Molecular Microbiology First published online 15 July 2008...

aglF, aglG and aglI, novel members of a gene islandinvolved in the N-glycosylation of the Haloferax volcaniiS-layer glycoprotein

Sophie Yurist-Doutsch,1 Mehtap Abu-Qarn,1

Francesca Battaglia,2 Howard R. Morris,2,3

Paul G. Hitchen,2,4 Anne Dell2 and Jerry Eichler1*1Department of Life Sciences, Ben Gurion University,Beersheva 84105, Israel.2Division of Molecular Biosciences and 4Centre forIntegrative Systems Biology, Faculty of NaturalSciences, Imperial College, London SW7 2AZ, UK.3M-SCAN Ltd, Wokingham, Berks RG41 2TZ, UK.

Summary

Proteins in all three domains of life can experienceN-glycosylation. The steps involved in the archaealversion of this post-translational modification remainlargely unknown. Hence, as the next step in ongoingefforts to identify components of the N-glycosylationpathway of the halophilic archaeon Haloferax volca-nii, the involvement of three additional gene productsin the biosynthesis of the pentasaccharide decoratingthe S-layer glycoprotein was demonstrated. Thegenes encoding AglF, AglI and AglG are found imme-diately upstream of the gene encoding the archaealoligosaccharide transferase, AglB. Evidence showingthat AglF and AglI are involved in the addition of thehexuronic acid found at position three of the pen-tasaccharide is provided, while AglG is shown to con-tribute to the addition of the hexuronic acid found atposition two. Given their proximities in the H. volcaniigenome, the transcription profiles of aglF, aglI, aglGand aglB were considered. While only aglF and aglIshare a common promoter, transcription of the fourgenes is co-ordinated, as revealed by determiningtranscript levels in H. volcanii cells raised in differentgrowth conditions. Such changes in N-glycosylationgene transcription levels offer additional support forthe adaptive role of this post-translational modifica-tion in H. volcanii.

Introduction

Post-translational protein modifications are responsiblefor much of the variety and diversity found within theproteome of any organism. Of the various modificationsa protein can experience, glycosylation is one of themost prevalent, occurring either on Asn residues, in thecase of N-glycosylation, or on amino acids presenting afunctional hydroxyl group, such as Ser or Thr, in thecase of O-glycosylation (Spiro, 2002). Both N- andO-glycosylation transpire in all three domains of life, i.e.Eukarya, Bacteria and Archaea (Spiro, 2002; Messner,2004; Eichler and Adams, 2005), although currentunderstanding of each version of these processes isnot consistent. In particular, the archaeal N-glycosylationpathway is not as well defined as the parallel eukaryal andbacterial processes (Yurist-Doutsch et al., 2008).

In Haloferax volcanii, sequences homologous toeukaryal and bacterial N-glycosylation genes have beendetected and several have been experimentally verifiedas participating in the N-glycosylation of a reporter protein(Abu-Qarn and Eichler, 2006; Abu-Qarn et al., 2007;2008). AglD plays a role in the addition of the final subunitof a pentasaccharide decorating the H. volcanii S-layerglycoprotein (Abu-Qarn et al., 2007), while AglE partici-pates in the addition of the fourth subunit to the samepentasaccharide (Abu-Qarn et al., 2008). Finally, AglBacts to transfer the pentasaccharide to at least two ofthe seven putative N-glycosylation sites of the S-layerglycoprotein, i.e. Asn-13 and Asn-83 (Abu-Qarn et al.,2007).

Examination of those ORFs found upstream of aglB(HVO_1530;http://archaea.ucsc.edu/cgi-bin/hgGateway?db=haloVolc1; Schneider et al., 2006) revealed twosequences previously listed as possible participants in theH. volcanii protein glycosylation process (Abu-Qarn andEichler, 2006). HVO_1528 corresponds to the H. volcaniihomologue of C. jejuni pglI, the product of which adds aglucose branch to the undecaprenolpyrophosphate-linkedpolysaccharide structure that is ultimately transferred topolypeptide targets in this bacterium (Linton et al., 2005).HVO_1527 corresponds to mpg1-B (Abu-Qarn andEichler, 2006), one of the five H. volcanii homologues of

Accepted 25 June, 2008. *For correspondence. E-mail [email protected]; Tel. (+972) 8646 1343; Fax (+972) 8647 9175.

Molecular Microbiology (2008) 69(5), 1234–1245 � doi:10.1111/j.1365-2958.2008.06352.xFirst published online 15 July 2008

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd

http://archaea.ucsc.edu/cgi-bin/hgGateway?

eukaryal mpg1, encoding the GTP:mannose-1-phosphateguanyltransferase responsible for catalysing the last stepin GDP-mannose production (Kruszewska et al., 1998). Inthe eukaryal N-glycosylation pathway, this nucleotide-activated mannose is transferred to a dolichol phosphatecarrier facing the cytoplasmic side of the ER membrane.The charged carrier is then re-orientated to face the ERlumen and the mannose subunit is transferred to thegrowing polysaccharide that is ultimately attached toselect Asn residues of nascent polypeptides being trans-lated and translocated into the ER lumen (Helenius andAebi, 2004).

The current annotation of the H. volcanii genome listsHVO_1529 as encoding a homologue of ExoM, a b1–4glucosyltransferase thought to be involved in the biosyn-thesis of a bacterial exopolysaccharide succinoglycan(Glucksmann et al., 1993). However, given the docu-mented difficulty in assigning function to sugar-bindingproteins (Coutinho et al., 2003), this annotation may beincorrect. Indeed, BLAST searches reveal HVO_1529 to behomologous to sequences simply referred to as glycosyl-transferases, including N-acetylgalactosamine trans-ferases, involved in mucin-type protein O-glycosylation inEukarya (Marth, 1996; Ten Hagen et al., 2003).

Given their physical proximity to H. volcanii genesimplicated in protein glycosylation and homology togenes putatively implicated in protein glycosylation else-where, the involvement of HVO_1527, HVO_1528 andHVO_1529 in H. volcanii protein N-glycosylation wasfurther considered. The results obtained confirm the par-ticipation of the three genes found upstream of aglB,namely HVO_1527 (now renamed aglF), HVO_1528 (nowrenamed aglI ) and HVO_1529 (now renamed aglG), inH. volcanii S-layer glycoprotein N-glycosylation.

Results

Deletion of HVO_1527, 1528 or 1529 does notcompromise H. volcanii survival

As a first step in assessing the putative involvement ofHVO_1527, 1528 and 1529 in H. volcanii protein glycosy-lation, each gene was deleted according to the protocoldeveloped by Allers et al. (2004) and successfully used bynumerous laboratories for the study of a variety of genes(cf. Soppa et al., 2008). In this approach, the sequenceunder consideration is replaced by the tryptophansynthase-encoding H. volcanii trpA gene (HVO_0789),introduced into the genome of the uracil and tryptophanauxotrophic H. volcanii strain WR536 by the pyrE-containing plasmid pTA131 and plating onto casaminoacids lacking uracil and tryptophan.

PCR amplification was performed to follow genomicintegration of the introduced plasmids as well as the

subsequent expulsion of the plasmid together withHVO_1527, 1528 or 1529. However, given the compa-rable sizes of these genes and the trpA sequence(732, 888, 942 and 834 nucleotides, respectively), eachgene was followed by dual PCR amplifications usingforward primers raised against internal sequences withinHVO_1527, 1528, 1529 or trpA and a reverse primerdirected against a sequence within the flanking regiondownstream to HVO_1527, 1528 or 1529, as appropriate.As revealed in Fig. 1B (left panels), whereas those primerpairs directed against internal and downstream flankingregions of HVO_1527, 1528 or 1529 yielded PCR ampli-fication products in the background strain (right pair oflanes in each panel; 1467, 1422 and 1251 bp, respec-tively), only those primer pairs directed against an internalsequence of trpA and the flanking regions downstream toHVO_1527, 1528 or 1529 yielded PCR amplification prod-ucts in the deletion strain (left pair of lanes in each panel;1353, 1368 and 1359 bp, respectively). These results thuspoint to respective replacement of HVO_1527, 1528 and1529 by trpA. Deletion of each gene was further con-firmed when PCR amplification was performed usinggenomic DNA from the deletion strains as template andprimers directed against the HVO_1527, 1528 or 1529coding regions (732, 888 and 942 bp, respectively;Fig. 1B, right panels).

The absence of HVO_1527, 1528 or 1529 in the respec-tive deletion strains was next ascertained at the RNA levelby RT-PCR, performed as described previously (Abu-Qarnand Eichler, 2006). In these experiments, RNA or cDNAgenerated from the RNA of each deletion strain or nonucleic acids (blank) served as template for PCR amplifi-cations, together with primers directed against the codingregion of HVO_1527, 1528 or 1529.As reflected in Fig. 1C,no PCR products were obtained when cDNA from any ofthe deletion strains served as template in reactions involv-ing primers directed against the deleted gene in question.By contrast, PCR products were readily obtained when thesame reactions were repeated using primers directedagainst either of the other two sequences. For example,when PCR amplification was performed using cDNAobtained from cells deleted of HVO_1527 (Fig. 1C, leftpanels, left lanes), PCR products were obtained whenprimers to the HVO_1528 or 1529 coding regions wereemployed (middle and bottom panels, respectively) but notwhen primers to the HVO_1527 coding region wereincluded in the reaction (top panel). Similarly, no PCRproducts appeared when RNA served as template (middlelanes of each panel) or when no nucleic acids were present(blank, right lanes of each panel). These results thus reflectthe deletion of HVO_1527, 1528 and 1529 at the RNA leveland, moreover, reveal that the absence of HVO_1527,1528 or 1529 does not compromise the transcription of theother two genes.

Haloferax volcanii protein glycosylation 1235

© 2008 The AuthorsJournal compilation © 2008 Blackwell Publishing Ltd, Molecular Microbiology, 69, 1234–1245

H. volcanii cells lacking HVO_1527, 1528 or 1529present a modified S-layer

Having determined that HVO_1527, 1528 and 1529 arenot essential for H. volcanii viability, the participation of thegene products in protein glycosylation was considered byexamining the S-layer glycoprotein, a well-characterizedarchaeal reporter of this post-translational modification(Sumper et al., 1990; Mengele and Sumper, 1992, Eichler,2000), in cells deleted of each gene.As reflected in Fig. 2A,when the S-layer glycoprotein from the H. volcanii WR536

strain background and the same strain lacking HVO_1527,1528 or 1529 were compared by SDS-PAGE and Coo-massie staining, the faster migration of the protein from themutant cells was evident. To confirm that such enhancedmigration of the S-layer glycoprotein on SDS-PAGE wasdue to the absence of the individual genes and not theoutcome of a general perturbation of the genome in theregion of HVO_1527, 1528 and 1529, each deletion strainwas transformed to express a plasmid-based copy of theabsent gene, engineered to include a cellulose-bindingdomain (CBD) tag, with expression being confirmed byimmunoblot using anti-CBD antibodies (Fig. 2B). In thecase of HVO_1527 and 1529, such complementationrestored the original SDS-PAGE behaviour of the S-layerglycoprotein (Fig. 2C). The failure of plasmid-encodedCBD-HVO_1528 to restore S-layer glycoprotein migrationin SDS-PAGE to that of the native protein may be due toseveral causes, including steric interference by the fusedCBD tag, introduced for purposes of detection. Nonethe-less, the observation that HVO_1527 and HVO_1529mRNA is detected in the HVO_1528 deletion strain(Fig. 1C) argues that effects resulting from the absence ofHVO_1528 (such as modified S-layer glycoprotein appar-ent molecular weight) are due to the missing gene productrather than arising in a non-specific, unrelated mannerbecause of genome disruption.

To determine whether the enhanced migration of theS-layer glycoprotein in the HVO_1527-, 1528- or 1529-lacking cells was indicative of modifications that affectedthe integrity of the S-layer surrounding H. volcanii,thought to be composed solely of the S-layer glycoprotein(Sumper et al., 1990), WR536 background cells, as well

Fig. 1. HVO_1527, 1528 and 1529 are not essential forH. volcanii survival.A. Schematic representation showing the orientations ofHVO_1527, 1528, 1529 and 1530 as well as proven (HVO_1530)annotations.B. Left panels: PCR amplification was performed using a forwardprimer directed at the HVO_1527, 1528 or 1529 3′ flanking regionsand a reverse primer directed at a sequence within the HVO_1527,1528 or 1529 coding regions (primer pair a) or a sequence withinthe trpA sequence (primer pair b), together with genomic DNA fromcells of the WR536 background strain (bkgnd) or from cells thathad replaced the HVO_1527, 1528 or 1529 gene (deletion; top,middle and bottom panels, respectively), as template. Right panel:PCR amplification was performed using primers directed againstthe HVO_1527, 1528 or 1529 coding regions, together withgenomic DNA from cells of the WR536 background strain (bkgnd)or the HVO_1527, 1528 or 1529-deleted strains (deletion; top,middle and bottom panels, respectively).C. RT-PCR was performed using primers directed at HVO_1527(top row of panels), HVO_1528 (middle row of panels) orHVO_1529 (bottom row of panels) and cDNA (left lane of eachpanel), RNA (middle lane of each panel) from HVO_1527, 1528 or1529-deleted strains (left, middle and right columns of panels,respectively) as template. In the right lane of each panel, nonucleic acid template was added to the reaction (blank). Theidentities of PCR products were confirmed by sequencing.

1236 S. Yurist-Doutsch et al. �


as cells of the same strain deleted of HVO_1527, 1528 or1529, were challenged with proteinase K for up to 3 h. Theproportion of non-digested S-layer glycoprotein remainingat increasing intervals from the onset of proteolysis wasthen considered. Such analysis revealed the S-layer gly-coprotein in the background strain (as well as in cells

deleted of HVO_A0586, a seemingly unrelated putativenucleoside diphosphate sugar pyrophosphorylase) to beless susceptible to proteolytic digestion than its counter-parts in the HVO_1527-, 1528- or 1529-deleted strains(Fig. 3). Moreover, complementation of HVO_1527- orHVO_1529-deleted cells to express a CBD-tagged

Fig. 2. The absence of HVO_1527, 1528 or 1529 affects S-layer glycoprotein migration on SDS-PAGE.A. Equivalent aliquots of H. volcanii WR356 cells (bkgnd), or the same cells lacking HVO_1527 (DHVO_1527; top panel), HVO_1528(DHVO_1528; middle panel) or HVO_1529 (DHVO_1529; bottom panel) were separated by 5% SDS-PAGE and Coomassie blue-stained. Theposition of the S-layer glycoprotein is shown.B. The expression of CBD-tagged HVO_1527 (top panel), HVO_1528 (middle panel) and HVO_1529 (top panel) in the complemented deletionstrains, as confirmed by immunoblot after separation on 15% SDS-PAGE using anti-CBD antibodies.C. Equivalent aliquots of H. volcanii WR356 cells lacking HVO_1527 (DHVO_1527), HVO_1529 (DHVO_1529) or cells of the deletion straintransformed with a plasmid encoding a CBD-tagged version of the deleted gene (DHVO_1527/CBD-HVO_1527; DHVO_1529/CBD-HVO_1529)were separated by 5% SDS-PAGE and Coomassie blue-stained. The position of the S-layer glycoprotein is shown.

Fig. 3. The S-layer surrounding H. volcaniicells is protease-sensitive in cells lackingHVO_1527, 1528 or 1529. Background strainWR536 (top panel), and HVO_1527-, 1528- or1529-lacking cells of the same strain (second,third and fourth panels, respectively) werechallenged with 1 mg ml-1 proteinase K at42°C. In the fifth and sixth panels, cellslacking HVO_1527 or HVO_1529,respectively, transformed to express aCBD-tagged version of the deleted gene,were similarly challenged. Aliquots wereremoved immediately prior to incubation withproteinase K and at 15–30 min intervalsfollowing addition of the protease for up to 3 hand examined by 7.5% SDS-PAGE. In acontrol experiment, H. volcanii cells deleted ofa seemingly non-related gene (HVO_A0586)were similarly challenged (bottom panel).



version of the encoded protein restored the proteaseresistance of the S-layer to that of the background strain.It thus appears that the source of the enhancedHVO_1527-, 1528- and 1529-deleted strain-derivedS-layer glycoprotein SDS-PAGE migration also compro-mises the proper assembly of the protein shell surround-ing H. volcanii cells in these strains.

HVO_1527, 1528 and 1529 participate in the assemblyof the pentasaccharide decorating the H. volcaniiS-layer glycoprotein

As homology-based predictions assign the deducedproducts of HVO_1527, 1528 and 1529 roles inN-glycosylation, experiments were next performedto directly test these predictions. Indeed, defectiveN-glycosylation could explain the observations describedabove. Accordingly, SDS-PAGE gel pieces containingthe S-layer glycoprotein from the H. volcanii backgroundstrain, as well as from cells lacking HVO_1527, 1528 or1529, were subjected to in-gel tryptic digestion. Theobtained peptides were separated by liquid chromato-graphy and MS/MS was employed to reveal peptidesequences. The six peptides generated in this mannerincluded the N-terminal 1ERGNLDADSESFNK14 peptide(1581 m/z), encompassing the glycosylated Asn-13residue (Sumper et al., 1990; Abu-Qarn et al., 2007).Previous MALDI TOF mass mapping of the nanoLC-purified tryptic digest, complemented by MS/MS analy-ses using MALDI TOF/TOF and electrospray Q-TOFinstrumentation, had shown this S-layer glycoprotein-derived peptide to be modified by a novel pentasaccha-ride (Abu-Qarn et al., 2007). In agreement with thisearlier study, the Asn-13-containing peptide isolated fromthe WR536 background strain was now shown to bedecorated by the same pentasaccharide moiety (m/z2447), composed of a hexose (162 Da), followed by two176 Da residues (hexuronic acids), one 190 Da residue(likely either dimethylated hexose or the methyl ester ofhexuronic acid) and an additional hexose residue at theend of the glycan chain. In addition, the same peptidemodified by precursor mono- (m/z 1743.7), di- (m/z1919.7), tri- (m/z 2095.8) and tetrasaccharides (m/z2285.5) were also observed (Fig. 4, top left panel,bkgnd).

When the same S-layer glycoprotein peptide wasderived from H. volcanii cells deleted of HVO_1527, avery different profile was obtained. In this case, themonosaccharide-bearing species as well as a lesseramount of the disaccharide-bearing peptide wereobserved [Fig. 4, top right panel, DHVO_1527 (aglF)]. Inthe case of cells deleted of HVO_1528, an identicalpattern was obtained [Fig. 4, bottom left panel,DHVO_1528 (aglI )]. Due to the weak nature of the signal

at m/z 1919.7 in the DHVO_1527 (aglF) and DHVO_1528(aglI ) profiles, relative to the m/z 1743.8 signal, twofurther analyses were performed (data not shown).Standard deviations of �2.2 and �0.9 were obtainedfor the relative intensities between these signals in theDHVO_1527 (aglF) and DHVO_1528 (aglI ) samples,respectively. When the N-terminal S-layer glycoproteintryptic peptide from cells lacking HVO_1529 was exam-ined as above, only the monosaccharide-decoratedspecies was detected [Fig. 4, bottom right panel,DHVO_1529 (aglG)]. The products of HVO_1527 and1528 are therefore involved in the addition of the distalhexuronic acid of the pentasaccharide decorating Asn-13, while the product of HVO_1529 is involved in addi-tion of the proximal hexuronic acid of the sameoligosaccharide.

Thus, given the involvement of HVO_1527, 1528 and1529 in H. volcanii S-layer glycoprotein N-glycosylation,as revealed by analysis of SDS-PAGE migration, suscep-tibility to proteolysis and mass spectrometry of thisreporter, HVO_1527, 1528 and 1529 are now renamedaglF, aglI and aglG, according to the nomenclature pro-posed by Chaban et al. (2006) for genes involved inarchaeal N-glycosylation.

The transcription of aglB, aglF, aglG and aglI isregulated in a co-ordinated manner

Given their physical proximity in the genome, as wellas the common involvement of their products inN-glycosylation, efforts next focused on whether the tran-scription of aglB, aglF, aglG and aglI is co-ordinated.Towards this end, the transcription profile of these geneswas initially considered by investigating their upstreamregions for the presence of promoters.

As aglF and aglI lie adjacent to each other on theH. volcanii genome, assume the same orientation and areapparently separated by only 51 nucleotides, the possi-bility that the two genes are co-transcribed was tested.Accordingly, RT-PCR was performed using cDNA derivedfrom RNA extracted from cells grown to mid-exponentialphase, together with a forward primer directed against the5′ end of aglF and a reverse primer directed against the 3′end of aglI. As reflected in Fig. 5A, a single PCR productwas obtained, confirmed by sequencing to contain bothaglF and aglI. To further demonstrate that the transcriptionof aglF and aglI is under the control of a common pro-moter, the DNA sequence separating HVO_1526 and1527, i.e. that region lying upstream of the predicted startsite of aglF, was introduced into plasmid pJAM1020(Reuter and Maupin-Furlow, 2004), encoding for GFP, inplace of the Halobacterium cutirubrum rRNA P2 promoteroriginally present in the plasmid. Preliminary controlexperiments confirmed that in the absence of the native



promoter, no GFP expression could be detected (Fig. 5B).When the modified plasmid containing the 180 bp regionupstream of the predicted aglF start site in place of theoriginal promoter was used to transform H. volcanii cells,the expression of GFP could be clearly seen. By contrast,far less GFP expression was achieved when the originalplasmid pJAM1020 promoter region was replaced withthe 51 bp sequence separating aglF and aglI. Thus,although the region upstream of aglI is capable of direct-ing protein expression to a limited extent, the augmentedlevel of protein expression directed by the stronger aglFpromoter offers additional support for the concept thataglF and aglI, the products of which jointly participate in

addition of a hexuronic subunit to the S-layer glycoproteinpentasaccharide, are co-transcribed under the control of asingle promoter.

Unlike aglF and aglI, which assume the same orienta-tion in the H. volcanii genome, aglG and aglB are orientedin opposite directions, with the direction of aglG beinginverted. To determine whether the 118 bp DNA sequenceseparating the predicted start sites of aglG and aglBdrives the transcription of either or both genes, the originalplasmid pJAM1020 promoter was replaced by the 118 bpregion, introduced in either orientation. As also reflectedin Fig. 5B, the transcription of GFP was driven by thisH. volcanii sequence, regardless of its orientation. The

Fig. 4. The products of H. volcanii HVO_1527, 1528 and 1529 are involved in the biogenesis of the pentasaccharide decorating S-layerglycoprotein Asn residues. The MALDI-TOF spectra of the Asn-13-containing tryptic peptide derived from the S-layer glycoprotein of theWR536 background cells (upper left panel) and cells from the HVO_1527- [DHVO_1527 (aglF); upper right panel], HVO_1528- [DHVO_1528(aglI ); lower left panel] or HVO_1529- [DHVO_1529 (aglG); lower right panel] deleted strains are shown. The components of thepeptide-associated glycan are shown as an inset in the upper left panel, while the sugar subunits decorating the peptide peaks detected areindicated on the MALDI-TOF spectra.



level of GFP detected was, however, somewhat higherwhen the 118 bp region was inserted in the forward direc-tion, pointing to the promoter being stronger in driving thetranscription of aglB than of algG.

While aglB, aglF, aglG and aglI do not form anoperon, given the differential orientation of aglG, thepossibility remains that their transcription is somehowlinked. To begin testing this hypothesis, the relativelevels of aglB, aglF, aglG and aglI transcription werequalitatively assessed by comparing the levels of GFP in

cells transformed to transcribe the encoding gene underthe control of the aglB, aglF, aglI or aglG promoters,grown to mid-exponential phase. As reflected in Fig. 5,GFP expression driven through the aglB promoterexceeded that expression directed through the aglF, aglIor aglG promoters. To quantify these observations, real-time RT-PCR was performed to assess the relativeamounts of AglB, AglF, AglG and AglI mRNA in H. vol-canii cells grown to mid-exponential phase in completemedium, using primer pairs that bind with equivalent effi-ciencies (as determined in preliminary experimentsinvolving the drawing of standard curves describingprimer pair binding to serial dilutions of known quantitiesof cDNA). Based on the results of three experiments,each involving triplicate samples, it could be concludedthat H. volcanii cells grown to mid-exponential phase incomplete medium contain threefold less AglF mRNA,and fivefold less AglG and AglI mRNA than AglB mRNA(with all differences being significant to P < 0.01)(Fig. 6A). At present, it is not clear why different levels ofAglF and AglI mRNA were detected, if the two genes areco-transcribed. Thus, cells grown to mid-exponentialphase contain different amounts of aglB, aglF, aglG andaglI mRNA.

To determine whether changes in the transcriptionprofile of aglB, aglF, aglG and aglI take place in aco-ordinated manner, real-time PCR was employed toquantify AglB, AglF, AglG and AglI mRNA levels in cellsgrown to stationary phase, challenged with heat shock(i.e. 65°C for 45 min) or raised to mid-exponential phasein low salt- or high salt-containing medium (i.e. 1.75or 4.8 M NaCl, respectively). In these experiments, 16SrRNA was considered as a housekeeping marker to allowfor normalization of mRNA levels from cells in each growthcondition. The AglB, AglF, AglG and AglI mRNA levelsmeasured in these various growth conditions were, inturn, expressed in terms of fold increase relative to thosevalues obtained from cells grown to mid-exponentialphase in complete medium. Initially, AglB, AglF, AglG andAglI mRNA levels in cells either grown to stationary phaseor exposed to heat shock conditions are considered. Incells grown to stationary phase, AglB, AglF, AglG and AglImRNA levels were substantially reduced, relative to thoselevels realized during mid-exponential growth (Fig. 6B).AglB, AglF, AglG and AglI mRNA levels were alsodepressed upon transfer to heat shock conditions, relativeto the situation realized in cells grown to mid-exponentialphase. In both growth conditions, the decrease in AglBmRNA levels was 10- to 20-fold greater than the observedreduction in AglF, AglG or AglI mRNA levels.

A very different picture was obtained when real-timeRT-PCR was performed with cells grown in the presenceof reduced or elevated salt concentrations. In the case ofcells grown in 1.75 M NaCl-containing medium, statisti-

Fig. 5. Functional characterization of the promoter regions ofH. volcanii aglB, aglF, algG and aglI.A. RT-PCR reveals the co-transcription of aglF and aglI. PCRamplification was performed using a forward primer directedagainst the start of the coding region of aglF and a reverse primeragainst the end of the coding region of aglI together with cDNA(lane 1), RNA (lane 2) or DNA (lane 3) from H. volcanii strainWR536 background cells as template, or no nucleic acid template(lane 4).B. Upper panels: H. volcanii strain WR536 cells were transformedto express GFP, as directed by plasmid pJAM-1020 in which thepromoter region had been removed, in which the native promoterwas present, or when the region upstream to aglF or aglI replacedthe native promoter of the plasmid. Lower panel: The 118 bp regionseparating aglG and aglB served as promoter (aglB lane). In laneaglG, the same region, this time in the reverse orientation, servedas the promoter in plasmid pJAM-1020. GFP expression wasvisualized by immunoblotting using anti-GFP antibodies.



cally significant (P < 0.01) increases in AglF, AglG and AglImRNA levels were detected, while in cells grown in 4.8 MNaCl-containing medium, statistically significant (P <0.01) increases in AglF and AglI mRNA levels were noted,in both cases relative to those levels measured in cellsgrown to mid-exponential phase in medium containing3.5 M NaCl. The observed increases in transcription werehigher in the case of cells grown in low-salt conditions. Inboth low- and high-salt growth conditions, the increase inAglB mRNA levels was not statistically significant.

Thus, real-time RT-PCR reveals that changes in thetranscription of aglB, aglF, aglG and aglI transpire in aco-ordinated manner in the face of different growth con-ditions, although the nature of such changes depends onthe conditions experienced, possibly reflecting an adap-tive role of N-glycosylation in H. volcanii.

Discussion

The list of H. volcanii genes whose products participate inthe N-glycosylation of a reporter glycoprotein, the S-layerglycoprotein, is growing (Abu-Qarn and Eichler, 2006;Abu-Qarn et al., 2007; Abu-Qarn et al., 2008). The presentstudy confirms the involvement of three additional geneproducts in the N-glycosylation pathway, namely AglF,AglG andAglI, showing that all three proteins serve roles inthe biogenesis of the pentasaccharide decorating at leasttwo of the modified sequons of the H. volcanii S-layerglycoprotein (Abu-Qarn et al., 2007). Specifically,AglF andAglI are involved in the addition of the hexuronic acid foundat position three of the pentasaccharide, while AglG con-tributes to the addition of the hexuronic acid found atposition two. These findings, together with the earlier iden-tification of AglE and AglD as, respectively, participating inthe addition of the 190 Da and hexose species found atpositions four and five of the pentasaccharide (Abu-Qarnet al., 2007; Abu-Qarn et al., 2008), as well as the oligosac-charide transferase, AglB (Abu-Qarn et al., 2007), areleading to the delineation of the N-glycosylation pathway inH. volcanii (Fig. 7 and Yurist-Doutsch et al., 2008).

As is the case with AglD and AglE, the specific rolesplayed by AglF, AglG and AglI remain undefined.Homology-based analysis reveals that AglF, first identifiedthrough its similarity to eukaryal Mpg1 (Abu-Qarn andEichler, 2006), contains a COG1210 UDP-glucose pyro-phosphorylase domain, involved in UDP-glucose genera-tion. IfAglF indeed serves such a role, then the observationthat aglF deletion prevented addition of the second but notthe first hexuronic acid to the S-layer glycoprotein pen-tasaccharide suggests these two monosaccharides to benon-identical. This assumption awaits a complete chemicaldescription of the pentasaccharide. By contrast, both AglI,originally detected due to its homology to C. jejuniPglI (Abu-Qarn and Eichler, 2006), and AglG, not

Fig. 6. The transcription of aglB, aglF, algG and aglI isco-ordinated.A. Real-time RT-PCR was employed to assess the relativeamounts of aglB, aglF, algG and aglI mRNA in H. volcaniistrain WR536 cells grown to mid-exponential phase in richmedium. Values shown represent the average of threeexperiments � standard deviation, expressed relative to the level ofaglB mRNA, taken as 1. Differences from the level of aglB RNAmarked with the double asterisk are statistically significant toP < 0.01, as determined by Student’s t-test.B. Real-time RT-PCR was employed to assess the fold increase inaglB, aglF, algG and aglI mRNA in H. volcanii strain WR536 cellsgrown to stationary phase (stat.), subjected to heat shock, or raisedin low or high salt-containing medium, relative to those levelsdetected in cells grown to mid-exponential phase in rich medium.The values shown represent the average of 3–5 experiments. Barsmarked with the double asterisk are statistically distinct to asignificance of P < 0.01, while those marked with single asterisksare statistically distinct to a significance of P < 0.05, as determinedby Student’s t-test.



previously implicated in H. volcanii N-glycosylation, con-tain Pfam00535 glycosyltransferase 2 domains. Theseenzymes may thus be responsible for, respectively, addingthe third and second sugar subunits to a dolichol-linkedmonosaccharide as part of the assembly of the S-layerglycoprotein-linked pentasaccharide. Still, like AglD (Abu-Qarn et al., 2007) and AglE (Abu-Qarn et al., 2008), accu-rate description of AglF, AglG and AglI function awaits thedevelopment of in vitro H. volcanii N-glycosylation assays.

It is, however, clear that the perturbed N-glycosylationof the S-layer glycosylation resulting from deletion of aglF,aglG or aglI affects the behaviour of the H. volcaniiS-layer, as revealed by the enhanced protease sensitivityof the S-layer glycoprotein in the deletion strains. Thisobservation lends support to the previously proposedhypothesis that a properly glycosylated S-layer is impor-tant for H. volcanii survival (Abu-Qarn et al., 2007). None-theless, the perturbation to the S-layer that transpires inthe absence of AglF, AglG or AglI (or indeed AglE; Abu-Qarn et al., 2008) seems less significant than what occurseither in the absence of AglD, involved in addition of thefinal hexose of the N-linked pentasaccharide, or AglB, theH. volcanii oligosaccharide transferase (Abu-Qarn et al.,2007). While the absence of AglD led to the appearanceof an S-layer with modified architecture, and deletion ofaglB resulted in enhanced S-layer glycoprotein releasefrom the cell, no such effects were detected in theabsence of AglF, AglG or AglI (not shown). Moreover, theabsence of AglF, AglG or AglI had little effect on the abilityof H. volcanii cells to grow in increasingly saline medium(not shown), in contrast to what was observed in the aglDand aglB deletion strains (Abu-Qarn et al., 2007).

In addition to assessing the contributions of AglF, AglGand AglI to N-glycosylation in H. volcanii, the present studyalso addressed questions related to the transcription ofgenes comprising the N-glycosylation gene island thatincludes aglF, aglI, aglG and aglB. By allowing the regionslying upstream of these genes to direct the expression ofGFP, as well as through real-time RT-PCR, relationsbetween the various genes were elucidated. Such analy-ses revealed aglF and aglI to be co-transcribed andshowed that the same region directs the expression of bothaglG and aglB, albeit in different orientations, and at differ-ent efficiencies. Nonetheless, the co-ordinated behaviourof the four genes could be demonstrated. In response tostationary phase growth or heat shock, H. volcanii cellspresent less mRNA directing the synthesis of thoseenzymes involved in the assembly of the pentasaccharidedecorating the S-layer glycoprotein, i.e. aglF, aglI andaglG, than in cells grown to mid-exponential phase. Cellsgrown to stationary phase or challenged with heat shockalso drastically reduce the amount ofAglB mRNA, directingthe biosynthesis of the enzyme catalysing the final step ofN-glycosylation. When H. volcanii cells are, however,grown in medium containing lowered or elevated salt con-centrations, the opposite holds true. Here, AglB mRNAlevels are maintained relatively constant while transcrip-tion of the neighbouring AglF-, AglG- and AglI-encodinggenes is augmented. Thus, while transcription of AglB,AglF, AglG and AglI mRNA transpires in a co-ordinatedmanner, the levels of these N-glycosylation island genescan be either jointly augmented or diminished, dependingon the growth conditions. These observations are in linewith earlier studies reporting differential transcription of the

Fig. 7. Schematic depiction of the H. volcanii N-glycosylation pathway, as described to date. Based on the findings presented in this andearlier reports (Abu-Qarn and Eichler, 2006; Abu-Qarn et al., 2007; 2008), AglB, AglD, AglE, AglF, AglG and AglI have been shown toparticipate in the series of reactions ultimately leading to N-glycosylation of the H. volcanii S-layer glycoprotein. Apart from AglB, all of theother N-glycosylation pathway components appear to act on the cytoplasmic face of the plasma membrane. After reorientation of thelipid-linked pentasaccharide to face the cell exterior by an as yet unidentified agent, AglB transfers the glycan moiety to select sequons in theprotein target. While AglB also transfers precursor polysaccharides to the S-layer glycoprotein, it remains to be determined whether the same‘flippase’ translocates the lipid-linked pentasaccharide precursors across the plasma membrane. The legend describes the components of theS-layer glycoprotein-bound pentasaccharide.



members of homologous H. volcanii gene families puta-tively involved in N-glycosylation as a function of growthconditions (Abu-Qarn and Eichler, 2006). Together, thesefindings support the hypothesis that in H. volcanii,N-glycosylation may be modulated in response to thestage or conditions of growth.

The gene island encompassing HVO_1527, 1528, 1529and 1530, respectively, encoding AglF, AglI, AglG andAglB, lays downstream of AglE, shown to be encoded bya DNA sequence lying between the wrongly delineatedHVO_1523 and HVO-1524 sequences (Abu-Qarn et al.,2008). The intervening sequences, i.e. HVO_1525 and1526, are currently annotated as encoding a putativemembrane protein and an insertion element respectively.Future efforts will address whether the products of thesegenes also play a role in N-glycosylation. The same holdstrue for HVO_1531 and 1532, annotated as encoding aUDP-glucose dehydrogenase and a predicted membraneprotein, respectively.

In conclusion, while the present study has expandedour understanding of protein N-glycosylation in Archaea,much remains unknown of the archaeal versionof this post-translational modification (Yurist-Doutschet al., 2008). Continued efforts at deciphering the N-glycosylation in H. volcanii as well as in other species,such as Methanococcus voltae (Chaban et al., 2006;Shams-Eldin et al., 2008) and Pyrococcus furiosus (Iguraet al. 2008), will help provide a more complete picture ofthis protein processing event across evolution.

Experimental procedures

Growth conditions

Haloferax volcanii WR536 (H53; Allers et al. 2004; Table 1),obtained from Moshe Mevarech (Tel Aviv University), wasgrown in complete medium containing 3.4 M NaCl, 0.15 MMgSO47H20, 1 mM MnCl2, 4 mM KCl, 3 mM CaCl2, 0.3%(w/v) yeast extract, 0.5% (w/v) tryptone, 50 mM Tris-HCl,pH 7.2, at 40°C (Mevarech and Werczberger, 1985). Forlow-salt growth conditions, 1.75 M NaCl was included in thegrowth medium, for high-salt growth conditions, 4.8 M NaClwas included in the growth medium, whereas for heat shock,cultures grown in complete medium were transferred to a65°C environment for 45 min. In casamino acids medium, theyeast extract and tryptone were replaced by casamino acids(Difco, Detroit MI) at a final concentration of 0.5% (w/v).Escherichia coli were grown in Luria–Bertani medium.

Gene deletion and complementation

Deletion of H. volcanii HVO_1527,1528 and 1529 wasachieved as previously described (Abu-Qarn and Eichler,2006). The primers used to amplify regions of approximately500 bp in length flanking the coding sequences of each geneare listed in Table 2. XhoI and HindIII sites were introduced inthe 1527-, 1528-, 1529-for 5′ up and -rev 5′ up sequences,respectively, while BamHI and XbaI sites were introduced inthe corresponding 3′ down and rev 3′ down sequencesrespectively. For complementation, HVO_1527, 1528, 1529were PCR amplified from H. volcanii strain WR536 genomicDNA using primers designed to introduce NdeI and KpnIrestriction sites (Table 2) at the 5′-and 3′ ends of the coding

Table 1. Strains and plasmids used in this study.

Description References

StrainsWR536 (H53) H. volcanii DS70 background, DpyrE2, DtrpA Allers et al. (2004)WR536DaglF H. volcanii WR536 pTA131aglF pop-in/pop-out; trpA +, DpyrE2, DaglF This studyWR536DaglG H. volcanii WR536 pTA131aglG pop-in/pop-out; trpA +, DpyrE2, DaglG This studyWR536DaglI H. volcanii WR536 pTA131aglI pop-in/pop-out; trpA +, DpyrE2, DaglI This study

PlasmidspTA131 pBluescriptII with pGB70 BamHI-XbaI pyrE2-containing fragment

(Bitan-Banin et al., 2003) under control of Halobacterium salinarumferrodoxin promoter (Pfeifer et al., 1993).

Allers et al. (2004)

pTA131aglF pTA131 containing XhoI-HindIII and BamHI-XbaI flanking regions of aglF This studypTA131aglG pTA131 containing XhoI-HindIII and BamHI-XbaI flanking regions of aglG This studypTA131aglI pTA131 containing XhoI-HindIII and BamHI-XbaI flanking regions of aglI This studypJAM1020 0.74 kb BamHI-SacI fragment of pSMRSGFP blunt end ligated with a 9.94 kb

NdeI-BlpI fragment of pJAM202, an H. volcanii-E. coli shuttle expression plasmidwith psmB-his6 gene

Reuter and Maupin-Furlow(2004)

pJAM1020nopro pJAM1020 lacking its promoter (BamHI-XbaI cut), blunt-end ligation This studypJAMaglFpro pJAM1020 with aglF promoter (BamHI-XbaI cut) replacing native promoter This studypJAMaglGpro pJAM1020 with aglG promoter (BamHI-XbaI cut) replacing native promoter This studypJAMaglIpro pJAM1020 with aglI promoter (BamHI-XbaI cut) replacing native promoter This studypJAMaglBpro pJAM1020 with aglB promoter (BamHI-XbaI cut) replacing native promoter This studypWL-CBD pWL-Nov vector containing the PrR16 promoter fused to the cbd gene encoding

for the C. thermocellum cellulosome CBDIrihimovitch and Eichler

(2003)pWL-CBD-HVO_1527 pWL-CBD containing NdeI-KpnI-flanked HVO_1527 This studypWL-CBD-HVO_1528 pWL-CBD containing NdeI-KpnI-flanked HVO_1528 This studypWL-CBD-HVO_1529 pWL-CBD containing NdeI-KpnI-flanked HVO_1529 This study



region, respectively, and ligated into the pGEM-T Easy vector(Promega). The HVO_1527, 1528, 1529 genes were thenexcised upon digestion with NdeI and KpnI and insertedinto the pWL-CBD vector (Irihimovitch and Eichler, 2003),also digested with the same restriction enzymes, resulting inDNA encoding the Clostridium thermocellum cellulosomeCBD fused to the 5′ end of HVO_1527, 1528 or 1529respectively.

Real-time RT-PCR

Real-time RT-PCR was performed essentially as described(Yurist et al., 2007) using SYBR Green PCR 2¥ Master Mix(Applied Biosystems, Foster City, CA). Primers (listed inTable 2) were designed using Primer Express 2.0 software(PerkinElmer Life Sciences) and employed at a final concen-tration of 400 nM. For PCR amplification, 20 ml reactionswere subjected to 40 reaction cycles in an ABI Prism 7300light cycler (Applied Biosystems). Primer efficiency wasascertained by drawing a standard curve based on five-fold serial dilutions of cDNA when using primers forHVO_1527,1528, 1529 and 1530 and 10-fold serial dilutionswhen using primers for 16S rRNA. For expression analysis ofHVO_1527,1528, 1529 and 1530 in H. volcanii WR536 cells,100 ng of cDNA were used in 20 ml PCR amplifications. Formeasuring the levels of 16S rRNA housekeeping gene,0.16 ng of cDNA were used in a 20 ml reaction. Relative

quantification of mRNA levels was calculated using the stan-dard 2-DDct formula.

Mass spectrometry

Mass spectrometry was performed essentially as describedelsewhere (Abu-Qarn et al., 2008).

Immunoblotting

For immunoblotting, proteins were electrotransferred fromSDS-PAGE gels to nitrocellulose membranes (0.45 mm,Schleicher and Schuell, Dassel, Germany) and incubatedwith anti-GFP (Roche) or anti-CBD (a gift from Ed Bayer,Weizmann Institute of Science, Rehovot, Israel) antibodies,each at a 1:1000 dilution. HRP-conjugated goat anti-mouse(1:2500; KPL, Gaithersburg, USA) or anti-rabbit (1:4000, Bio-Rad) antibodies, serving as secondary antibodies for bindingof the anti-GFP or anti-CBD sera respectively. Detection ofantibody binding was achieved using ECL Western blottingdetection reagent (Amersham Biosciences, UK).

Accession numbers

The sequence of H. volcanii aglF, aglI and aglG have beendeposited into the EMBL/GenBank/DDBJ databases andassigned accession number AM991128, AM991129 andAM991130, respectively.

Table 2. Primers used in this study.

Primer name Forward primers Reverse primers

Flanking region primersaglF 5� up gggctcgagCGTCATTACGAACCCATACT cccaagcttAGTAAGAGAGTCATCGAGGCaglF 3� down gggggatccACATCTAATCACGTGTGCTT ccctctagaTGTGCGTCAAACCTTGCTGGaglG 5� up gggctcgagCCAAAAGCGACTTGGCTACG cccaagcttAAGTCGGAGTTACCGAGGAGaglG-3� down gggggatccTTGGCATTTCAGCGGGTGTT ccctctagaCACAGACCGCCTTTCCCATAaglI 5� up gggggctaccGCTGATGCTTGGCGACAACAT cccctcgagTGAAATCAGGTTTACTCCCACaglI 3� down gggggatccCCACGAGGTTCGGCGTCAACA ccctctagaCGTCGGGTGTGACGAACGTG

Open reading frame primersaglF TAAAGGAACCCGTCTTCGAC GTCGTTGTTCTGCTTCGTCAaglG CTCGATGGAACGGTACGAGT TTCGTCTTCTCCACGAGGTTaglI ATGGCTGATTCTCCGTTTCC TCAGCGGGTGTTCCCGCGAACGtrpA cccgaattcTTATGTGCGTTCCGGATGCG

Complementation primersCBD-aglF gggcatATGCAAGCTGTTGTCCTCGCC cccggtaccCTACTCGGTCGCCTGTGTCGTTTCCCBD-aglG gggcatATGAAAGTCTCCGTCGTGGTC cccggtaccCTAATTATTCGTCTTCTCCACGCBD-aglI gggcatATGGCTGATTCTCCGTTTCCTTG cccggtaccTCAGCGGGTGTTCCCGCGAACG

Plasmid pJAM1020 promoter primersaglF promoter gggtctagaATAACCGCAGGACACCAACCC cccggatccTAGTAAGAGAGTCATCGAGGCaglG promoter gggtctagaTTGTGACCAACAACCGCCAAG cccggatccTAAGTCGGAGTTACCGAGGAGaglI promoter ctagaGACATCTAATCACGTGTGCTTTTTATTA

GTGGGAGTAAACCTGATTTCAAggatccTTGAAATCAGGTTTACTCCCACTAATAAAAAGCACACGTGATTAGATGTCt

aglB promoter gggtctagaTAAGTCGGAGTTACCGAGGAG cccggatccTTGTGACCAACAACCGCCAAG

Real-time RT-PCR primersaglF RT GTGAGGCAATCGACCTTCTC GGTCTTCTGGGTAGCCGATAaglG RT GAAAGTCTCCGTCGTGGTCT GTCTGTGCGAGGACACTCTCaglI RT ACATACCCGACGGAGAGAGT GAGTGTGACGTTCTCGTGCTaglB RT AACCGGATGGAGTACTACGG AGGACGGTAATCCAGTGACC16S rRNA RT CGGGTTGTGAGAGCAAGAG GGTCGAGAAAAGCGAGGAC

Genomic DNA sequences are in capitals.



Acknowledgements

J.E. is supported by grants from the Israel Science Founda-tion (grant 30/07) and the US Air Force Office for ScientificResearch (grant FA9550-07–10057). The Imperial Collegework was supported by the Biotechnology and BiologicalSciences Research Council (grants B19088, SF19107 andBBC5196701). S.Y.D. is the recipient of a Negev-Faran Asso-ciates Scholarship.

References

Abu-Qarn, M., and Eichler, J. (2006) Protein N-glycosylationin Archaea: defining Haloferax volcanii genes involved inS-layer glycoprotein glycosylation. Mol Microbiol 61: 511–525.

Abu-Qarn, M., Yurist-Doutsch, S., Giordano, A., Trauner, A.,Morris, H.R., Hitchen, P., et al. (2007) Haloferax volcaniiAglB and AglD are involved in N-glycosylation of theS-layer glycoprotein and proper assembly of the surfacelayer. J Mol Biol 14: 1224–1236.

Abu-Qarn, M., Giordano, A., Battaglia, F., Trauner, A., Morris,H.R., Hitchen, P., et al. (2008) Identification of AglE, asecond glycosyltransferase involved in N-glycosylation ofthe Haloferax volcanii S-layer glycoprotein. J Bacteriol 190:3140–3146.

Allers, T., Ngo, H.P., Mevarech, M., and Lloyd, R.G. (2004)Development of additional selectable markers for the halo-philic archaeon Haloferax volcanii based on the leuB andtrpA genes. Appl Environ Microbiol 70: 943–953.

Bitan-Banin, G., Ortenberg, R., and Mevarech, M. (2003)Development of a gene knockout system for the halophilicarchaeon Haloferax volcanii by use of the pyrE gene.J Bacteriol 185: 772–778.

Chaban, B., Voisin, S., Kelly, J., Logan, S.M., and Jarrell. K.F.(2006) Identification of genes involved in the biosynthesisand attachment of Methanococcus voltae N-linked glycans:insight into N-linked glycosylation pathways in Archaea.Mol Microbiol 61: 259–268.

Coutinho, P.M., Deleury, E., Davies, G.J., and Henrissat, B.(2003) An evolving hierarchical family classification forglycosyltransferases. J Mol Biol 25: 307–317.

Eichler, J. (2000) Novel glycoproteins of the halophilicarchaeon Haloferax volcanii. Arch Microbiol 173: 445–448.

Eichler, J., and and. Adams, M.W.W. (2005) Posttranslationalprotein modification in Archaea. Microbiol Mol Biol Rev 69:393–425.

Glucksmann, M.A., Reuber, T.L., and Walker, G.C. (1993)Family of glycosyl transferases needed for the synthesisof succinoglycan by Rhizobium meliloti. J Bacteriol 175:7033–7044.

Helenius, A., and Aebi. M. (2004) Roles of N-linked glycans inthe endoplasmic reticulum. Annu Rev Biochem 73: 1019–1049.

Igura, M., Maita, N., Kamishikiryo, J., Yamada, M., Obita, T.,Maenaka, K., and Kohda, D. (2008) Structure-guided iden-tification of a new catalytic motif of oligosaccharyl-transferase. EMBO J 27: 234–243.

Irihimovitch, V., and Eichler, J. (2003) Post-translationalsecretion of fusion proteins in the halophilic archaea Halof-erax volcanii. J Biol Chem 278: 12881–12887.

Kruszewska, J.S., Saloheimo, M., Penttilä, M., and Palama-rczyk, G. (1998) Isolation of a Trichoderma reesei cDNAencoding GTP: a-D-mannose-1-phosphate guanyltrans-ferase involved in early steps of protein glycosylation. CurrGenet 33: 445–450.

Linton, D., Dorrell, N., Hitchen, P.G., Amber, S., Karlyshev,A.V., Morris, H.R., et al. (2005) Functional analysis ofthe Campylobacter jejuni N-linked protein glycosylationpathway. Mol Microbiol 55: 1695–1703.

Marth, J.D. (1996) Complexity in O-linked oligosaccharidebiosynthesis engendered by multiple polypeptide N-acetylgalactosaminyltransferases. Glycobiology 6: 701–705.

Mengele, R., and Sumper, M. (1992) Drastic differences inglycosylation of related S-layer glycoproteins from moder-ate and extreme halophiles. J Biol Chem 267: 8182–8185.

Messner, P. (2004) Prokaryotic glycoproteins: unexplored butImportant. J Bacteriol 186: 2517–2519.

Mevarech, M., and Werczberger, R. (1985) Genetic transferin Halobacterium volcanii. J Bacteriol 162: 461–462.

Pfeifer, F., Griffig, J., and Oesterhelt, D. (1993) The fdx geneencoding [2Fe-2S] ferrodoxin of Halobacterium salinarium(H. halobium). Mol Gen Genet 239: 66–71.

Reuter, C.J., and Maupin-Furlow, J.A. (2004) Analysis ofproteasome-dependent proteolysis in Haloferax volcaniicells, using short-lived green fluorescent proteins. ApplEnviron Microbiol 70: 7530–7538.

Schneider, K.L., Pollard, K.S., Baertsch, R., Pohl, A., andLowe, T.M. (2006) The UCSC archaeal genome browser.Nucleic Acids Res 34: D407–D410.

Shams-Eldin, H., Chaban, B., Niehus, S., Schwarz, R.T.,and Jarrell, K.F. (2008) Identification of the archaeal alg7gene homolog (N-acetylglucosamine-1-phosphate trans-ferase) of the N-linked glycosylation system by cross-domain complementation in yeast. J Bacteriol 190: 2217–2220.

Soppa, J., Baumann, A., Brenneis, M., Dambeck, M., Hering,O., and Lange, C. (2008) Genomics and functional genom-ics with haloarchaea. Arch Microbiol doi:10.1007/s00203-008-0376-4.

Spiro, R.G. (2002) Protein glycosylation: nature, distribution,enzymatic formation, and disease implications of glycopep-tide bonds. Glycobiology 12: 43R–56R.

Sumper, M., Berg, E., Mengele, R., and Strobel, I. (1990)Primary structure and glycosylation of the S-layer protein ofHaloferax volcanii. J Bacteriol 172: 7111–7118.

Ten Hagen, K.G., Fritz, T.A., and Tabak, L.A. (2003)All in the family: the UDP-13 GalNAc: polypeptideN-acetylgalactosaminyltransferases. Glycobiology 13:1R–16R.

Yurist, S., Dahan, I., and Eichler, J. (2007) SRP19 is a dis-pensable component of the signal recognition particle inArchaea. J Bacteriol 189: 276–279.

Yurist-Doutsch, S., Chaban, B., VanDyke, D., Jarrell, K.F.,and Eichler, J. (2008) Sweet to the extreme: protein glyco-sylation in Archaea. Mol Microbiol 68: 1079–1084.



Molecular Microbiology First published online 15 July 2008...

Documents

Transcript of Molecular Microbiology First published online 15 July 2008...