Chapter 19

Molecular Marker Techniques to Study Variability of Populus Pathogens1

Girma M. Tabor and Harold S. McNabb, Jr.

Introduction

Molecular genetic techniques are commonly used in many laboratories and many have been developed that address diverse problems in plant pathology. In recent years, tremendous advances have occurred concerning the molecular genetics of plant/parasite interactions includ­ing the cloning of plant genes for (Jones et al. 1994; Martin et al. 1993; Whitham et al. 1994) and corresponding avirulence genes in pathogens (Huynh et al. 1989; Kearney and Staskawicz 1990; Kobayashi et al. 1989, 1990; Staskawicz et al. 1984). Studies on the molecular genetic basis of in poplar are also underway (Cervera et al. 1996; Goue-Mourier et al.1996; Newcombe and Bradshaw 1996). However, poplar pathogen populations must be charac­terized before ecological interactions of pathogenesis and host resistance are fully understood.

The crown gall pathogen (Agrobacterium tumefaciens) and its host interactions are genetically and biochemi­cally well described (Beneddra et al. 1996; Binns 1990; Stachel et al. 1985, 1986; Yusibov et al. 1994; Zupan and Zambryski 1995). However, molecular genetic studies of other poplar pathogens and their associated diseases are just developing and are primarily tailored toward basic questions on taxonomy, epidemiology, and popu­lation genetics. An understanding of these basic qu es­tions is urgently needed so that critical processes involved in host-pathogens interactions will be defined and used to establish coherent selection and breeding programs for Populus spp.

' Klopfenstein, N.B.; Chun, Y. W.; Kim, M.-S.; Ahuja, M.A., eds. Dillon, M.G.; Carman, R.C.; Eskew, L.G., tech. eds. 1997. Micropropagation, genetic engineering, and molecular biology of Populus. Gen. Tech. Rep. RM-GTR-297. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 326 p.

150

Many molecular marker techniques are available to gen­erate diverse genetic information for various purposes. Molecular marker techniques used to study Populus patho­gens are the same as those used to study the host. Because these techniques are well described elsewhere in this vol­ume (Cervera et al.; Lin et al.; Noh and Lee), a detailed description is not presented here. However, various at­tributes of these techniques are discussed within the con­text of this chapter.

Polymerase chain reaction (PCR) methods are the most widely used molecular genetic techniques to study Populus pathogens. Although PCR ·offers a virtually limitless source of genetic information, its use is curtailed because basic information on the taxonomy, etiology, and epide­miology of the pathogens is lacking.

In this chapter, we present some preliminary studies conducted to gain understanding about 2 economically important pathogens of Populus, Septaria spp. and Melampsora spp. Presently, random amplified polymorphic DNA (RAPD) and site-directed PCR are used in Populus pathology laboratories to provide basic molecular genetic information of Populus pathogens.

Random Amplified Polymorphic DNA {RAPD)

Diseases that are serious problems to many Populus clones are leaf and stem diseases caused by Septaria spp. In the north central and northeastern United States, 5. musiva (teleomorph: Mycosphaerella populorum) is consid­ered a serious pathogen. Besides leaf spot, S. musiva causes lethal stem cankers on Populus triclzocarpa hybrids. In the Pacific Northwest (PNW) of North America, S. populicola (teleomorph: M. populicola) causes leaf spot without lethal stem cankers. Of current debate is whether these 2 Septaria populations are different species or whether canker de­velopment is limited by the environmental conditions in the PNW. Using RAPDs, Ward and Ostry (1996) showed that bulked collections from these 2 pathogen populations exhibit molecular polymorphism, suggesting that these populations may be isolated and distinct. They also found

This file was created by scanning the printed publication.Errors identified by the software have been corrected;

however, some errors may remain.

that Septaria population from the P NW did not exhibit much polymorphism. In contrast, molecular polymor­phism was observed within populations from the North Central United States (figure 1).

RAPD markers can be reliable for typing an individual. In contras t, typing a population using RAPDs is d iff icult because collected samples mus t accurately represent a ll individua ls of a population. H owever, obtaining a repre­sentative sample from wild populations is form idable and often impossible. In addition, RAPD markers a re not easy to reproduce. The problem of obtaining representa ti ve samples of a p opulation, coupled w ith the re prod ucibility problems o f RAPD markers, can rende r these markers unreliable for population typing .

RAPD ma rkers linked to plant genes of interest can be successfull y used for selection, breeding, and other gene tic manipulations (B radshaw and Stettler 1995; Goue-Mourier et a l. 1996; H a ley et a l. 1993; Miche lm ore et a l. 1991;

ewcombe and Bradshaw 1996). Similarly, RAPD mark­ers may be important when working w ith pathogen iso­lates that are inbreds or isogenic.

Site-Directed Polymerase Chain Reaction (PCR)

Site-directed PCR requires some p rior knowledge of tar­get Dt A sequences to be amplified. The funga l ribosomal R A (rR A) genes are wid e ly u sed for s ite-d irected PCR because they comprise domains that are h ighly conserved

Figure 1. Random amplified polymorphic DNA (RAPD) of Septaria spp. isolates from the North Central states, USA. From the left, lane 1 =1-kb DNA ladder; lane 2=RAPD control (no template DNA); and lanes 3 through 20=RAPDs various Septaria spp. isolates from the North Central s tates using Operon primer F-1 0, 5' to 3' - GGAAGCTIGG.

USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.

Molecular Genetic Analysis of Populus Chloroplast DNA

among a wide range of taxa. The conserved nature of these domains has allowed the synthesis of genera l p rimers that can a mplify several regions of the rRNA operon from vari­ous fungi. Consequently, this has allowed the synthesis of taxa-specific primers (Gard es and Bruns 1993; Tisserat et a!. 1994; White et al. 1990).

A typica l eukaryotic nuclear rRNA is polycistronic; cod­ing regions for 185, 5.85, and 285 rR ' As are g rouped (in the order listed) within a single transcription unit. An en­tire transcribed unit includes 2 noncoding regions, te rmed the internal t ranscribed spacers (ITS), which separate the 3 coding regions from each other. Sequences in the rRNA coding. regions a re h ighly conserved among related taxa. Litt le or no variation is evident among rRNA ~oding se­quences of closely re la ted taxa at the class, family, genus, or species level. This lack of variation in the rRNA coding regions among related taxa limits their use as a diagnos tic too l.

Besides the conserved regions, the rRN A operon of sev­eral fungi consists of regions that can vary among species in a genus and among subspecies within a species. These variable regions can have practical importance to a Populus pathologis t. Species, subspecies, and hybrids potentia lly can be identified based on their differences in the variable regions of the rR TA op eron. Depending on the taxa, the ITS regions of fungi may vary in length and ON A sequence (Ga rd es and Bruns 1993; Tisserat e t a l. 1994; Wh ite et al. 1990) und muy be used to identify and classify funga l pathogens o f Populus.

The other region of the rRI A that may be of practical value to a p lant pathologist is the intergenic spacer (IGS) region. In most organisms, rRNA genes occur as multip le copies clus tered in long tandem a rrays on several differ­ent chromosomes. A single transcription uni t w ithin a clus­ter is separated by an IGS tha t is not transcribed. In some fungi, the IGS regions con tain 55 genes, producing 2 IGS regions (Kim e t a l. 1995). IGS lengths and sequences are known to va ry among related taxa, w h ich can be exp loited for practical identi fication purposes.

Coding a nd noncoding regions of rR 'A genes from sev­eral fungi can be readily PCR amplified with genera l prim­ers that target rRNA genes from diverse organisms. PCR products then may be sequenced using automated se­quencing machines, and these DNA sequences can be used for diagnos tic and phylogenetic stud ies.

When ITS and IGS lengths are the same from separate pathogen isolates, seque ncing may reveal some d ifferences in the DNA. Based on the DNA sequence diffe re nces, unique enzyme restriction sites may be identified and used to generate Dt A restriction patterns that are unique to these pathogens. In addition, based on D A sequence dif­ferences, specific PCR p rimers can be designed for selec­ti ve a mplifi ca ti o n of D NA fragments fro m specific pathogen races or species (Gardes and Bruns 1993; Tisserat et a !. 1994).

151

Section Ill Molecular Biology

In our laboratory, ITS regions and the 5.8S rRNA genes o f the 3 major Melampsorn species on ~opulus w~re amplified using gene ra l prime rs. Derive~ mf~rmat10n wi ll be used to ide ntify species and p ossible mte rspe­cific hybrids among M. medusae, M. occidental is, a nd M. larici-popul ina .

Materials and Methods

Template DNA

Template DNA was obta ined by e ither adding a few (10 to 30) ured iospores directly to the PCR mixture or by extracting genomic 0 'A from urediospores. To extract genomic DNA, fresh d ry u rediospores were mixed with an equal volume of d iatoma ceous earth product and ground w ith a p lastic pestle operated by an electric dri~l. The lysis buffer containing 50 mM Tris-HCI (pH 7.2), ::JO mM EDTA (pH 8.0), and 3 percent sod iu m dodecyl sul­fate (SDS) was a utoclaved for 15 min . The grinding s lurry was centrifuged at 800 x g and incuba ted at 65 oc for 1 h. After incubation, s tanda rd p heno l/ chloroform extraction and e thanol precipitation were cond ucted to obtain the temp late DNA.

Primers and PCR Amplification

Primers u sed in thi s procedure we re ITS4 (TCCTCCGCTTATTG AT ATGC) a n d ITS5 (GGAAGTAAAAGTCGTAACAAGG). These primers a re uni versa l because they amp li fy rRNA genes from wide range o f fun g i (Ga rd es and Bruns 1993; Tissera t et a l. 1994; White et al. 1990).

The amplification reaction was performed in 100 1t1 volumes containing 10 mM Tris- HC I (pH 8.3), 50 mM KCI, 200 11M of each dNTP (dATP, d TTP, d GTP, and dCT P), 0.5 11M of each primer, 2.5 units of Taq poly­merase, and 1.5 mM MgC I

2• Am pli fica ti on was con­

ducted for 35 cycles of d enaturation (1 m in) at 93 °C, anneal ing (35 sec) at 58 °C, and ex ten sion (2 min) a t 72 oc. Fin a l extensional 72 oc was pe rformed fu r 10 min . All reagents were obtained from the Perkin-Elmer Cor­poration (Norwa lk, CT, USA).

Restriction Enzyme Digestion

The PCR product was electrophoresed in 1.4 percent agarose gel, s tained with ethidium bromide (0.5Jig / l), and visualized under UV light. The PCR product then was di­gested with severa l restriction enzymes in attempts to de­tect any restriction fragment leng th polymorphism.

152

Sequencing of PCR Product

The PCR products were purified w ith spin columns (Amicon, Inc., Beverly, MA, USA). Product concentration was measured using a fluorometer, and the concentration was adjusted for a utomated sequencing.

Results

Ampli fied produ cts from intact spores and genom ic DNA were approximately 700 base pairs and no differ­ence in product size was observed among tested species of Melampsorn (figure 2). Restriction digestion products of several enzymes did not produce any de tectable polymor­phism for use in distinguishing the 3 species. This also was supported by DNA sequence data in that ITS and 5.8S rRNA gene sequences from all 3 species showed a very high degree of similari ty. These ITS and 5.8S sequen~es from Melmnpsom spp. were a lso highly homologous With those from other rus t fung i.

Discussion

Our resu lts indicate that DNA sequences of ITS regions from the 3 Melampsorn species a rc identical. Thus far, these sequences ha ve exhibited no distinguishing characteris­tics for d iagnostic purposes. As expected, the 5.8S genes were also identica l. Although the ITS and 5.8S sequences cannot be used for disting uishing these 3 species, these DNA sequences a re useful for phylogenetic comparisons w ith other orga nisms. The ability to amplify rRNA genes without ex tracting genomic DNA grea tly simplifies stud­ies on rRt A genes o f Me/am psora species.

Figure 2. Polymerase chain reaction (PCR) products showing the 2 ITS regions and the • 5.8S rRNA gene from 3 species of Melampsora with primers ITS4 and ITS5. Intact spores provided as template DNA. From the left, lanes 1 through 3=M. larici-populina; lanes 4 through 6=M. occidentalis; lanes 7 through 9=M. medusae; lane 1 O=control (no template) ; and lane 11 =1 00 bp ladder.

USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.

Acknowledgments

This research was supported under Subcontract No. 19X-43391C with Oak Ridge National Laboratory under Mar­tin Marietta Energy Systems, Incorporated contract DE-ACOS-840R21400 with the U.S. Department of Energy. We thank Dr. Michael E. Ostry for providing a gel photo­graph used in this manuscript (figure 1 ).

Literature Cited

Beneddra, T.; Pecard, C.; Petit, A.; Nesme, X. 1996. Corre­Ia tion between susceptibility to crown gall and sensi­tivity to cytokinin in aspen cultivars. Phytopathology. 86: 225-231.

Binns, A.N. 1990. Agrobacterium-mediated gene delivery and the biology of host range limitations. Physiologia Plantarum. 79: 135-139.

Bradshaw, H.D., Jr.; Stettler, R.F. 1995. Molecular genetics of growth and development in Populus. IV. Mapping QTLs with large effects on growth, form, and phenol­ogy traits in a forest tree. Genetics. 139: 963-973.

Cervera, M.-T.; Gusmao, J.; Steenackers, M.; Storme, V.; Vanden Broeck, A.; Van Mo~tagu, M.; Boerjan, W. 1996. The use of bulked segregant analysis to identify AFLP"' molecular markers closely linked to Melampsora larici­populina resistance in Populus. In: Ahuja, M.R.; Boerjan, W.; Neale, D.B., eds. Somatic cell genetics and molecu­lar genetics of trees. Dordrecht, The Netherlands: Kluwer Academic Publishers: 205-210.

Gardes, M.; Bruns, T.D. 1993. ITS primers with enhanced specificity for Basidiomycetes-application to the iden­tification of mycorrhizae and rusts. Molecular Ecology. 2: 113-118.

Goue-Mourier, M.C.; Faivre-Rampant, P.; Le Guerroue, B.; Lefevre, F.; Villar, M. 1996. Molecular and genetic ap­proaches to rust resistance (Melampsom sp.) in poplar (Populus sp.). In: Ahuja, M.R.; Boerjan, W.; Neale, D.B., eds. Somatic cell genetics and molecular genetics of trees. Dordrecht, The Netherlands: Kluwer Academic Publishers: 249-254.

Haley, S.D.; Miklas, P.N.; Stavely, j.R.; Byrum, J.; Kelly, J.D. 1993. Identification of rapid markers linked to a major rust resistance gene block in common bean. Theor. Appl. Genet. 86: 505-512.

Huynh, T.V.; Dahlbeck, D.; Staskawicz, B.J. 1989. Bacterial blight of soybean: regulation of a pathogen gene deter­mining host cultivar specificity. Science. 245: 1374-1377.

Jones, D.A.; Thomas, C.M.; Hammond-Kosack, K.E.;

USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.

Molecular Genetic Analysis of Populus Chloroplast DNA

Balint-Kurti, P.J.; Jones, J.D.G. 1994. Isolation of the to­mato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science. 266: 789-793.

Kearney, B.; Staskawicz, B. 1990. Widespread distribution and fitness contribution of Xanthomonas campestris a virulence gene avrBs2. Nature. 346: 385-386.

Kim, W.K.; Mauthe, W.; Harder, D.H.; Klassen, G.R.; Fox, 5. 1995. The 55 ribosomal RNA gene region of several cereal rust, pine rust and cereal bunt fungi. Proceed­ings of the fourth IUFRO rusts of pines working party conference, Tsukuba, Japan: 163-169.

Kobayashi, D.Y.; Tamaki, S.; Keen, N.T. 1989. Cloned avirulence genes from the tomato pathogen Pseudomo­nas syringae pv. tomato confer cultivar specificity on soy­bean. Proc. Natl. Acad. Sci. USA. 86: 157-161.

Kobayashi, D.Y.; Tamaki, S.J.; Trollinger, D.J.; Gold, 5.; Keen, N.J. 1990. A gene from Pseudomonas syringaepv. glycinea with homology to avirulence gene from Pseudomonas syringae pv. tomato but devoid of the avirulence pheno­type. Malec. Plant-Microbe Interact. 3: 112-121.

Martin, G.B.; Brommonschenkel, S.H.; Chunwongse, J.; Frary, A.; Ganal, M.W.; Spivey, R.; Wu, T.; Earle, E.D.; Tanksley, S.D. 1993. Map-base cloning of a protein ki­nase gene conferring disease resistance in tomato. Sci­ence. 262: 1432-1436.

Michelmore, R.W.; Paran, 1.; Kesseli, R.V. 1991. Identifica­tion of markers linked to disease resistance genes by bulked segregant analysis: A rapid method to detect mark­ers in specific genomic regions by using segregating popu­lations. Proc. Natl. Acad. Sci. USA. 88: 9828-9832.

Newcombe, G.; Bradshaw, H.D., Jr. 1996. Quantitative trait loci conferring resistance in hybrid poplar to Septaria populicola, the cause of leaf spot. Can. J. For. Res. 26: 1943-1950.

Stachel, S.E.; Messens, E.; Van Montagu, M.; Zambryski, P. 1985. Identification of signal molecules produced by wounded plant cells that activate T-DNA transfer in Agrobacterium tumefaciens. Nature. 318: 624-629.

Stachel, S.E.; Timmerman, B.; Zambryski, P. 1986. Genera­tion of single stranded T-DNA molecules during the ini­tial stages of T-DNA transfer from Agrobacterium tumefaciens to plant cells. Nature. 322: 706-712.

Staskawicz, B.J.; Dahlbeck, D.; Keen, N.T. 1984. Cloned a virulence gene of Pseudomonas syringae pv. glycinea de­termines race-specific incompatibility on Glycine max (L.) Merr. Proc. Natl. Acad. Sci. USA. 81:6024-6028.

Tisserat, N.A.; Hulbert, S.H.; Sauer, K.M. 1994. Selective amplification of rONA internal transcribed spacer re­gions to detect Ophiosphaerella korrae and 0. herpotricha. Phytopathology. 84:478-482.

Ward, K.T.; Ostry, M.E. 1996. Characterization of the ge­netic and pathogenic variation in Septaria musiva and Septoria populicola. In: Analyzing pathogen and pest populations in poplar and willow. Abstract booklet for the International Symposium organized by the Inter-

153

Section Ill Molecular Biology

national Energy Agency I Bioenergy agreement task XII activities: "pests" and "stock improvement and charac­terization". 1996 September 23-25; Long Ashton Re­search Station, University of Bristol, UK.: 38. Abstract.

White, T.J.; Bruns, T.; Lee, S.; Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A.; Gelfand, D.H.; Sninsk~ J.J.; White, T.J., eds. PCR protocols: A guide to methods and applications. New York: Academic Press, Inc.: 315-322.

154

Whitham, S.; Dinesh-Kumar, S.P.; Choi, D.; Hehl, R.; Corr, C.; Baker, B. 1994. The product of the tobacco mosaic virus resistance gene N: similarity to Toll and the Interleukin-1 receptor. Cell. 78: 1101-1115.

Yusibov, V.M.; Steck, T.R.; Gupta, V.; Gelvin, S.B. 1994. As­sociation of single-stranded transferred DNA from Agrobacterium tumefaciens with tobacco cells. Proc. Natl. A cad. Sci. USA. 91: 2994-2998.

Zupan, J.R.; Zambryski, P. 1995. Transfer ofT-DNA from Agro­bacterium to the plant cell. Plant Physiol. 107: 1041-1047.

USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997.