APPLIED AND ENVIRONMENTAL MICROBIOLOGY,0099-2240/97/$04.0010

Feb. 1997, p. 719–723 Vol. 63, No. 2

Copyright q 1997, American Society for Microbiology

Molecular Evidence for Association between theSphingobacterium-Like Organism “Candidatus comitans” and

the Myxobacterium Chondromyces crocatusCHRISTOPH A. JACOBI,1† BERNHARD AßMUS,2 HANS REICHENBACH,3

AND ERKO STACKEBRANDT1*

DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen1 and Abteilung Naturstoffbiologie, Gesellschaft furBiotechnologische Forschung,3 D-38124 Braunschweig, and Institut fur Bodenokologie, GSF-Forschungszentrum fur

Umwelt und Gesundheit, D-85758 Oberschleißheim,2 Germany

Received 16 July 1996/Accepted 5 November 1996

Seven strains of the myxobacterium Chondromyces crocatus, isolated from widely separated geographicregions, were investigated for the presence of an associate gram-negative, rod-shaped companion bacteriumthat is phylogenetically related to the genus Sphingobacterium and has been named “Candidatus comitans”(C. A. Jacobi, E. Stackebrandt, H. Reichenbach, and B. J. Tindall, Int. J. Syst. Bacteriol. 46:119–122, 1996).Five of the Chondromyces strains were found to be associated with a companion bacterium, and one strain lostits companion during the study. A 16S ribosomal DNA (16S rDNA) clone library was generated for eachChondromyces culture. Sequence similarity was >99.1% for all but one strain of C. crocatus and all but onestrain of “Candidatus comitans.” The three analyzed 16S rDNA clone sequences of the companion of Cm c7indicated that this companion strain is slightly less related to the other companion strains. The associationbetween the companion and the myxobacterium including the sporangioles was determined by in situ hybrid-ization with fluorescently labeled rRNA probes and scanning confocal laser microscopy. Based on these results,there are indications that the companion strains may survive environmental stress by inclusion in theaggregates and in the sporangioles of the myxobacterium.

The myxobacterial species Chondromyces crocatus is com-prised of strains that grow axenically or in association withsmall rod-shaped bacteria (14). Recently, we have isolated andcharacterized a bacterium (“companion”) which cocultureswith the strains of C. crocatus (8). “Candidatus comitans” is anaerobic, mesophilic, gram-negative, nonmotile, rod-shapedbacterium which is phylogenetically related to the genus Sphin-gobacterium within the Cytophaga-Flavobacterium-Bacteroidesphylum (8, 19). In contrast to the rod-shape morphology ob-served in association with the myxobacterium, the morphologychanged to highly pleomorphic cells when they were grownwithout the myxobacterium. Under these conditions, growthceased after a few transfers, making it impossible to charac-terize the physiology of this organism.Myxobacteria, members of the delta subclass of the class

Proteobacteria (17, 20), are bacteria which are characterized bya highly evolved developmental cycle. Under unfavorable en-vironmental conditions, such as dry or cold weather, starvation,and other stress factors, vegetative cells form aggregates fromwhich fruiting bodies with species-specific morphologies de-velop. Within the maturing fruiting bodies, the vegetative cellsconvert into myxospores. The shape of these myxospores isspecies specific. They are resistant to desiccation and UV ra-diation (16), and some members are even resistant to dry heat(up to 1208F or 498C) (18).The question whether the two bacteria coevolved can pos-

sibly be answered by analysis of the phylogenetic relationships

between the partners of several independently isolated pairs oforganisms, i.e., by analysis of the 16S ribosomal DNA (16SrDNA). It would also be interesting to know whether and whythe small rod-shaped bacterium is associated with the myxo-bacterium at each stage of its complex life cycle, including thefruiting body. We tried to answer this question by scanningconfocal laser microscopy following in situ hybridization withtaxon-specific rRNA-directed fluorescence-labeled oligonucle-otide probes which would localize the Sphingobacterium-typeorganisms within the stages of the C. crocatus life cycle.

MATERIALS AND METHODS

Bacterial strains and media. Strains of C. crocatus, most of which had beenidentified as containing the associated Sphingobacterium-like strains of “Candi-datus comitans,” came from the culture collection of Hans Reichenbach, Gesell-schaft fur Biotechnologische Forschung GmbH. These strains were isolated fromsoil samples of widely separated geographic regions (Table 1). The strains werecultured in Pol1 broth at 308C (10). Fruiting body formation was induced bygrowing the strains on VY/2 agar (5) for 10 days at 308C.Extraction and PCR amplification of 16S rDNA. Cells of 1-ml liquid cultures

of the C. crocatus strains were mechanically homogenized with glass beads (0.08-to 0.25-mm diameter) by vortexing. The beads were collected by centrifugation,and the cells were then enzymatically lysed as described previously (15). Extrac-tion of genomic DNA, amplification of 16S rDNA by PCR, and purification ofthe PCR products were performed as described previously (15).Cloning of 16S rDNA amplification products. Amplified and purified 16S

rDNA was cloned into the plasmid vector pCRII (TA Cloning System; Invitro-gen, San Diego, Calif.) as described by the manufacturer. The ligation productwas used to transform competent Escherichia coli cells supplied with the TAcloning kit. Plasmids were extracted by resuspending cells of a single colony insterile water and boiling them for 10 min. The cell debris was spun down, and thesupernatant was used for PCR to screen for 16S rDNA inserts by using an M13primer pair (forward, GTAAACGACGGCCAG 39; reverse, GTCCTTTGTCGATACTG 39) (11).Multiprimer PCR analysis. Discrimination between the cloned 16S rDNA

amplificates of the myxobacterium and the Sphingobacterium-type strain wasdone by a multiprimer PCR assay. The primer set consisted of a eubacterialuniversal primer (E. coli positions 10 to 30 forward [18]) and two reverse primers,i.e., a C. crocatus primer derived from the published 16S rDNA sequence (17)

* Corresponding author. Mailing address: DSMZ-Deutsche Sammlungvon Mikroorganismen und Zellkulturen, Mascheroder Weg 1B, 38124Braunschweig, Germany. Phone: 49 531 2616 352. Fax: 49 531 2616418. E-mail: erko@gbf-braunschweig.de.† Present address: Max von Pettenkofer Institut, D-80336 Munich,

Germany.

719

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

(CTTACAAGTAGTGGCCCGC 39; E. coli positions 198 to 214) and a primerwhich was designed on the basis of the 16S rDNA sequence of the isolatedcompanion of C. crocatus Cm c3 (CTCAAAGAAAGCAAGCTCTCC 39; E. colipositions 68 to 100). When more sequences for both organisms became available,it could be seen that some target sequences differed in up to two nucleotides.PCR conditions were as described elsewhere (6). The two PCR products, whichdiffered in length by 138 nucleotides, were electrophoretically separated on 1.5%agarose gels.Sequencing of inserts and phylogenetic analysis. The amplified PCR products

were purified (15) and sequenced with a Dyedeoxy terminator sequencing kit(Applied Biosystems, Foster City, Calif.). Extension products were purified byphenol-chloroform extraction, and an Applied Biosystems model 373A auto-mated sequencer was used to separate amplified fragments. Stretches of 700nucleotides (between positions 15 and 778 [E. coli nomenclature]) were alignedmanually to reference 16S rDNA sequences of C. crocatus (17) and “Candidatuscomitans” (8).In situ hybridization. The liquid coculture of C. crocatus and “Candidatus

comitans” was fixed by standard fixation and dehydration procedures (1–3).Sporangioles were carefully removed from the fruiting body with a sterile needleunder a binocular microscope with 340 magnification. The sporangioles weretransferred into ice-cold methanol-acetone (50:50, vol/vol) and were fixed for 1 hat 2208C. After centrifugation, the methanol was removed and the sporangioleswere washed once with phosphate-buffered saline before being transferred ontogelatin-coated slides. Samples were washed and subsequently dehydrated in 50,70, and 96% ethanol (1–3).Oligonucleotide probes. The following oligonucleotide probes were used:

EUB338, complementary to a region of the 16S rRNA specific for the domainBacteria (13), and EUK1379, complementary to a region of the 18S rRNA of thedomain Eucarya (7). The sequences of the probes for C. crocatus Cm c6 and forthe companion were identical to those indicated for the multi-PCR assay. Theoligonucleotide probes were synthesized with a C6-TFA amino linker [6-(tri-fluoroacetylamino)hexyl(2-cyanoethyl)-(N,N-diisopropyl) phosphoramidite] atthe 59 terminus (MWG Biotech, Ebersberg, Germany), labeled with tetrameth-ylrhodamine-5-isothiocyanate (TRITC) (Molecular Probes, Eugene, Oreg.). Theprobes were either purified as described by Amann et al. (2) or purchasedalready coupled with 5(6)-carboxyfluorescein-N-hydroxysuccinimide ester(FLUOS) and purified by high-pressure liquid chromatography (MWG Biotech).In the latter case, the purification procedure (2) started with the separation oflabeled and unlabeled oligonucleotides in a polyacrylamide gel. The probes werefinally dissolved in TE buffer (10 mM Tris hydrochloride [pH 7.0], 1 mM EDTA)to a final concentration of 50 mg ml21 and stored at 2208C.Fixed samples on slides were immersed in 15 ml of hybridization buffer (0.9 M

NaCl, 20 mM Tris hydrochloride [pH 7.2], 0.01% sodium dodecyl sulfate, 5 mMEDTA). A 2-ml volume of the respective probe solution was added. The slideswere incubated for 2 h at 468C in an equilibrated humidity chamber. Excessprobes were removed with 5 ml of washing solution (20 mM Tris, 0.01% sodiumdodecyl sulfate, 5 mM EDTA, 0.9 M NaCl). The slides were immersed in 50 mlof washing solution at 488C for 20 min, rinsed with distilled water, allowed to airdry, and mounted in antifading solution (9).Scanning confocal laser microscopy. An LSM 410 scanning confocal laser

microscope (Zeiss, Jena, Germany) equipped with an Ar ion, an HeNe lasersupplying excitation at wavelengths of 488 and 543 nm, and a 1003 oil immersionlens (NA 1.3) was used. Monochrome sequences of images were taken along theoptical axis (z axis) with increments of 1.0 mm. To further confirm spatialdistribution of the recorded fluorescence signals, z-scans perpendicular to thefocused planes were also recorded. Artificial color images (rgb mode) wererearranged from the monochrome images recorded at the different excitationwavelengths. All image combining, processing, and analysis were done with LSMsoftware, version 3.70, provided by Zeiss.

RESULTS

Macroscopic and microscopic investigation of the seven C.crocatus cultures (designated Cm c1 to Cm c7) indicated thatfive strains contained the companion bacterium, while strainsCm c1 and Cm c5 did not contain the companion strain (Table1). The companion was lost in strain Cm c6 during cultivationexperiments. On VY/2 agar, the myxobacterium formed or-ange-brown colonies consisting of swarming bacteria whetheror not the companion strain was present. In contrast, the com-panion bacterium alone grew slowly on nutrient broth agarplates, and the translucent and small colonies (,0.1 mm indiameter) became visible only 5 days after inoculation. Also,none of the Chondromyces strains that were associated with acompanion strain would grow at all in the absence of thecompanion strain. The two cell types could be clearly differ-entiated by light microscopy, as the C. crocatus rod-shapedcells have about two times the length and three times the widthof the rod-shaped cells of the companion. After about 7 days’growth in Pol1 broth, cells of C. crocatus aggregate and the cellnumbers of the companion are significantly reduced. After 14days, companion cells are no longer visible by light microscopy.However, transfer of C. crocatus cells from such a culture tofresh Pol1 medium led to growth of both cell types. Pure liquidcultures of the companion bacteria resulted in highly enlarged,pleomorphic cells (8). Transfer of these cells to a pure liquidculture of C. crocatus led to the growth of the companion strainas small, thin, pleomorphic cells.Determination of phylogenetic relationships of C. crocatus

and the companion strains. Between 20 and 40 clones of theindividual clone libraries, generated from PCR-amplified 16SrDNAs of DNAs isolated after 4 days of incubation from allseven C. crocatus cultures, were screened by a multiprimerassay for the presence of taxon-specific PCR products. Thefinding that the libraries of C. crocatus Cm c1 (Fig. 1, top), Cmc5 (not shown), and Cm c6 (not shown) contained only C.crocatus-specific PCR fragments (size, about 220 nucleotides)was consistent with the absence of the companion in the cul-tivation studies of these strains. Analysis of the clone librariesof the other cultures revealed that both PCR products werepresent. The companion-specific fragments dominated overthe C. crocatus-specific fragment by about 20:1 (Fig. 1, bot-tom).Comparison of a 700-nucleotide 16S rDNA fragment of C.

crocatus Cm c6, analyzed by Shimkets and Woese (17), and acloned sequence of strain Cm c6 revealed 99.6% sequencesimilarity. A similarity of .99.1% was found when either thealmost complete sequences (1,500 nucleotides) of Cm c6 and asingle clone of Cm c1, Cm c5, and Cm c7 or the 59 500 nucle-otides of single clones of Cm c2, Cm c3, and Cm c4 wereincluded in the analysis. Small differences in the sequencesoccurred primarily in the two variable regions around positions100 and 200.Analyses of the 16S rDNA sequences of the companion

strains indicated that they were highly similar. The almostcomplete 16S rDNA (1,500 nucleotides) of the cultured com-panion of C. crocatus Cm c3 was virtually identical with thesequence of a clone of a companion from the clone library ofC. crocatus Cm c2 (99.7% similarity). Equally high values (99.6to 99.9%) were found when a stretch of 750 nucleotides wasanalyzed for the two sequences of the cultured companions ofCm c2 and Cm c3 and one clone of the companion of each ofthe clone libraries of C. crocatus Cm c3 and Cm c4. Threeclones from the companion of C. crocatus Cm c7 showedhigher than 99.5% sequence similarity of the almost complete16S rDNA among themselves, but these companions were

TABLE 1. Designation of strains of C. crocatus, presence orabsence of their associated companion strains (“Candidatus

comitans”), and origin of the myxobacterium

Strain Companion Samplesource Origin (yr of isolation)

Cm c1 Absent Unknown H. D. McCurdy (1963)Cm c2 Present Soil Madeira (1982)Cm c3 Present Soil Madeira (1982)Cm c4 Present UnknownCm c5 Absent Soil Brazil (1988)Cm c6 Presenta Soil New Delhi, India (1989)Cm c7 Present Soil Malaysia (1990)

a The companion did not survive the experiment; the myxobacterial straincontinued to grow.

720 JACOBI ET AL. APPL. ENVIRON. MICROBIOL.

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

slightly less related to the companions of the other C. crocatusstrains (98 to 99% 16S rDNA sequence similarity for a stretchof 750 nucleotides).In situ hybridization. The oligonucleotide probe directed

against the rRNA of C. crocatus Cm c6 was labeled with thefluorescent dye FLUOS, whereas the probe for the companion“Candidatus comitans” was labeled with TRITC. In situ hy-bridization of these probes with a culture containing the twoorganisms (Fig. 2A) and analysis by scanning confocal lasermicroscopy gave the expected result. The few large rod-shapedC. crocatus cells gave a green fluorescence signal, whereas thesmaller, slightly pleomorphic cells of the companion gave a redsignal (Fig. 2B). In control experiments, unstained bacterialcells showed only a very weak autofluorescence with the exci-tation wavelengths used. The background signals were notincreased when the eukaryotic probe EUK1379 was used,which demonstrated that no unspecific adsorption of oligonu-cleotides occurred (not shown). Hybridization with probeEUB338, specific for members of the domain Bacteria gave themost intense signal of all the probes used (not shown).Probing of the sporangioles of C. crocatus with the two

taxon-specific probes revealed that the companion cells wereassociated with the sporangioles (Fig. 2C). However, the cellnumber of the companion was much smaller than that of the C.crocatus myxospores, and their distribution was not uniform.The spatial arrangement of the investigated samples was con-firmed by analysis of z-series of optical sections. The localiza-tion of the companion cells within the sporangiole was con-firmed by z-scanning the samples. In this way, it was possible to

distinguish between bacteria which colonized the interior ofthe sporangiole from bacteria which were located outside thesporangiole. In addition to intact sporangioles, crushed spo-rangioles in which the companion bacteria were detached fromthe myxobacterial spores were seen (Fig. 2D).

DISCUSSION

Phylogenetic analysis of the 16S rDNAs of seven strains ofthe myxobacterium C. crocatus indicates a high level of inter-strain relatedness. Small differences of ,1% can be expectedto occur in the 16S rDNA at the strain level, because the 16SrDNA was subjected twice to 30 cycles of PCR amplification,and individual rRNA genes rather than bulk rRNA genes wereanalyzed. Based upon morphological characteristics and high16S rDNA sequence similarity, it is concluded that all studiedstrains belong to the species C. crocatus, whether or not theywere associated with a companion Sphingobacterium-typestrain. The nearest phylogenetic neighbor of C. crocatus isChondromyces apiculatus, whose 16S rDNA differs from theformer species by 2.9 to 3.1%.Except for the three 16S rDNA clone sequences of the

companion of Cm c7, all strains have almost identical 16SrDNA sequences (.99% similarity). The three 16S rDNAclone sequences of the companion of Cm c7 are also almostidentical (.99% similarity) but differ slightly from the se-quences of the other companions, including that of the typestrain of “Candidatus comitans,” by 1 to 2%. As long as nofurther information than high 16S rDNA sequence similarity isavailable, we consider all companion strains of C. crocatus tobe strains of “Candidatus comitans.” A few nucleotides arefound exclusively in the 16S rDNA of strain Cm c7, but phe-notypic characteristics which would differentiate this strainfrom its phylogenetic neighbor are not known.The use of fluorescence-labeled rRNA-directed probes has

been applied to the detection of bacteria in a variety of envi-ronments (1–3). The method allows the detection and enumer-ation of bacteria in their natural environment. Probe technol-ogy can be combined with confocal laser microscopy to yieldhigh-quality images and spatial information about the viewedsamples (4, 12). This approach complements isolation studiesand the determination of the physiological properties whichmay allow us to understand the functional role of the strain inthe environment. In cases where isolation of a strain, repre-sented by its 16S rDNA sequence in the clone library, has notyet been achieved, the verification of the authenticity of thestrain by in situ hybridization with a 16S rDNA-specific probeis mandatory for the description of a “Candidatus” status forthe strain (8).In the present study, in situ hybridization was used to deter-

mine the mode of transfer of the companion strain in culturesof C. crocatus. After 14 days of growth of the coculture in Pol1medium, the companion strain seems to have disappeared andonly myxobacterial cell clusters are visible by microscopy. Thefinding that growth of companion cells occurs following trans-fer of the cell clusters to fresh Pol1 medium indicates thateither the number of companion cells was too low to be mi-croscopically visible or some cells of the companion bacteriumsurvived by attachment to the myxobacterial cells. However,the formation of aggregates is not the survival strategy ofmyxobacteria on solid media. There, under stress conditions,they form fruiting bodies and the companion organism ispresent very close to the spreading myxobacterium. Fluores-cence signals obtained with the “Candidatus comitans”-specificprobe indicate that the companion bacterium is found withinthe stem (not shown) and the sporangioles of the fruiting body.

FIG. 1. Agarose gel electrophoresis of partial 16S rDNA PCR fragmentsresulting from multiprimer assay of clone libraries. (Top) Analysis of 10 clonesof a library of a culture of C. crocatus Cm c1. Fragments in lanes 1 to 10 are ofthe myxobacterium-specific size of 220 bp. The lack of any companion-specificPCR fragment of 90 bp indicates the absence of a companion in the C. crocatusculture. The fragment pattern in lane 9 points towards the presence of anunspecific PCR product. (Bottom) Analysis of 10 clones of a library of a cultureof C. crocatus Cm c4 and its companion. Fragments in lanes 12, 14 to 18, 20, and21 were obtained from clones originating from the companion strain (90 bp),while the fragment in lane 19 originates from C. crocatus Cm c4 (220 bp). Thefragment pattern in lane 13 points towards the presence of unspecific PCRproducts. Lanes 11 and 22, positive controls of C. crocatus; lanes M, molecularweight marker VIII (Boehringer Mannheim).

VOL. 63, 1997 “CANDIDATUS COMITANS” AND C. CROCATUS ASSOCIATION 721

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

Whether the companion enters the sporangioles actively orwhether it enters accidentally during the formation of the fruit-ing body cannot yet be determined.The nature of the association between the two bacterial

species is not understood. The presence of C. crocatus appearsto be essential for the growth of the companion bacteria. Incoculture, companion cells are small, only slightly pleomor-phic, and rapidly growing, while in pure culture they hardlygrow and the cells are large and pleomorphic, roundish to verylong. The companion bacterium grew very well in the Infors

membrane fermentor experiment (8), where the two bacteriawere physically separated by a membrane which allowed smallmolecules produced by either strain to pass through. The as-sociation seems not equally important for the myxobacterium,as certain strains still thrive well after having lost the compan-ion. With other strains, however, a stable relationship betweenthe two organisms appears to exist. The phylogenetic separat-edness of C. crocatus Cm c7 and its companion from otherstrains of C. crocatus and other companion strains, respec-tively, is significant; however, the close relatedness among the

FIG. 2. Micrographs obtained by scanning confocal laser microscopy. (A and B) “Candidatus comitans” (bright field and dual excitation fluorescence after in situhybridization with a TRITC-labeled rRNA probe specific for the companion and a FLUOS-labeled rRNA probe specific for C. crocatus, respectively). A cell of C.crocatus is indicated (arrow). (C and D) Optical sections of sporangioles after in situ hybridization with the same probes, applied to an intact sporangiole and to adisrupted sporangiole, respectively. A cell of the companion is indicated (arrow). Bars, 10 mm.

722 JACOBI ET AL. APPL. ENVIRON. MICROBIOL.

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from

16S rDNA sequences found between all companion strains onthe one hand and between all strains of C. crocatus on theother hand makes this molecule not well suited for answeringquestions about coevolution. The fact that the degree of relat-edness among the companion strains as well as among strainsof C. crocatus is very high indicates that not only their associ-ation but also the spreading of C. crocatus to geographicallywidely distributed regions has occurred rather recently in evo-lution.

ACKNOWLEDGMENTS

We thank A. Hartmann (GSF, Institut fur Bodenokologie) and P.Hutzler (GSF, Institut fur Pathologie, biomedizinische Bildanalyse)for allowing us to use the laser microscopy facility.

REFERENCES

1. Amann, R. I., N. Springer, W. Ludwig, H.-D. Gortz, and K.-H. Schleifer.1991. Identification in situ and phylogeny of uncultured bacterial endosym-bionts. Nature (London) 351:161–164.

2. Amann, R. I., B. J. Binder, R. J. Olson, S. W. Chrisholm, R. Devereux, andD. A. Stahl. 1990. Combination of 16S rRNA-targeted oligonucleotideprobes with flow cytometry for analyzing mixed microbial populations. Appl.Environ. Microbiol. 56:1919–1925.

3. Amann, R. I., L. Krumholz, and D. A. Stahl. 1990. Fluorescent oligonucle-otide probing of whole cells for determinative, phylogenetic, and environ-mental studies in microbiology. J. Bacteriol. 172:762–770.

4. Aßmus, B., P. Hutzler, G. Kirchhof, R. Amann, J. R. Lawrence, and A.Hartmann. 1995. In situ localization of Azospirillum brasiliense in the rhizo-sphere of wheat with fluorescently labeled, rRNA-targeted oligonucleotideprobes and scanning confocal laser microscopy. Appl. Environ. Microbiol.61:1013–1019.

5. DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen. 1993.DSM catalogue of strains. DSMZ-Deutsche Sammlung von Mikroorganis-men und Zellkulturen, Braunschweig, Germany.

6. Goebel, B. M., and E. Stackebrandt. 1994. Cultural and phylogenetic analysisof mixed microbial populations found in natural and commercial bioleachenvironments. Appl. Environ. Microbiol. 60:1614–1621.

7. Hicks, R. E., R. I. Amann, and D. A. Stahl. 1992. Natural staining of bacte-

rioplankton with 49,6-diamidino-2-phenylindole and fluorescent oligonucle-otide probes targeting kingdom-level 16S rRNA sequences. Appl. Environ.Microbiol. 58:2158–2163.

8. Jacobi, C. A., E. Stackebrandt, H. Reichenbach, and B. J. Tindall. 1996.“Candidatus comitans,” a bacterium living in coculture with Chondromycescrocatus (Myxobacteria). Int. J. Syst. Bacteriol. 46:119–122.

9. Johnson, G. D., and G. M. de Nogueira Araujo. 1981. A simple method ofreducing the fading of immunofluorescence during microscopy. J. Immunol.Methods 43:349–350.

10. Kunze, B., R. Jansen, G. Hofle, and H. Reichenbach. 1995. Crocacin, a newelectron transport inhibitor from C. crocatus (Myxobacteria): production,isolation and physico-chemical and biological characteristics. J. Antibiot.47:881–886.

11. Liesack, W., and E. Stackebrandt. 1992. Occurrence of novel groups of thedomain Bacteria as revealed by analysis of genetic material isolated from anAustralian terrestrial environment. J. Bacteriol. 174:5072–5078.

12. Manz, W., R. Amann, R. Szewzyk, U. Szewzyk, T. A. Stenstrom, P. Hutzler,and K. H. Schleifer. 1995. In situ identification of Legionellaceae using 16SrRNA-targeted oligonucleotide probes and confocal laser microscopy. Mi-crobiology 141:29–39.

13. Manz, W., R. Amann, W. Ludwig, M. Wagner, and K.-H. Schleifer. 1992.Phylogenetic oligonucleotide probes for the major subclasses of proteobac-teria: problems and solutions. Syst. Appl. Microbiol. 15:593–600.

14. McCurdy, H. D. 1963. A method for the isolation of myxobacteria in pureculture. Can. J. Microbiol. 16:1453–1461.

15. Rainey, F. A., M. Dorsch, H. W. Morgan, and E. Stackebrandt. 1992. 16SrDNA analysis of Spirochaeta thermophila: its phylogenetic position andimplications for the systematics of the order Spirochaetales. Syst. Appl.Microbiol. 15:197–202.

16. Reichenbach, H. 1993. Biology of the myxobacteria: ecology and taxonomy,p. 13–62. In M. Dworkin and D. Kaiser (ed.), Myxobacteria II. AmericanSociety for Microbiology, Washington, D.C.

17. Shimkets, L., and C. R. Woese. 1992. A phylogenetic analysis of the myxo-bacteria: basis of their classification. Proc. Natl. Acad. Sci. USA 89:9459–9463.

18. Sudo, S. Z., and M. Dworkin. 1969. Resistance of vegetative cells and mi-crocysts of Myxobacterium xanthus. J. Bacteriol. 98:883–887.

19. Weisburg, W. G., J. G. Tully, D. L. Rose, J. P. Petzel, H. Oiyaizu, D. Yang,L. Mandelco, I. Sechrest, T. G. Lawrence, J. van Etten, J. Maniloff, and C. R.Woese. 1989. A phylogenetic analysis of the mycoplasmas: basis for theirclassification. J. Bacteriol. 171:6455–6467.

20. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221–271.

VOL. 63, 1997 “CANDIDATUS COMITANS” AND C. CROCATUS ASSOCIATION 723

on March 20, 2020 by guest

http://aem.asm

.org/D

ownloaded from