Molecular characterization of a light-responsive gene, breast basic conserved protein 1 (OsiBBC1),...

www.bba-direct.comBiochimica et Biophysica Acta 1676 (2004) 182–192

Molecular characterization of a light-responsive gene, breast basic

conserved protein 1 (OsiBBC1), encoding nuclear-localized protein

homologous to ribosomal protein L13 from Oryza sativa indica

Mukesh Jain, Shashi B. Tyagi, Jitendra K. Thakur, Akhilesh K. Tyagi, Jitendra P. Khurana*

Centre for Plant Molecular Biology and Department of Plant Molecular Biology, University of Delhi South Campus,

Benito Juarez Road, New Delhi 110021, India

Received 2 September 2003; received in revised form 14 November 2003; accepted 20 November 2003

Abstract

Rice (Oryza sativa L. subsp. indica) cDNA for the gene OsiBBC1, encoding homologue of the breast basic conserved protein 1 (BBC1),

similar to ribosomal protein L13, has been identified and characterized. OsiBBC1 codes for a 24 kDa highly basic protein with two potential

bipartite nuclear localization signals (NLS) and a transcriptional activation domain (TAD). The structural part of the gene is interrupted by

four introns. The OsiBBC1 gene is represented by two copies in the rice genome and both of them are expressed. Northern analysis showed

that OsiBBC1 is expressed more in the young root, post-fertilized inflorescence, leaf base and callus tissue, which are comprised of actively

dividing cells, indicating its role in cell division. The OsiBBC1 transcript accumulated more in the root of light-grown seedlings as compared

to the shoot while its levels were higher in the shoot as compared to root of the etiolated seedlings, indicating its down-regulation by light.

The western analysis, carried out using antibodies raised against a recombinant fusion protein, 6xHis–OsiBBC1, corroborated its tissue-

specific expression profile observed by northern analysis. In addition, OsiBBC1/RPL13 protein could be targetted to the nucleus by particle

bombardment of OsiBBC1::GUS fusion construct in the onion epidermal cells.

D 2003 Elsevier B.V. All rights reserved.

Keywords: Rice (Oryza sativa indica); BBC1 (breast basic conserved protein 1); Ribosomal protein L13; Cell division; Transcription activation; Nuclear

localization

1. Introduction

The breast basic conserved protein 1 (BBC1) gene was

initially isolated and characterized in human by differential

screening of breast carcinoma cDNA library due to its

significantly higher expression in benign breast fibroadeno-

mas as compared to malignant breast carcinomas [1].

Subsequently, BBC1 was found to be expressed in other

non-tumoral mammalian tissues and evolutionarily con-

served in other eukaryotes including yeast, animals and

plants [1–5]; it was suggested that BBC1 may have a role

in cell growth and development. The human BBC1 protein

was later found to have a strong homology (96.7%) with rat

ribosomal larger subunit protein L13 [6], indicating it to be a

component of ribosomes. The transcriptional activation

0167-4781/$ - see front matter D 2003 Elsevier B.V. All rights reserved.

doi:10.1016/j.bbaexp.2003.11.012

* Corresponding author. Tel.: +91-11-24675126; fax: +91-11-2688-

5270; 2410-9450.

E-mail address: [email protected] (J.P. Khurana).

sequence of BBC1 homologue from tobacco has substantial

identity with P14 protein, and can replace the activation

domain of yeast transcriptional factor GAL4 [7]. It was

proposed that BBC1 protein could interact with nucleic

acids directly or indirectly regulating transcriptional activi-

ties. In Arabidopsis, the transcript levels of BBC1 gene were

found to be developmentally regulated and positively cor-

related with active cell division [4]. Saez-Vasquez et al. [3]

showed that the expression of Brassica napus BBC1 homo-

logue, BnC24, is induced in response to cold treatment at

the transcriptional level. However, the changes in BnC24

protein level could not be correlated with the accumulation

of BnC24 transcripts at low temperature, indicating that

BnC24 protein is under strong translational or post-transla-

tional control [8].

In addition to dicot species like Brassica, Nicotiana and

Arabidopsis, the presence of BBC1 homologues has also

been predicted in tomato, and monocots like wheat and rice

[4] but detailed work is lacking. We have isolated a full-

length cDNA, OsiBBC1, encoding BBC1/RPL13 protein

M. Jain et al. / Biochimica et Biophysica Acta 1676 (2004) 182–192 183

from rice (Oryza sativa L. subsp. indica), the model

monocot plant. This study provides evidence that OsiBBC1

gene encodes a nuclear-localized protein, whose expression

is modulated by light and developmental cues, and tran-

script levels are most abundant in meristematic tissues.

2. Materials and methods

2.1. Plant material and growth conditions

Rice (O. sativa L. subsp. indica var. Pusa Basmati 1)

seeds were obtained from the Regional Station of the Indian

Agricultural Research Institute, Karnal. Seeds were washed

thoroughly with reverse osmosis (RO) water and disinfected

with 0.1% HgCl2 for 1 h, and were soaked overnight in RO

water. Seedlings were grown on cotton saturated with RO

water at 28 jC, either in dark or constant light provided by a

bank of fluorescent tube lights (Philips TL 40 W/54, 6500

K) with a fluence rate of 70 Amol m� 2 s� 1, as per

experimental requirement. For tissues of mature leaf, mature

stem, rachis, pre-pollinated inflorescence and post-fertilized

inflorescence, plants were grown in the field under natural

conditions or in a greenhouse.

All the stress treatments were given to 6-day-old light-

grown seedlings raised on cotton saturated with RO water at

28F 1 jC. The 6-day-old seedlings were transferred to

cotton saturated with RO water at 4 jC for cold treatment

and at 42 jC for heat shock treatment, on blotting sheets for

dehydration, on cotton saturated with 400 mM NaCl, or 50

AM ABA dissolved in dimethylsulfoxide.

2.2. Isolation of OsiBBC1 cDNA and sequencing

The rice root cDNA library made using cDNA synthesis

kit, ZAP Expressk and Gigapack III gold (Stratagene

Cloning Systems, USA) was employed in this study. Several

clones were randomly picked and the inserts used as probes

to analyze their expression profile and tissue-specific ex-

pression by Northern analysis (protocol described later).

One of these clones with high level of expression in root

tissue of rice seedlings was processed further for sequenc-

ing. This clone was sequenced using automated DNA

sequencer (ABI prism 377), with the Thermosequenase

Dye Terminator Cycle sequencing kit (Amersham, UK) as

per manufacturer’s instructions. After sequencing, DNA and

protein sequence analysis was performed using BLAST

search tools (National Centre for Biotechnology Informa-

tion) and the clone designated as OsiBBC1.

2.3. Southern analysis

The genomic DNAwas isolated from 8-day-old etiolated

rice seedlings according to the protocol given by Dellaporta

et al. [9]. Genomic DNA sample (10 Ag) was digested

separately with EcoRI, PstI, BamHI and SacI restriction

endonucleases. The digested samples were resolved on a

1.0% agarose gel and transferred to a Hybond-N nitrocel-

lulose membrane (Amersham). Hybridization was carried

out at 42 jC in 50% formamide, 5� SSC, 5� Denhardt’s

solution, 50 mM sodium phosphate (pH 6.5) and 250 Ag/ml

of denatured Herring sperm DNA, using a32P-dATP labeled

BglII/XhoI fragment of OsiBBC1 cDNA as probe for 16 h.

After hybridization, the membrane was washed for 10 and

15 min with 5� SSC, 0.1% SDS and 2� SSC, 0.1% SDS

at room temperature, respectively, followed by 0.1� SSC,

0.5% SDS at 60 jC (high stringency) for 15 min. The

membrane was wrapped in Klin wrap and autoradiography

done using X-ray film (Konica Tokyo, Japan) in a hyper-

cassette with intensifying screen (Amersham) at � 80 jC.The film was developed after 72 h of exposure.

2.4. Induction of callus

The rice caryopses were sterilized, grains dehusked and

split into two with a scalpel. The grain halves were surface-

sterilized with 0.1% HgCl2 for 30 min with regular shaking.

The sterilized grains were rinsed thoroughly with RO water

and soaked overnight. The grains were transferred to induc-

tion medium consisting of MS salts [10] with 2 mg/l of 2,4-

D, 3% sucrose and 0.8% agar. After 7 days, the callus was

dissected and transferred to a maturation medium with 1

mg/l of 2,4-D, 500 mg/l L-proline and 300 mg/l casamino

acids. Culture transfers were made on maturation medium

every 14 days and calli harvested after two transfers.

2.5. Northern analysis

Total RNA was isolated from different tissues as de-

scribed by Logeman et al. [11] and resolved on 1.2%

agarose gel containing 1.1% formaldehyde at 120 V, trans-

ferred to Hybond-N membrane and fixed using a UV-

crosslinker after air-drying. Hybridizations were carried

out in 50% formamide, 5� SSC, 5� Denhardt’s solution,

0.1 M sodium phosphate buffer (pH 6.5), 10% dextran

sulfate and 250 Ag/ml of denatured Herring sperm DNA

at 42 jC, using a32P-dATP labeled BglII/XhoI fragment of

OsiBBC1 as probe. The membranes were then washed for

10, 15 and 20 min with 5� SSC, 0.1% SDS, 2� SSC,

0.1% SDS and 1� SSC, 0.1% SDS, respectively, at room

temperature. Autoradiography and X-ray film developing

were performed as described above.

Ethidium bromide-stained rRNA or rehybridization of

the filters (stripped with boiled 0.1% SDS) with Lemna

gibba rRNA gene used as probe served as a control to

estimate the relative amounts of rRNA in each lane.

2.6. Expression of 6xHis–OsiBBC1 protein in E. coli and

production of antiserum

The coding region of OsiBBC1 was amplified by poly-

merase chain reaction to introduce a BamHI and HindIII

M. Jain et al. / Biochimica et Biophys184

restriction sites at 5Vand 3Vend, respectively, by using the

oligonucleotides: 5VGCGGATCCATGGTGAAGCACAA-

CAACG 3Vand 5VGCAAGCTT GTCCGGTCACTT-

CACTTCTTC 3V(restriction sites are underlined). The

amplified product digested with BamHI and HindIII was

cloned in BamHI/HindIII digested plasmid pQE-30 (Qiagen,

Germany) to form a 6xHis–OsiBBC1 fusion construct. The

recombinant plasmid was transformed in E. coli M15 cells.

The transformed E. coli cells were grown in Luria–Bertani

medium to an A600 of 0.6 at 37 jC. The expression of fusionprotein was induced with 1.0 mM isopropyl-h-D-thiogalac-toside (IPTG) and allowed to continue for 4 h at 37 jC. Thefusion protein was checked for solubility (soluble or insol-

uble) and purified using Ni-NTA affinity column (Qiagen)

under denaturing conditions according to the manufacturer’s

instructions.

Polyclonal antibodies were raised against 6xHis –

OsiBBC1 fusion protein in mice by injecting 20 Ag of

purified protein mixed with Complete Freund’s Adjuvant

(CFA) followed by three additional 20 Ag booster doses at

days 15, 25 and 35.

2.7. Extraction of total soluble proteins

Total soluble proteins from different plant tissues were

extracted in 0.2 M Tris–HCl (pH 8.0) buffer containing 0.1

M NaCl, 0.4 M sucrose, 10 mM EDTA, 14 mM h-mercaptoethanol and 1 mM phenylmethylsulfonylfluoride.

The extract was centrifuged at 13,000 rpm for 30 min at 4

jC followed by an additional centrifugation of the superna-

tant at 13,000 rpm for 10 min at 4 jC. The protein

concentration of the supernatant was estimated using an

aliquot of 5 Al of clarified extract following the protocol of

Bradford [12].

2.8. Immunoblot analysis

Equal amounts of total soluble proteins (100 Ag)extracted from different tissues were fractionated on a

12.5% polyacrylamide gel and electrotransferred to

Hybond-C Super nitrocellulose membrane (Amersham).

The membrane was incubated in blocking solution (5%

non-fat milk powder in TBS-T buffer (10 mM Tris, pH

7.6, and 0.5 M NaCl) with 0.1% Tween-20 (v/v)) for 1

h at room temperature (RT) on an orbital shaker (40 rpm)

followed by two washes with TBS-T buffer for 5 min

each. Subsequently, the blot was probed with a 1:500

dilution of polyclonal antibodies raised against fusion

protein 6xHis–OsiBBC1 in TBS-T for 2 h at RT and

40 rpm. The immunoblot was washed with TBS-T as

above and incubated with anti-mouse IgG conjugated to

horseradish peroxidase as secondary antibody (1:25,000

dilution) for 1 h at room temperature followed by

washing. The blot was developed using ECL Plus Chemi-

luminescence kit (Amersham) as per manufacturer’s

instructions.

2.9. Particle bombardment of OsiBBC1–GUS fusion

construct in onion epidermal cells

The complete ORF of OsiBBC1 was cloned in NcoI/BglII

sites of the plasmid pCAMBIA 3301 upstream to GUS gene.

The two restriction sites NcoI at 5Vend and BamHI at 3Vend of coding region of OsiBBC1 were added by poly-

merase chain reaction using the oligonucleotides 5VCATGCCATGG TGAAGCACAACAACGT 3V and 5VTGCGGATCC CTTCTTCTCTTCCTTCTCTG 3V (restric-tion sites are underlined).

The epidermal layers of onion were spread on Petri

dishes containing MS-agar medium (MS salts and vitamins

with 3% sucrose and 2% agar, pH 5.8) [10], keeping inside

up. The cells were transformed by biolistic approach as

described by Varagona et al. [13] with minor modifications.

In place of tungsten, gold particles were used as micro-

carriers and 1100 psi rupture discs employed. Preparation of

microcarriers, coating with plasmid DNA (OsiBBC1::GUS

fusion construct purified by Qiagen spin column) and

bombardment were done as per manufacturer’s instruction

(PDS-1000/He-particle delivery system; Biorad, USA). Af-

ter bombardment, the onion epidermal layers in Petri dishes

were incubated at 28 jC for 16 h in dark and then

transferred to GUS histochemical assay buffer (50 mM

sodium phosphate, pH 7.0, 50 mM potassium ferrocyanide,

50 mM potassium ferricyanide, 10 mM Na2EDTA, 0.01%

Triton X-100 and 1 mg/ml X-Gluc). After overnight incu-

bation, the epidermal layers were mounted on glass slides

with 20 Ag/ml Hoechst 33258 (nucleus-specific stain) and

observed for subcellular localization of GUS activity by

bright-field microscopy and UV-light for nucleus-specific

staining.

ica Acta 1676 (2004) 182–192

3. Results

3.1. OsiBBC1 cDNA codes for ribosomal protein L13

While randomly analyzing clones from the rice root

cDNA library for their tissue-specific expression and tran-

script abundance, on sequencing, one of the clones revealed

homology to known BBC1 cDNAs. This rice BBC1 cDNA

(accession no. AJ272394), designated as OsiBBC1 (O.

sativa indica breast basic conserved protein 1), is 889 bp

long (excluding poly A tail) with an open reading frame

(ORF) of 624 bp (Fig. 1A). The 61-bp-long 5V-untranslatedregion (UTR) is rich in pyrimidine residues near the

transcriptional start site (from 1 to 37), as observed in other

ribosomal proteins of eukaryotes, which is supposed to be

important for translational regulation [14]. The 3V-UTR of

201 bp contains a polyadenylation signal at 32 bp upstream

of poly (A) site (Fig. 1A). The genomic sequence down-

loaded from rice genome database was also analyzed. The

gene is 2074 bp long and a comparison with the cDNA

sequence in the present study revealed the existence of five

Fig. 1. (A) Nucleotide sequence of OsiBBC1 cDNA (accession no. AJ272394) and coding region of OsRPL13A and OsRPL13B. The deduced amino acid

sequence of OsiBBC1 protein is shown below the nucleotide sequence. Nucleotide and amino acid positions are given in numerals. SNPs within the coding

region of OsRPL13B (marked with asterisks) and OsRPL13A are highlighted in gray boxes. Pyrimidine-rich nucleotide sequence in 5V-UTR is underlined by

dotted line. The two potential bipartite nuclear-localization signals in amino acid sequence are underlined. Amino acid sequence constituting the TAD is

highlighted in the gray box. The polyadenylation site in nucleotide sequence and N-glycosylation site in amino acid sequence are shown in bold letters. (B)

Pictorial presentation of alignment of OsiBBC1 cDNAwith the gene showing position of exons and introns. Exons and introns are represented by shaded and

blank boxes, respectively. Translation start site (ATG) is shown by an arrow.


M. Jain et al. / Biochimica et Biophysica Acta 1676 (2004) 182–192186

exons and four introns (Fig. 1B). The cDNA encodes a

highly basic (26.9% Arg, Lys and His) protein of 208 amino

acids with a predicted molecular mass of ca. 24 kDa. The

analysis of primary structure of OsiBBC1 protein reveals a

Fig. 2. (A) Southern blot analysis of OsiBBC1 gene. Rice genomic DNA (10 Ag) wthe top of the autoradiograph. Southern hybridization and washings were carried

location of OsiBBC1/OsRPL13B and OsRPL13A genes on chromosomes 3 and 6

potential site for N-glycosylation located at amino acid

residue 103 and protein kinase C phosphorylation sites at

residues 62 and 118. The OsiBBC1/RPL13 sequence con-

tains two potential bipartite nuclear localization signals

as digested separately with different restriction endonucleases mentioned on

out under highly stringent conditions. (B) Diagrammatic representation of

, respectively, along with their nearest marker and its cM position.


(NLS) and a transcriptional activation domain (TAD) (86

PKKYAPTIGISVDHRRKNRSLEGLQ 110) (see Fig. 1A),

highly conserved in other known BBC1 proteins.

3.2. Southern analysis and chromosomal localization of

OsiBBC1

To determine whether the gene corresponding to

OsiBBC1 cDNA belongs to a multigene family or is

represented as a single copy, rice genomic DNA was

digested with different restriction enzymes and processed

Fig. 3. (A) Alignment of deduced amino acid sequence of OsiBBC1/OsRPL13B p

RPL13 proteins. Fully and partially conserved amino acid residues are highlighted

amino acids. Gaps are denoted by hyphens. TAD represents transcriptional ac

homologues with P14 peptide sequence. Identical amino acid residues are shown

for Southern analysis at high stringency (50% formamide,

42 jC) using complete OsiBBC1 cDNA as radiolabeled

probe. In case of SacI-, EcoRI- or BamHI-digested DNA,

two fragments hybridized prominently, whereas digestion

with PstI gave hybridization of four fragments (Fig. 2A)

because of the presence of PstI site in the gene (Fig. 1B)

indicating that OsiBBC1 gene is represented by at least

two copies in the rice genome. The BLAST search done

using TIGR database of rice genome (http://www.tigrblast.

tigr.org/euk-blast) also showed the presence of two non-

redundant ribosomal protein L13 genes designated as

rotein with amino acid sequence of OsRPL13A and other eukaryotic BBC1/

with black and gray boxes, respectively. Numerals indicate the position of

tivation domain. (B) Alignment of TAD of OsiBBC1 and other BBC1

in black boxes.

http:\\www.tigrblast.tigr.org\euk-blast

Table 1

Percentage identity of OsiBBC1 protein with other BBC1/RPL13 homologs

Protein Organism Accession no. Full-length/

partial

Percentage

identity

OsRPL13A Oryza sativa BAC22205 full 97.6

TaBBC1 Triticum

aestivum

AAL93210 full 90.1

AtRPL13B/

AtBBC1

Arabidopsis

thaliana

NP_190470/

P41127

full 83.5

AtRPL13D Arabidopsis

thaliana

NP_197778 full 81.1

AtRPL13C Arabidopsis

thaliana

NP_190465 full 75.2

AtRPL13A Arabidopsis

thaliana

CAB51060 partial 55.2

BnC24B Brassica napus P41127 full 83.0

BnC24A Brassica napus P41128 full 82.5

NtBBC1 Nicotiana

tabaccum

P49627 full 70.8

DmRPL13 Drosophila

melanogaster

P41126 full 55.8

RatRL13 Rat P41123 full 55.3

HsBBC1 Homo sapiens P26373 full 54.3

SmRPL13 Schistosoma

mansoni

U57003 full 53.3

SpRPL13 Saccharomyces

pombe

T43385 full 47.6


OsRPL13A and OsRPL13B, based on nomenclature given

by Barakat et al. [15] for ribosomal protein genes in the

Arabidopsis genome. OsRPL13B represents a japonica

rice ortholog of OsiBBC1 gene (from indica rice) having

two single nucleotide polymorphisms (SNPs) within the

ORF as shown in Fig. 1A (marked with asterisks), without

any change in amino acid composition, while OsRPL13A

is supposed to be a paralog of OsRPL13B/OsiBBC1,

which differs in 67 nucleotides spread throughout the

coding region (Fig. 1A) and only five amino acid residues

at the protein level (Fig. 3A). OsiBBC1/OsRPL13B was

found to be localized on chromosome 3 (BAC clone

OSJNBa0008D12) and OsRPL13A on chromosome 6

Fig. 4. Phylogenetic tree constructed based on alignment of amino acid seque

Evolutionary group is assigned according to Wool et al. [16].

(BAC clone OSJNBa0019F11) downstream of nearest

known markers S2470 (86.5 cM) and S2330 (3.6 cM),

respectively, as shown in Fig. 2B.

3.3. OsiBBC1 gene belongs to evolutionary group III

The predicted amino acid sequence of OsiBBC1 shows

significant homology with other BBC1/RPL13 proteins

documented in the database (Table 1). The multiple se-

quence alignment of BBC1 homologues (representatives

only) was done using Gene runner version 3.04 and DNAS-

TAR Megalign 4.03 (Fig. 3A). The TAD of OsiBBC1 and

other BBC1 homologues shows very high percentage of

identity (22 amino acid residues are identical out of 25

residues in case of OsiBBC1) with P14 peptide (alignment

shown in Fig. 3B), a plant activating sequence [7]. The

phylogenetic analysis of BBC1 homologues done by using

DNASTAR Megalign 4.03 (Fig. 4) showed that BBC1

protein is highly conserved evolutionarily. It belongs to

evolutionary group III, found to be present only in eukar-

yotes [16].

3.4. OsiBBC1 is developmentally regulated and expressed

more in meristematic tissues

To study the tissue-specific expression of OsiBBC1 at the

transcriptional level, northern analysis was performed with

total RNA extracted from different light-grown tissues.

Although a basal level of transcripts could be detected in

all the tissues, the transcript abundance of OsiBBC1 was

significantly high in young root, post-fertilized inflores-

cence, leaf base and callus (Fig. 5). This suggests that

OsiBBC1 is expressed more in tissues comprising actively

dividing cells.

To examine the developmental regulation of OsiBBC1

expression, northern analysis was performed with root and

shoot tissues harvested from rice seedlings grown under

light and dark conditions for different durations. The tran-

nces of OsiBBC1/RPL13B and other eukaryotic BBC1/RPL13 proteins.

Fig. 5. Northern blot analysis of OsiBBC1 mRNA levels in different tissues (mentioned at the top of each lane). Total RNA (20 Ag) extracted from each tissue

was fractionated on a 1.2% agarose-formaldehyde gel and transferred to a nitrocellulose membrane. The membrane was successively hybridized with

radiolabeled probe of BglII/XhoI fragment of OsiBBC1 cDNA. Ethidium bromide-stained rRNA represents the control.

Fig. 6. Northern blot analysis of OsiBBC1 transcript levels in young root

and shoot tissues of different age grown under light (A) and dark (B)

conditions as mentioned. Total RNA (20 Ag) extracted from each tissue was

fractionated on a 1.2% agarose-formaldehyde gel and transferred to a

nitrocellulose membrane. The membrane was successively hybridized with

radiolabeled probe of BglII/XhoI fragment of OsiBBC1 cDNA. Ethidium

bromide-stained rRNA represents the control. (C) Northern analysis for

transcript level accumulation after ABA treatment to rice seedlings.


script level of OsiBBC1 was high in the shoot as compared

to roots of etiolated seedlings (Fig. 6A) while it was higher

in the roots as compared to shoots in light-grown seedlings

(Fig. 6B). Also, the transcript level of OsiBBC1 decreases

with the age of seedlings, indicating its developmental

regulation.

3.5. OsiBBC1 expression is not affected by different stresses

Expression of BBC1 in B. napus has been shown to be

induced by low temperature. To check whether OsiBBC1

responds in a similar fashion, northern analysis was

performed with total RNA isolated from seedlings after

cold treatment. However, there was no effect of low

temperature on transcript abundance of OsiBBC1 (data

not shown). Even other stresses like dehydration and salt

concentration did not affect the OsiBBC1 transcript accu-

mulation (data not shown), although there was slight but

distinct increase in OsiBBC1 transcript level after ABA

treatment (Fig. 6C).

3.6. Tissue-specific expression of OsiBBC1 protein

Recombinant 6xHis–OsiBBC1 protein was expressed in

E. coli induced with 1 mM IPTG and purified using Ni-NTA

affinity column under denaturing conditions as the protein

was found to be in the insoluble fraction (Fig. 7A). The

purified fusion protein was used to raise polyclonal anti-

bodies in mice, and immunoblot analysis performed to

analyze the expression of OsiBBC1 protein in young root,

young shoot, pre-pollinated and post-fertilized inflorescence

tissues. The protein level corresponds to the transcript level,

being maximum in the young root and post-fertilized

inflorescence tissue (Fig. 7B).

3.7. OsiBBC1 protein is nuclear localized

The hydropathic profile of OsiBBC1 indicates that the

protein could be localized in hydrophilic environment


within the cell (Fig. 8A). Also, the deduced amino acid

sequence of OsiBBC1 protein shows the presence of two

potential bipartite NLS shown in Fig. 1A. To determine

whether these NLS are sufficient to target the OsiBBC1

protein to the nucleus, in-frame OsiBBC1::GUS fusion

construct was prepared in expression vector pCAMBIA3301.

The recombinant vector and pCAMBIA 3301 (cytosolic

control) were bombarded into the inner epidermal cells of

white onion as per protocol described earlier. Subcellular

localization of fusion protein OsiBBC1::GUS and GUS pro-

tein was established using GUS histochemical assay buffer.

The fusion proteinwas found to be concentrated in the nucleus

(Fig. 8B(a)), whereas the GUS protein alone was distributed

all over the cell (Fig. 8B(c)). The staining with nucleus-

Fig. 8. (A) Hydropathy profile of OsiBBC1 protein made according to the

Kyte and Doolittle method. Numbers indicate position of amino acids. (B)

Intracellular localization of OsiBBC1 protein in onion epidermal cells.

OsiBBC1::GUS fusion construct was bombarded on onion epidermal cells

and histochemical assay was done to detect the recombinant protein. Panel

a shows OsiBBC1::GUS fusion protein, whereas control panel c shows

only the GUS protein. Panel b shows Hoechst 33258 staining of nuclei.

Fig. 7. (A) Coomassie Brilliant Blue-stained SDS-polyacrylamide gel

(12.5%) for recombinant 6xHis –OsiBBC1 protein expression and

purification. Lane 1, molecular weight standards; lanes 2 and 3, E. coli

crude extracts before and after 4 h isopropyl-h-D-thiogalactoside induction,respectively; lanes 4 and 5, soluble and insoluble fractions from induced

cell extract; lane 6, purified protein from Ni-NTA affinity column; lane 7,

purified 6xHis–OsiBBC1 fusion protein bound to anti-6xHis–OsiBBC1

antisera. (B) Immuno-blot analysis for expression of OsiBBC1 protein in

different tissues (indicated on the top of each lane). Total soluble proteins

(100 Ag) from each tissue was fractionated on 12.5% acrylamide gel,

transferred on nitrocellulose membrane which was probed with antibodies

raised against fusion protein 6xHis–OsiBBC1 and developed by ECL Plus

Chemiluminescence kit.

specific dye Hoechst 33258 confirmed the nuclear locali-

zation of OsiBBC1 (Fig. 8B(b)).

4. Discussion

In this study, a cDNA clone, designated as OsiBBC1,

was isolated from rice (O. sativa indica) cDNA library. The

deduced amino acid sequence of OsiBBC1 shows signifi-

cant homology (54.3%) with human BBC1, which is

expressed more in benign breast tumors [1]. The homology

of OsiBBC1 protein with rat ribosomal larger subunit

protein L13 [6] suggests it to be a constituent of ribosome,

the protein machinery of the cell. The OsiBBC1 cDNA

contains a pyrimidine-rich sequence near the transcriptional

start site, which is supposed to be important for translational

regulation of ribosomal proteins in eukaryotes [15]. The

structural part of OsiBBC1 gene has four introns as revealed

by comparison of cDNA and genomic sequence by

BLASTN search results. The number and position of introns

was found to be same in rice and Arabidopsis thaliana,

showing it to be conserved evolutionarily. Southern analysis

under high stringency conditions (50% formamide, 42 jC),showed that two or four fragments of rice genomic DNA


digested with different restriction endonucleases (sites not

present in the cDNA) hybridized with OsiBBC1 cDNA

probe (Fig. 4), which suggests that OsiBBC1 gene is

represented by at least two copies (OsRPL13A and

OsRPL13B) within the rice genome. This has also been

confirmed by BLAST search results in TIGR rice genome

database.

The OsiBBC1 cDNA codes for a highly basic protein (pI

10.95) harboring two potential bipartite nuclear localization

signals and a transcriptional activation domain having

significant identity (88%) with P14 peptide, a plant-activat-

ing sequence, which can replace the activation domain of

the yeast transcriptional factor GAL4 [7], suggesting it to be

a regulatory nuclear protein.

The results of northern blot analysis showed the most

accumulation of OsiBBC1 mRNA in young root, post-

fertilized inflorescence, leaf base and callus tissue (Fig. 5),

which consists of actively dividing cells, suggesting it to be

involved in cell division. This observation is in accordance

with the results from earlier studies [1,2,4]. To find out

whether the expression pattern shown in Figs. 5 and 6

reflect the abundance of OsiBBC1/OsRPL13B transcript

only or includes the accumulation of both the transcripts

(OsRPL13A and OsRPL13B), RT-PCR analysis was carried

out using gene-specific primers. However, no significant

difference was detected in the transcript abundance

corresponding to these genes in at least some samples

(young root, young shoot, pre-pollinated inflorescence and

post-fertilized inflorescence) examined (data not presented)

implying that the expression data shown may relate to both

the genes. The expression of OsiBBC1 was found to be

down-regulated by light. Also, the transcript levels were

developmentally regulated, being maximum till 4–5 days

and decrease thereafter in both the root and shoot tissue of

light- and dark-grown seedlings. Earlier study in B. napus

[3] showed that expression of BnC24, a homologue of

BBC1, is induced by cold treatment at mRNA level,

however, in this study, we did not find any effect of cold

treatment on the expression of OsiBBC1 mRNA. There is a

possibility that the gene for this ribosomal component in

rice is regulated differently than Brassica. Also, the rice

seedlings, when subjected to dehydration, salt treatment or

heat shock showed no significant effect on accumulation of

OsiBBC1 mRNA, except for a slight increase in mRNA

level on treatment with the plant stress hormone abscisic

acid.

The western analysis showed that the level of

OsiBBC1 protein in different tissues correlates very well

with the transcript abundance, indicating that the expres-

sion of OsiBBC1 is mainly transcriptional and not regu-

lated translationally or post-translationally. Localization of

OsiBBC1 protein inside the nucleus is in agreement with

the fact that ribosomal proteins are required to be

imported into the nucleus to form a multi-subunit com-

plex. In B. napus, BnC24 protein was also shown to be

nuclear-localized [8].

The nuclear localization of OsiBBC1/RPL13 protein,

along with presence of highly basic residues and a

transcriptional activation sequence, indicates that this

transcriptional regulatory factor has a valuable biological

significance. What is its precise role will be unravelled

by either creating gene knock-outs or blocking the

function of this gene in transgenics by RNAi or antisense

technology.

Acknowledgements

MJ and JKT acknowledge the award of Research

Fellowship from the Council for Scientific and Industrial

Research, and the University Grants Commission, New

Delhi, respectively. This research work was supported

financially by the Department of Biotechnology, Govern-

ment of India, New Delhi.

References

[1] S.M. Adams, N.R. Helps, M.G.F. Sharp, W.J. Brammar, R.A. Walker,

J.M. Varley, Isolation and characterization of a novel gene with differ-

ential expression in benign and malignant human breast tumours,

Hum. Mol. Genet. 1 (1992) 91–96.

[2] N.R. Helps, S.M. Adams, W.J. Brammar, J.M. Varley, The Droso-

phila melanogaster homologue of the human BBC1 gene is highly

expressed during embryogenesis, Gene 162 (1995) 245–248.

[3] J. Saez-Vasquez, M. Raynal, L. Meza-Basso, M. Delseny, Two re-

lated, low-temperature-induced genes from Brassica napus are ho-

mologous to the human tumour bbc1 (breast basic conserved) gene,

Plant Mol. Biol. 23 (1993) 1211–1221.

[4] N. Bertauche, J. Leung, J. Giraudat, Conservation of the human

breast basic conserved 1 gene in the plant kingdom: characteriza-

tion of a cDNA clone from Arabidopsis thaliana, Gene 141 (1994)

211–214.

[5] G.R. Franco, M. Tanaka, A.J.G. Simpson, S.D.J. Pena, Characteriza-

tion of a Schistosoma mansoni homologue of the gene encoding the

breast basic conserved protein 1/L13 ribosomal protein, Comp. Bio-

chem. Physiol., Part B Biochem. Mol. Biol. 120 (1998) 701–708.

[6] J. Olvera, I.G. Wool, The primary structure of rat ribosomal protein

L13, Biochem. Biophys. Res. Commun. 201 (1994) 102–107.

[7] J.J. Estruch, L. Crossland, S.A. Goff, Plant activating sequences:

positively charged peptides are functional as transcriptional activation

domains, Nucleic Acids Res. 22 (1994) 3983–3989.

[8] J. Saez-Vasquez, P. Gallois, M. Delseny, Accumulation and nuclear

targeting of BnC24, a Brassica napus ribosomal protein correspond-

ing to a mRNA accumulating in response to cold treatment, Plant Sci.

156 (2000) 35–46.

[9] S.L. Dellaporta, J. Wood, J.B. Hicks, A plant DNA minipreparation:

version II, Plant. Mol. Biol. Report. 1 (1983) 19–21.

[10] T. Murashige, F. Skoog, A revised medium for rapid growth and

bioassay with tobacco tissue cultures, Physiol. Plant. 15 (1962)

473–497.

[11] J. Logeman, J. Schell, L. Willmitzer, Improved methods for the iso-

lation of RNA from plant tissue, Anal. Biochem. 163 (1987) 16–20.

[12] M.M. Bradford, A rapid and sensitive method for the quantitation of

microgram quantities of protein utilizing the principle of protein-dye

binding, Anal. Biochem. 72 (1976) 248–254.

[13] M.J. Varagona, R.J. Schmidt, N.V. Raikhel, Nuclear localization sig-

nal(s) required for nuclear targeting of the maize regulatory protein

Opaque-2, Plant Cell 4 (1992) 1213–1227.


[14] S. Levy, D. Avni, N. Hariharan, R.P. Perry, O. Meyuhas, Oligopyri-

midine tract at the 5Vend of mammalian ribosomal protein mRNAs is

required for their translational control, Proc. Natl. Acad. Sci. U. S. A.

88 (1991) 3319–3323.

[15] A. Barakat, K. Szick-Miranda, I.-F. Chang, R. Guyot, G. Blanc,

R. Cooke, M. Delseny, J. Bailey-Serres, The organization of cy-

toplasmic ribosomal protein genes in Arabidopsis genome, Plant

Physiol. 127 (2001) 398–415.

[16] I.G. Wool, Y.L. Chan, A. Gluck, Structure and evolution of mamma-

lian ribosomal proteins, Biochem. Cell. Biol. 73 (1995) 933–947.

Molecular characterization of a light-responsive gene, breast basic conserved protein 1 (OsiBBC1),...

Documents

Transcript of Molecular characterization of a light-responsive gene, breast basic conserved protein 1 (OsiBBC1),...