein-12 (FKBP12), interacts with the intra-cellular FKBP–rapamycin associated protein (FRAP) onlywhen rapamycin is present in the culture medium. This inter-action is well documented to increase over time and with thedose of rapamycin. Rapamycin is a small, cell-permeablemolecule that binds to the two intracellular proteins viaindependent determinants. Since rapamycin is unable to bindtwo FKBP12 molecules at the same time and FRAP only bindsrapamycin within the FKBP12-rapamycin complex, het-erodimers do not form unless rapamycin is present (25).

Specifically, the test system involved combining the weaklycomplementing b-gal mutants, Da or Dv, with the FKBP12yFRAPyrapamycin system by producing fusion proteins. Twodifferent retroviral constructs were designed that encodedfusion proteins of either the FKBP12–rapamycin bindingdomain of FRAP or the entire FKBP12 peptide together withthe b-gal Da or Dv mutants, respectively (FRAP-Da andFKBP12-Dv). A prediction of the hypothesis is that introduc-tion of these fusion proteins into cells would result in negligibleb-gal activity in the absence of rapamycin (Fig. 1A). Thus,b-gal activity would first become detectable upon addition ofdrug. As a result, b-gal activity would monitor the associationof FRAP and FKBP12 proteins (green and red proteins andcDNAs in Fig. 1 B and C, respectively).

A critical feature of the design of the system presented herewas to reduce protein expression levels as much as possible toavoid perturbing the intracellular protein milieu. Accordingly,

8406 Biochemistry: Rossi et al. Proc. Natl. Acad. Sci. USA 94 (1997)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 29

, 202

1

the fusion proteins should serve as ‘‘tracers’’ of naturallyoccurring protein–protein interactions, overcoming the prob-lems previously experienced upon overexpression of intro-duced proteins either by transient or stable transfection, ortransduction with retroviruses. To reduce expression levels, inthe experiments reported here the cDNAs encodingFRAP-Da and FKBP12-Dv were not inserted into MFG, butinto the pWZL retroviral vector (P. J. Morgenstern, unpub-lished work), upstream of the gene encoding hygromycin orneomycin, respectively. The levels of protein expression arereduced in the pWZL vector due to the presence of mutationsthat delete the splice donoryacceptor sequences upstream ofthe ATG of the fusion proteins. These mutations result in alower translation efficiency of the first coding sequence of abicistronic message, but do not affect the translation of thesecond sequence, in this case the selectable marker, which issolely dependent on an encephalomyocarditis virus internalribosomal entry sequence. Using a pWZL vector, 50% less ofthe upstream protein is expressed compared with vectorscontaining wild-type splice donoryacceptor sequences (datanot shown). As a result of the reduced levels of expression thefrequency of spontaneous interactions of b-gal mutants, whichis concentration dependent, should be significantly reduced.

Induction of b-Gal Activity on Coexpression of FRAP-Daand FKBP12-Dv Fusion Proteins in the Presence of Rapa-mycin. The FRAP-Da-Neo and FKBP12-Dv-Hygro vectorswere tested in an established line of myoblasts, C2C12 (18).Infectious viral particles were produced by transient transfec-tion of each construct into the Phoenix packaging cell line(P. L. Achacoso and G. P. Nolan, unpublished work). C2C12myoblasts were infected either singly with each retrovirusalone or simultaneously with both. All experiments wereperformed after selection with hygromycin and G418 to ensurethat 100% of the cells contained the constructs.

b-gal activity was measured in biochemical assays and found tobe dependent on the presence of rapamycin in the medium.C2C12 cells expressing both fusion proteins were plated in

replicate in 96-well plates. Rapamycin was added to the culturemedium, and the b-gal activity was measured at different timepoints. For each time point, six replicate samples were assayedwith a sensitive chemiluminescence assay, as described (15). Inuntreated control samples, no b-gal activity was detected abovebackground. Rapamycin at a concentration of 10 ngyml induceda 30-fold increase in b-gal activity within 5 hr. After 5 hr, b-galactivity continued to increase, reaching a level 2 orders ofmagnitude above background within 20 hr (Fig. 2A). In controlpopulations of cells expressing only one of the two constructs,b-gal activity did not increase above background when rapamycinwas added (data not shown). The linear increase in b-gal activityobserved between 5 and 20 hr after rapamycin addition may bedue to an increase in protein concentration resulting from cellproliferation, since the C2C12 cells have a doubling time of 12 hr.It is also possible that a donor peptides are stabilized when theyare incorporated into a multimeric complex. In support of thelatter possibility, Western blotting of cellular extracts with anti-bodies to b-gal revealed an increase in steady-state levels of b-galmutant peptides upon rapamycin treatment (data not shown); inaddition, stabilization of complementing b-gal peptides uponassembly of active multimeric enzymes has been reported byothers (26).

In Fig. 2B, the dose response curve is shown. b-gal activityincreased linearly with the dose of rapamycin in the 0–10 ngymlrange. This linearity suggests that b-gal enzymatic activity canserve as a reporter to quantitate protein–protein interactions.The results of these experiments demonstrate that the interactionof the FKBP12- and FRAP-b-gal fusion proteins in the presenceof rapamycin is specific and exhibits a comparable dose-responsecurve to results previously obtained by others for the FKBP12yFRAPyrapamycin complex alone (25). Thus, fusion to b-galpeptides does not interfere with the interaction of the FKBP12and FRAP proteins. Moreover, endogenous FKBP12 and FRAPproteins are ubiquitously expressed and will interact in thepresence of rapamycin, thereby competing with the introducedFRAP-Da and FKBP12-Dv fusion proteins, yet not generating

FIG. 1. Experimental design. (A) When the Da and Dvb-gal mutants are fused to proteins that do not dimerize,their association is not favored and b-gal activity is notdetected. (B) When the Da and Dv b-gal mutants are fusedto proteins that can dimerize, the formation of active b-galis favored. (C) Schematic representation of the FKBP12-Dv-Neo and the FRAP-Da-Hygro constructs. IRES, inter-nal ribosome entry sequence; LTR, long terminal repeat.

Biochemistry: Rossi et al. Proc. Natl. Acad. Sci. USA 94 (1997) 8407

Dow

nloa

ded

by g

uest

on

Nov

embe

r 29

, 202

1

b-gal activity. Our results indicate that productive FRAP-Da andFKBP12-Dv dimers will also form, generating b-gal activity thatwill reflect the interaction of FRAP with FKBP12-rapamycin inthat cellular environment even in the presence of the competingendogenous proteins. This finding suggests that it will be possibleto use b-gal complementation as a tool to analyze protein–proteininteractions generally.

b-gal activity was assayed using the sensitive Fluor-X-Galhistochemical stain, which allows simultaneous tricolor fluores-cence analysis, as described (15). Because of its broad emissionspectrum, the fluorescence of this substrate can be visualized atwavelengths that yield either a red (Fig. 3 A and B) or a greensignal (Fig. 3 C and D). In the absence of rapamycin, only a veryweak b-gal fluorescence was observed. For example, in Fig. 3A,

in which two fluorochromes were used at low magnification, theblue nuclei of the myoblasts was primarily evident with littleevidence of red b-gal activity. Similarly, in Fig. 3C, in which threefluorochromes were used at higher magnification, blue nuclei andred phalloidin-staining of actin were evident, but green b-galactivity was barely detectable. In both histochemical assays, in thepresence of 10 ngyml rapamycin, the activity of b-gal increasedsignificantly to produce an intense stain that was primarilylocalized in the cytoplasm, as expected (Fig. 3 B and D). Detec-tion of the complemented b-gal enzyme was enhanced by imagingwith a deconvolution microscope (Fig. 3D). These images showthat protein complexes forming outside the nucleus are readilydetectable using this assay.

The b-gal activity of a population of cells was assayed in thepresence and absence of 10 ngyml rapamycin by FACS. Using thissensitive assay, we were able to detect increased b-gal activity inmost of the cells after only 90 min of rapamycin treatment (Fig.4A). A range of expression levels was seen, as evidenced by thebreadth of the peak of emission in the presence and absence ofthe drug (Fig. 4A, blue and red profiles). This breadth is pre-sumably due to variable efficiency of expression of each of theretroviral vectors following integration in the target cell. Thisinference is supported by the finding that when the 25% of thecells expressing the lowest b-gal activity in the absence of rapa-mycin were collected (Fig. 4B) and then reassayed in the presenceand absence of rapamycin, a clear distinction between the twopopulations was seen (Fig. 4C). Thus, nonoverlapping popula-tions of cells that do or do not express complementing fusionproteins can be identified and isolated by FACS.

Rapamycin-Dependent Induction of b-Gal Activity in CellLysates. To test whether the heterodimerization of FRAP-Daand FKBP12-Dv induced by rapamycin required cotransla-tional assembly or could occur with fully synthesized andfolded proteins, b-gal activity was assayed in a cell free system.Cells expressing both constructs were grown in the absence ofrapamycin and lysed in situ in 50 ml of a 1:1 mixture of lysis andassay buffers containing Galacton Plus substrate from theGalacto-Light Plus assay kit (Tropix). Rapamycin was thenadded to the lysates, and b-gal activity was quantitated imme-diately, 1 and 3 hr later. As a control, b-gal activity wasmeasured in a parallel set of lysates that were not exposed torapamycin at all. No statistically significant increase in b-galactivity was detected in the samples that did not receiverapamycin. By contrast, a more than 2-fold increase in b-galactivity was observed in the rapamycin-treated lysates 1 hrafter drug administration. The increase in activity detected inlysates is only a fraction of the increase observed uponrapamycin treatment of intact cells, a finding that very likelyreflects the lower concentration of FRAP-Da and FKBP12-Dvin the lysates. This is probably due to the combined effects ofthe instability of b-gal mutants within lysates and of theirdilution during lysis. Nevertheless, these experiments demon-strate that de novo synthesis is not required for complemen-tation and that folded proteins can be induced to formcomplexes that can be monitored by b-gal activity.

DISCUSSIONPrerequisites for Monitoring Protein–Protein Interactions by

b-Gal Complementation. We have shown that b-gal activity canbe used to monitor the interaction of chimeric proteins. Criticalto the success of this system was the choice of two poorlycomplementing b-gal mutants, since strongly complementingmutants spontaneously assemble and produce functional b-galactivity detectable in the absence of any other protein constitu-ents (15). By contrast, the weakly interacting Da or Dv b-galmutants expressed from the pWZL vector do not yield detectableenzymatic activity, unless their local concentration is increased byforcing them to heterodimerize. This is only achieved by synthe-sizing them as fusion proteins in which the non-b-gal portions ofthe chimeras have sufficient affinity to drive the interaction.

FIG. 2. Biochemical assay of induction of b-gal activity uponchimera complementation. (A) Kinetics of induction of b-gal activityupon treatment with rapamycin. Pure populations of C2C12 cellsstably expressing both FKBP12-Dv and FRAP-Da were plated in96-well plates and 10 ngyml rapamycin was added at time zero. Cellswere then lysed at different time intervals thereafter, and the b-galactivity in the lysates was quantitated by chemiluminescence. (B) Doseresponse of b-gal activity upon rapamycin treatment. C2C12 cellsexpressing both FKBP12-Dv and FRAP-Da were plated in 96-wellplates and treated with different concentrations of rapamycin for 3.5hr. b-gal activity is expressed as luminescence counts per second. Eachpoint represents the average of six replicate samples. Error barsindicate standard deviations from the mean.

8408 Biochemistry: Rossi et al. Proc. Natl. Acad. Sci. USA 94 (1997)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 29

, 202

1

The molecular basis of the impaired ability of the Da and Dvmutants to associate spontaneously and recreate active b-gal isunclear. Potential insights derive from prokaryotic studies and therecently published crystal structure of intact b-gal (27). It is wellknown that efficient b-gal complementation in prokaryotes re-quires intermolecular interactions resulting in the sharing ofdomains between a acceptor and v donor mutants (20). More-over, the recently published structure of wild-type b-gal suggeststhat both the a and v domains are involved in a dimerization stepcritical to the assembly of functional enzymes. These domains arealso involved in essential contacts with the relatively large centralregion of the molecule (27). Da b-gal can be efficiently andspontaneously complemented in mammalian cells by an a donor

lacking the central m portion of the molecule (15). Similarly, Dvb-gal can complement spontaneously with an v donor lacking thecentral domain. In contrast, the weakly complementing mutantpairs used here each contain a large intact central m domain.Thus, one possible explanation for the observed lack of sponta-neous complementation between the Dv and the Da peptides isthat the presence of the m domain in both mutants may diminishtheir affinity for each other by steric hindrance or by sequesteringeither the a or the v domain in an intramolecular interaction.Accordingly, we postulate that the lack of spontaneous assemblyand generation of b-gal activity can be overcome by increasing thelocal concentration of Da and Dv by forced association of thesetwo mutants in chimeras, thereby counteracting the potential

FIG. 3. Histochemical assay of induction of b-gal activity upon chimera complementation. C2C12 cells expressing both FKBP12-Dv andFRAP-Da were maintained overnight either in the absence (A and C) or the presence (B and D) of 10 ngyml rapamycin. b-gal activity was visualizedby fluorescence microscopy using Fluor-X-Gal as substrate. (A and B) Double-labeled samples showing Hoechst stained nuclei (blue) and b-galactivity using Fluor-X-Gal as substrate viewed with a rhodamine filter set (red). (C and D) Triple-labeled samples obtained by imaging with aDeltaVision microscope showing b-gal activity using Fluor-X-Gal as substrate (green), Hoechst stained nuclei (blue), and Cy5-labeled actinfilaments (red) to visualize the contour of each cell at higher magnification.

Biochemistry: Rossi et al. Proc. Natl. Acad. Sci. USA 94 (1997) 8409

Dow

nloa

ded

by g

uest

on

Nov

embe

r 29

, 202

1

inhibitory effect imposed by the presence of two central domains.Testing of this model will require further mutagenesis, activityassays, and x-ray crystallographic analysis of the resulting struc-tures.

Irrespective of the precise molecular nature of the interactions,the data presented here provide strong evidence that by engi-neering constructs in which domains or proteins of interest drivethe dimerization of Da or Dv b-gal mutants, it will be possible tomonitor such interactions by measuring the level of b-gal activityfollowing coexpression of these fusion proteins in intact cells.Moreover, the present system should theoretically allow detectionof complexes in subcellular compartments, including the nucleus,the cytoplasm, or the membrane. Finally, as shown here, proteindimerization can be monitored in the context of the cell in thepresence of endogenous competing protein partners.

Potential for the Development of a ‘‘Mammalian Two-Hybrid’’System. The experiments described in this report show that twodistinct b-gal mutants that do not readily assemble can be forcedto interact and yield significantly increased levels of active en-zyme. This is achieved by coupling each mutant with one of a pairof highly interactive proteins, as chimeras or fusion proteins. Inthis case, we have used FRAP and FKBP12, proteins that onlyinteract in the presence of a small molecule, rapamycin. Using thistripartite complex, we were able to show that the affinity of thenon-b-gal proteins drove the interaction and that the b-galcomponents generated enzymatic activity as a result, serving tomonitor the extent of that interaction. The levels of b-gal activityin the presence and absence of forced dimerization were clearlyseparable by both biochemical and FACS assays, suggesting thatthis system could be used to screen for as yet unidentified proteinpartners. The target protein fused to a complementing b-galmutant (bait) could be stably expressed in a well-characterizedcell line. Expression libraries containing cDNAs fused to a b-galdeletion mutant could be introduced into these cells with highefficiency using retroviral vectors (28). Finally, gene products thatinteract with the bait could be isolated by identifying b-galpositive clones. A potential advantage of this system over systemsdescribed previously is that the screen could be carried out in anycell type with its own particular milieu of competing residentproteins. An attractive possibility is that the bait could be targetedto a given cellular compartment, with the aim of identifyingproteins involved in interactions restricted to that specific loca-tion. This mammalian ‘‘two-hybrid’’ screen could also be carried

out in the presence of extracellular signaling molecules, growthfactors, or differentiation factors, that might alter the potential fordimerization of two given proteins in particular cell types. Takentogether, this approach to the study of protein–protein interac-tions should greatly enhance our understanding of the develop-ment of diverse cell types and organisms and how that develop-ment goes awry.

We are grateful to Bruce Blakely for constructive comments on themanuscript, to Oivin Guicherit and Norris Turner for technical advice,and to Gerald Crabtree for useful discussions. F.R. was supported by along-term postdoctoral fellowship from the Human Frontiers in ScienceProgram. H.M.B. is the recipient of an National Institutes of HealthMERIT award.

1. Gu, W., Schneider, J. W., Condorelli, G., Kaushal, S., Mahdavi, V. & Nadal-Ginard, B. (1993) Cell 72, 309–324.

2. Halevy, O., Novitch, B. G., Spicer, D. B., Skapek, S. X., Rhee, J., Hannon, G. J.,Beach, D. & Lassar, A. B. (1995) Science 267, 1018–1021.

3. Schneider, J. W., Gu, W., Zhu, L., Mahdavi, V. & Nadal-Ginard, B. (1994) Science264, 1467–1471.

4. Bai, C. & Elledge, S. J. (1996) Methods Enzymol. 273, 331–347.5. Fields, S. & Song, O. (1989) Nature (London) 340, 245–246.6. Chien, C. T., Bartel, P. L., Sternglanz, R. & Fields, S. (1991) Proc. Natl. Acad. Sci.

USA 88, 9578–9582.7. Adams, S. R., Harootunian, A. T., Buechler, Y. J., Taylor, S. S. & Tsien, R. Y.

(1991) Nature (London) 349, 694–697.8. Lis, J. T., Simon, J. A. & Sutton, C. A. (1983) Cell 35, 403–410.9. Nielsen, D. A., Chou, J., MacKrell, A. J., Casadaban, M. J. & Steiner, D. F. (1983)

Proc. Natl. Acad. Sci. USA 80, 5198–5202.10. Nolan, G. P., Fiering, S., Nicolas, J. F. & Herzenberg, L. A. (1988) Proc. Natl.

Acad. Sci. USA 85, 2603–2607.11. Price, J., Turner, D. & Cepko, C. (1987) Proc. Natl. Acad. Sci. USA 84, 156–160.12. Ullmann, A., Jacob, F. & Monod, J. (1967) J. Mol. Biol. 24, 339–343.13. Ullmann, A., Jacob, F. & Monod, J. (1968) J. Mol. Biol. 32, 1–13.14. Ullmann, A., Perrin, D., Jacob, F. & Monod, J. (1965) J. Mol. Biol. 12, 918–923.15. Mohler, W. A. & Blau, H. M. (1996) Proc. Natl. Acad. Sci. USA 93, 12423–12427.16. Villarejo, M., Zamenhof, P. J. & Zabin, I. (1972) J. Biol. Chem. 247, 2212–2216.17. Charlton, C. A., Mohler, W. A., Radice, G. L., Hynes, R. O. & Blau, H. M. (1997)

J. Cell Biol., in press.18. Blau, H. M., Chiu, C. P. & Webster, C. (1983) Cell 32, 1171–1180.19. Langley, K. E. & Zabin, I. (1976) Biochemistry 15, 4866–4875.20. Zabin, I. (1982) Mol. Cell. Biochem. 49, 87–96.21. Brown, E. J., Albers, M. W., Shin, T. B., Ichikawa, K., Keith, C. T., Lane, W. S.

& Schreiber, S. L. (1994) Nature (London) 369, 756–758.22. Chen, J., Zheng, X. F., Brown, E. J. & Schreiber, S. L. (1995) Proc. Natl. Acad.

Sci. USA 92, 4947–4951.23. Belshaw, P. J., Ho, S. N., Crabtree, G. R. & Schreiber, S. L. (1996) Proc. Natl.

Acad. Sci. USA 93, 4604–4607.24. Choi, J., Chen, J., Schreiber, S. L. & Clardy, J. (1996) Science 273, 239–242.25. Ho, S. N., Biggar, S. R., Spencer, D. M., Schreiber, S. L. & Crabtree, G. R. (1996)

Nature (London) 382, 822–826.26. Lin, S. & Zabin, I. (1972) J. Biol. Chem. 247, 2205–2211.27. Jacobson, R. H., Zhang, X. J., DuBose, R. F. & Matthews, B. W. (1994) Nature

(London) 369, 761–766.28. Kitamura, T., Onishi, M., Kinoshita, S., Shibuya, A., Miyajima, A. & Nolan, G. P.

(1995) Proc. Natl. Acad. Sci. USA 92, 9146–9150.

FIG. 4. FACS analysis of induced b-gal activity upon chimera complementation. The red peaks represent the untreated samples and the bluepeaks represent samples treated with 10 ngyml rapamycin. (A) Induction of b-gal activity in a population of C2C12 cells expressing both FKBP12-Dvand FRAP-Da after 90 min of rapamycin treatment. The majority of the cells respond to rapamycin treatment with an increase in b-gal activity.(B) Subpopulation of cells selected on the basis of low b-gal activity in uninduced conditions. (C) The same population was maintained overnightin the absence (red peak) or in the presence (blue peak) of rapamycin. The induced and uninduced populations yield essentially nonoverlappingpeaks. The vertical axis represents relative cell number and the horizontal axis represents intensity of b-gal f luorescence on a logarithmic scale.

8410 Biochemistry: Rossi et al. Proc. Natl. Acad. Sci. USA 94 (1997)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 29

, 202

1