JOURNAL OF CRUSTACEAN BIOLOGY, 36(5), 684-694, 2016

MOLECULAR CHARACTERIZATION AND SUB-CELLULAR DISTRIBUTION OF JNKAND JIP4 PROTEIN KINASES IN SPERMATOGENESIS AND ACROSOME REACTIONOF THE CHINESE MITTEN CRAB ERIOCHEIR SINENSIS H. MILNE EDWARDS, 1853

(CRUSTACEA: BRACHYURA: VARUNIDAE)

Hongdan Yang 1,∗, Qing Li 1,∗, Aiqing Yu 2, Lin He 1,∗∗, and Qun Wang 1,∗∗

1 Laboratory of Immunological Defense & Reproduction, School of Life Science,East China Normal University, Shanghai 201100, P.R. China

2 Shanghai Fisheries Technical Extension Station, Shanghai Fisheries Research Institute,Shanghai 200433, P.R. China

A B S T R A C T

The c-Jun N-terminal protein kinase mitogen-activated protein kinases (JNK MAPKs) are an evolutionarily conserved family ofserine/threonine protein kinases involved in controlling cell growth, differentiation, and apoptosis in mammalian testis and germ cells.As a scaffold protein of the JNK pathway, JNK-interacting protein 4 (JIP4) is found in some mammalian spermatozoa and participates incertain male reproductive processes. Few have reported on the roles of JNK and JIP4 in the Chinese mitten crab Eriocheir sinensis H. MilneEdwards, 1853. Based on transcriptome sequences from the testis of E. sinensis, we successfully cloned full-length cDNAs of JNK andJIP4 (designated Es-JNK and Es-JIP4, respectively). Western blotting showed relatively high expression of Es-JNK and Es-JIP4 proteinsin the testis. Expression levels of total Es-JNK, phosphorylated Es-JNK (Es-p-JNK), and Es-JIP4 proteins decreased gradually duringspermatogenesis. Es-JNK and Es-JIP4 mRNAs were mainly localized in the nucleus from the spermatogonium stage to the secondaryspermatocyte stage and were widely distributed in the nuclear cup, apical cap, acrosomal tubule, and acrosomal vesicle of spermatids. Es-JNK, Es-p-JNK, and Es-JIP4 proteins were nevertheless mainly dispersed in the cytoplasm and intercellular substance of spermatogoniumand primary spermatocytes, in the nucleus of secondary spermatocytes, and in the apical cap, acrosomal tubule, acrosomal vesicle, andnuclear cup of spermatids. During the acrosome reaction induced by the calcium ionophore A23187, Es-JNK, Es-p-JNK, and Es-JIP4proteins were found mainly expressed in the apical cap and acrosomal vesicle by immunofluorescence microscopy. The results implicatefunctions for Es-JNK and Es-JIP4 in spermatogenesis and the acrosome reaction in E. sinensis.

KEY WORDS: immunofluorescence, in situ hybridization, MAPK, scaffold protein

DOI: 10.1163/1937240X-00002468

INTRODUCTION

Spermatogenesis is a process in which spermatogonia un-dergo proliferation and division before the mature spermato-zoon is finally formed. Spermatozoa are not capable of fer-tilization immediately after spermatogenesis, however, andthey must undergo numerous membrane modifications be-fore interaction with the oocyte, processes that are referredto as capacitation (Austin, 1951; Suarez and Pacey, 2006).In mammalian species, after capacitation, spermatozoa un-dergo the acrosome reaction (AR), which results in the re-lease and activation of acrosomal enzymes. Only the ARsperm can bind and penetrate the zona pellucida (ZP) to fusewith the oocyte (De et al., 1997; Wassarman, 1999; Wassar-man et al., 2001). The MAPK signaling pathway, includingextracellular signal regulated kinase (ERK) pathway, c-Jun-N-terminal kinase (JNK) pathway, p38 subfamily pathway,and ERK5/BMK1 pathway, is involved in cell growth, dif-ferentiation, reproduction, apoptosis, anti-stress, and otherphysiological processes (Go et al., 2011). Zhu et al. (2014)

* These authors contributed equally to this work.** Corresponding authors; e-mail: lhe@bio.ecnu.edu.cn and qwang@bio.ecnu.edu.cn

and Sun et al. (2015) reported the discovery that ERK andp38 are involved in the AR of Eriocheir sinensis (H. MilneEdwards). We further explored in this study the reproductivefunction of JNK pathway in E. sinensis.

JNK had been implicated in the induction of the apoptosisof immature germ cells when they become detached fromSertoli cells in mammals (Show et al., 2008). Deltamethrin-induced germ cell apoptosis and reduction of sperm produc-tion have been shown to be mediated by the eNOS-JNK1-AR signaling pathway (Yu et al., 2014). Others have alsoidentified involvement of JNK in the regulation of the vi-ability of stallion spermatozoa (García, 2012). The regula-tion and translation of the JNK signaling pathway, however,often requires scaffold proteins to assemble the activatingkinases. Scaffold proteins play two related functional roles,including maintaining of specificity and served as catalyststo activate different components in the signaling pathway(Engstrom et al., 2010). Four groups of potential scaffoldproteins that may coordinate JNK signaling modules havebeen reported: CrkII, filamin, β-arrestin, and JIP (JNK-

© The Crustacean Society, 2016. Published by Brill NV, Leiden DOI:10.1163/1937240X-00002468

YANG ET AL.: REPRODUCTION OF JNK/JIP4 IN E. SINENSIS 685

interacting protein) (Weston and Davis, 2007). The JIP fam-ily has four members in mammals: JIP1, JIP2, JIP3, andJIP4. The JIP4 gene encodes three different proteins as a re-sult of alternative splicing: JIP4 (Kelkar et al., 2005), JLP(JNK-associated leucine zipper protein) (Lee et al., 2002),and SPAG9 (sperm-associated antigen 9) (Jagadish et al.,2005), which share common 3′ exons, but differ in the 5′ re-gion. The function of JIP4 has nevertheless been shown to bedifferent from that of other JIP proteins. Although JIP4 bindsJNK, it does not activate JNK signaling. Specifically, JIP4also can bind p38, MAPKKs (MKK3 and MKK6) and acti-vate the p38 signaling pathway in mice (Kelkar et al., 2005).JLP was observed during mouse testis development to playan important role in spermatogenesis (Iwanaga et al., 2008).SPAG9 was suggested to have a role in the spermatozoa-egginteraction in human spermatozoa (Jagadish et al., 2005),thus suggesting that JNK and JIP4 could be involved in sometype reproductive process, such as spermatogenesis, AR, orfertilization, in E. sinensis.

The Chinese mitten crab is one of the most importantaquaculture species in China (Wang et al., 2006). Due to sea-sonal changes in the reproductive system, testis developmentof E. sinensis are divided into five stages: spermatogoniumstage (May-June), spermatocyte stage (July-August), sper-matid stage (August-October), sperm stage (October-Aprilof the following year), and dormant stage (April-May) (Duet al., 1988). The spermatozoa of most crustaceans lack flag-ella and are composed of a spherical acrosome, nuclear cup(NC), and many radial arms (RA) that help sperm to adhereto the oocyte and promote the apical cap (AC) binding tothe oocyte membrane (Brown, 1966; Langreth, 1969; Du etal., 1987a). Although some primary studies have been con-ducted on spermatogenesis and the AR in E. sinensis (Du et

al., 1987b, 1988; Wang et al., 2015), the detailed molecularmechanisms underlying these two processes remain unclear.It has demonstrated that JNK pathway plays a critical role insome male reproductive processes, such as sperm productionand germ cell apoptosis. The spermatogenesis and AR arerelated to the reproduction and larval quality of E. sinensis.We examine, as a continuation of previous work, the rolesof Es-JNK and Es-JIP4 by exploring their distribution in theprocesses of spermatogenesis and AR.

MATERIALS AND METHODS

Animal and Tissue Preparation

Live, healthy, and sexually mature male crabs were obtained from Xin’anaquaculture market, Shanghai, China once a month from July to December2014. Six tissues (testis, vas deferens, gills, intestine, heart, and muscle)were dissected and quickly frozen in liquid nitrogen prior to storage at−80°C for cloning of Es-JNK and Es-JIP4 cDNA as well as extraction oftotal protein. Animal experiments were conducted following guidelines ofthe Ethics Committee of Laboratory Animal Experimentation at East ChinaNormal University.

Cloning of Full-Length Es-JNK and Es-JIP4 cDNA

We obtained JNK and JIP4 fragments from a testis transcriptome libraryin E. sinensis (He et al., 2013) and designed specific primers to validatesequences. Rapid amplification of cDNA ends (RACE) was then performedto obtain the full-length cDNAs of Es-JNK and Es-JIP4 (SMART™RACE cDNA Amplification kit, Clontech, San Francisco, CA, USA).Appropriately-sized PCR products were detected and separated on a 1.5%agarose gel. Amplicons of expected sizes were purified using the Wizard®

SV Gel and PCR Clean-up System (Promega, Madison, WI, USA) andinserted into the pMD-19T vector (Takara, Shiga, Japan). Positive clonescontaining inserts of the expected size were sequenced using T7 primer andSP6 primer (Table 1).

Bioinformatic Analysis

The Es-JNK and Es-JIP4 full-length cDNAs and deduced amino-acid se-quences were compiled and aligned with GenBank sequences using the

Table 1. Sequence of forward and reverse primers used in this study.

Primer description Sequence (5′ → 3′) Primer name

Primers for verificationForward primer GAAGAGTAGCAAGACAGGGAA JNK-F

CTGGTGACACAGTATGAACG JIP4-F1GCAAAAGAAAGCGATTACG JIP4-F2

Reverse primer GAAGAGGCGGTCAAAGGA JNK-RCCTCAAACGCAGCCGA JIP4-R1AGAGCAGTAGGGTGCGAAC JIP4-R2

Primers for spanning exon-exon junctionForward primer ATGGGCAAGGTAGTGGAGA JIP4-SReverse primer GGTTTATCTCTTCCGTTTCCT JIP4-A

Primers for RACE PCRForward primer GTTGAAAACCGTCCCCGCT JNK-3′raceReverse primer AGGACTCAGGAGCGGCATA JNK-5′race

TCGTGCTCCTGGTTCTCCGTGT JIP4-5′race

Sequencing ATTTAGGTGACACTATAGAA SP6TAATACGACTCACTATAGG T7

Primers for DIG-RNA probesForward primer GGCTATTCCTTTGACCGC JNK-Pro-F

ACGACGACATCAACAAGGC JIP4-Pro-FReverse primer GCAGCAGCATTAGTGGCAG JNK-Pro-R

GGACAGCGGAGTGGACATA JIP4-Pro-R

686 JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 5, 2016

BLAST program (http://blast.ncbi.nlm.gov). ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to determine the open reading frame(ORF). Functional protein domains and conserved domains were deducedusing DELTA-BLAST or SMART (http://blast.ncbi.nlm.nih.gov, http://smart.embl-heidelberg.de/smart/set_mode.cgi). The amino-acid composi-tion, molecular weight and isoelectric point were calculated by using theExPASy ProtPatam tool (http://web.expasy.org/protparam). The DNAmansoftware was used to perform multiple sequence alignments, and the MEGA4.0 program (Thompson et al., 1994; Tamura et al., 2007) was employed toanalyze the phylogenetic relationships.

Antibodies

The antibodies used were obtained from commercial sources: anti-JNK andanti-phospho-JNK (Santa Cruz Biotechnology, Dallas, TX, USA), anti-JIP4(Cell Signaling Technology, Danvers, MA, USA), HRP-conjugated goatanti-mouse IgG, HRP-conjugated goat anti-rabbit IgG, FITC-conjugatedAffiniPure goat anti-mouse IgG, FITC-conjugated AffiniPure goat-rabbitIgG and Cys-conjugated AffiniPure goat anti-rabbit IgG (CWBIO, Beijing,P.R. China), and rabbit anti-β-actin (HuaAn Biotechnology, Hangzhou, P.R.China).

Western Blot Analysis

Testis, vas deferens, gills, intestine, heart, and muscle from the samemonth and testis from July to December were homogenized in the RIPAlysis buffer (Beyotime, Jiangsu, China) containing protease inhibitors onice for 10 min and centrifuged at 12,000× g for 5 min at 4°C, andthe supernatant was collected. A Thermo NanoDrop 2000 was used todetermine the protein concentrations. All samples containing equal amountsof protein were diluted with a quarter volume of 5× SDS-PAGE sampleloading buffer (Beyotime) and then heated at 100°C for 5 min. Afterseparation by 10% SDS-PAGE, the proteins were transferred to a methanol-activated polyvinylidene fluoride membrane (PVDF) (CWBIO) at 200 mAfor 120 min. Subsequently, the membrane was blocked with 5% bovineserum albumin (BSA) in Tris-buffered Saline with Tween 20 (TBST) atroom temperature on a shaker for 60 min and then incubated with theprimary antibody (diluted 1:1000) overnight at 4°C. After washing withTBST three times, the membrane was immunoreacted with horseradishperoxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG)(diluted 1:2000) at 37°C for 60 min. After washing three times with TBST,the immunoreactive protein bands were visualized using the cECL WesternBlot Kit (CWBIO), and photos were acquired by Charge Coupled Device(CCD) imaging. For subsequent detection of another primary antibodyon the same membrane, the membrane was treated with Stripping Buffer(CWBIO) according to the procedures described by the manufacturer andthen probed with the corresponding antibody as above.

DIG-Labeled RNA Probe Synthesis

Two pairs of primers (Table 1) were designed to amplify the 392 bp Es-JNK cDNA fragment and the 492 bp Es-JIP4 cDNA fragment for DIG-labeled RNA probe synthesis cloning. The PCR reactions were performed,and the amplified target fragments were extracted, purified, and cloned aspreviously described (Wang et al., 2012). Positive clones were selectedby sequencing, from which it was determined that T7 RNA polymerasewould be used for the in vitro antisense probe synthesis and SP6 RNApolymerase used for the in vitro sense probe synthesis. The positiveplasmids were extracted using the HighPure Plasmid Kit (TIANGEN,Beijing, P.R. China) and were linearized after digestion by SpeI (Takara).The product was purified with Axygen PCR Clean-up Kit (Axygen, SiliconValley, CA, USA) and utilized as the template for DIG-labeled RNA probesynthesis. The 20 μl transcription mixture included 10 μl of linearizedplasmid template (100 ng/μl), 2 μl DIG RNA labeling mix (Roche, Basel,Switzerland) instead of dNTP labeling mixture, 2 μl 10× Transcriptionbuffer, 1 μl Protector RNase inhibitor, 2 μl RNA Polymerase T7 (SP6)(Promega) and 3 μl RNase-free water. The riboprobe synthesis reactionswere performed according to the manufacturer’s protocol. The ribprobeswere subsequently centrifuged at 13,000× g for 20 min at 4°C, washed withpre-chilled 75% ethanol, centrifuged at 13,000× g for 5 min at 4°C, dried atroom temperature for 10 min, and dissolved in 30 μl diethypyrocarbonate(DEPC) water for storage at −80°C.

Hematoxylin and Eosin (HE) Staining

The developmental phases of the testis can be distinguished according toits morphology (Wang et al., 2015). Fresh testes obtained from healthyadult male Chinese mitten crabs in August, 2014 were fixed in Bouin’s

solution, embedded in paraffin and cut into sections of 3 μm thick for usein further experiments. Tissue paraffin sections were dewaxed with xyleneand dehydrated with gradient alcohol. We used HE Staining Kit (Soarbio,Beijing, P.R. China) to elaborate the morphological and structural changesduring spermatogenesis of E. sinensis. The stained sections were observedwith a bright field microscope (Leica, Wetzlar, Germany).

In Situ Hybridization

In situ hybridization was performed according to methods used by Trifonovet al. (2009) and Wang and Yang (2010) with some modifications. Afterdewaxed with xylene and dehydrated with gradient alcohol, the paraffinsections of testes were then prehybridized at 60°C for 120 min in 50%deionized formamide in 5× SSC (standard saline citrate, pH 7.0) containingdenatured salmon sperm DNA, which can decrease hybrid background andimprove hybridization specificity. Probes were denatured at 80°C for 5 min.The hybridization was performed in a hybridization mixture containingapproximately 400 ng/ml DIG-labeled RNA probe in a damp box saturatedwith 5× SSC solution containing 50% deionized formamide at 60°Covernight. Following hybridization, sections were washed in 2× SSC for30 min at room temperature, then 2× SSC solution at 65°C for 60 minfollowed by 0.1× SSC solution at 65°C for 60 min. Hybridized probeswere detected with an alkaline phosphatase-conjugated anti-DIG antibody(Roche), and the chromogenic reaction was developed with NBT/BCIP(Roche), according to the manufacturer’s protocol. The hybridized sectionswere observed, and images were captured with a bright field microscope(Leica).

Spermatophore Digestion and Induction of Spermatozoa

Spermatozoa were obtained from spermatophores in the vas deferens andplaced in precooled (4°C) Ca2+-free artificial seawater (Ca2+-FASW)(NaCl, 21.63 g/l; KCl, 1.12 g/l; H3BO3, 0.53 g/l; NaOH, 0.19 g/l; MgSO4 ·7H2O, 4.93 g/l, pH 7.4). The spermatophores were first extruded from theseminal vesicles to Ca2+-FASW. After centrifuging at 400× g for 10 min,the spermatophores were digested with 0.025% trypsin (Gibco, Carlsbad,CA, USA) for 10 min at 37°C with gentle stirring. The spermatozoal pelletwas washed with the precooled Ca2+-FASW three times to obtain the puresperm cells with a high survival rate (>80%).

The calcium ionophore A23187-induced AR was analyzed as reportedby Zhu et al. (2014) and Sun et al. (2015). A23187 (Sigma, St. Louis, MO,USA), which was dissolved in DMSO at 2 mg/ml as the stock solution, wasadded to the prepared spermatozoal suspension to the final concentrationof 50 μg/ml at room temperature. A sample of spermatozoa was collectedevery 10 min (approximately 60 min) and used for further experiments.Sperm viability at different stages was measured by Trypan blue exclusion(Mayorga et al., 2007). Ten microliters of the spermatozoal suspension wasmixed with an equal volume of Trypan blue for 1 min and examined undera bright field microscope (Leica).

Immunofluorescence

After deparaffinization and dehydration in graded alcohol, the testes tissuesections were transferred into antigen retrieval citrate buffer (0.01 M,pH 6.0) at 92°C for 10 min and incubated with 3% H2O2 deionized water atroom temperature for 10 min. After washing in phosphate-buffered solution(PBS) three times, the slides were blocked in 2% BSA in TBST solutionfor 30 min and incubated with an anti-JNK, anti-phospho-JNK or anti-JIP4antibody (diluted at 1:100) at 4°C overnight. After being washed three timeswith TBST, the slides were incubated with Cys-conjugated AffiniPure goatanti-rabbit IgG, FITC-conjugated AffiniPure goat anti-mouse IgG or FITC-conjugated AffiniPure goat-rabbit IgG secondary antibodies (diluted 1:100)at 37°C for 60 min. The nuclei were finally stained with 4,6-diamino-2-phenyl indole (DAPI) (ZSGB-BIO, Beijing, P.R. China) for 10 min andobserved with a fluorescence microscope (Leica).

The A23187-stimulated sperm samples were smeared on slides and fixedwith 4% paraformaladehyde for 10 min. After washing three times in PBS,the slides were permeabilized in 0.1% Triton X-100 and then washed threetimes again. The slides were incubated with specific antibodies as describedabove for immunofluorescence analysis.

Statistical Analyses

Statistical analyses were performed using SPSS software version16.0.Data were given as mean ± standard error (SE). Statistical significanceswere determined by one-way ANOVA (Snedecor and Cochran, 1971).Significance was set at P < 0.05.

YANG ET AL.: REPRODUCTION OF JNK/JIP4 IN E. SINENSIS 687

RESULTS

Sequence Analyses of Es-JNK and Es-JIP4 cDNAsin E. sinensis

The full-length sequence of Es-JNK cDNA (GenBank ac-cession no. KC900087) was successfully cloned, spanning2467 bp including a 624 bp 5′ untranslated region (UTR),a 1266 bp ORF and a 586 bp 3′ UTR. The ORF en-codes an Es-JNK protein of 421 amino acids (Fig. 1). Therelative molecular mass of Es-JNK protein was identifiedas 47 kDa. DELTA-BLAST analysis showed that the pro-tein has a JNK MAPK function domain (STKc_JNK: ser-ine/threonine kinases (STKs), JNK subfamily, catalytic do-main) (see Fig. S1 in the online edition of this journal, whichcan be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x). This functional domain con-tains an active site, activation loop (A-loop), ATP bind-ing site, KIM (Kinase Interaction Motif) docking site, andpolypeptide substrate binding site. A dual-phosphorylationsite named the T-X-Y motif (T195-P196-Y197) was found,which is unique for JNK MAPK within the A-loop. Blast Panalysis of the Es-JNK protein amino-acid sequence showedhigh similarity with other species found in the database, e.g.,

Fig. 1. Full-length cDNA of Es-JNK gene and deduced amino-acidsequences. The functional domain STKc_JNK is underlined, and the T-P-Ymotif is shaded. The polyA signal AATAAA and polyA tail are boxed.

97, 93, 89, 83, and 83% identity with homologs from Mar-supenaeus japonicus (Spence Bate, 1888), Danaus plexip-pus (Linnaeus, 1758), Drosophila melanogaster (Meigen,1830), Columba livia (Gmelin, 1789) and Homo sapiens,respectively. Multiple sequence alignment showed that allactive sites of JNK from different species are highly con-served (Fig. 2). In the phylogenetic tree analysis, JNK fromE. sinensis first clustered with its homolog from M. japoni-cus, then with those from insects such as D. melanogaster,and vertebrates such as birds and mammals (see Fig. S2in the online edition of this journal, which can be ac-cessed via http://booksandjournals.brillonline.com/content/journals/1937240x).

The full-length sequence of Es-JIP4 cDNA (GenBank ac-cession no. KP691642) was successfully cloned, spanning4298 bp including a 180 bp intact 5′ UTR, a 3936 bp in-tact ORF, and a 386 bp partial 3′ UTR. The ORF encodesan Es-JIP4 protein of 1311 amino acids, with a relativemolecular mass of 146 kDa (Fig. 3). DELTA-BLAST analy-sis showed that the protein has a JNK-SapK_ap_N domain,which is the N-terminal 200 residues of a set of proteinsconserved from yeasts to humans. This functional domainhas two polypeptide binding sites, homodimer interface, andMyoVa-GTD (see Fig. S3a in the online edition of thisjournal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x). SMART analy-sis also showed that the protein has a WD40 domain, whichis known to function as a protein-protein or protein-DNA in-teraction platform in a large variety of cellular processes (Xuand Min, 2011) (see Fig. S3b in the online edition of thisjournal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x). Blast P analy-sis showed that the Es-JIP4 protein amino-acid sequencedoes not have high similarity with other species found inthe database. For example, it has 54%, 53%, 46%, and46% identity with corresponding sequences from Fopiusarisanus (Sonan, 1932), Harpegnathos saltator (T. C. Jer-don, 1851), Anolis carolinensis (Voigt, 1832), and Musmusculus (Linnaeus, 1758), respectively. Multiple sequencealignment showed that even though Es-JIP4 has low identitywith homologous proteins, the functional domains are highlyconserved. In addition, the JBD domain is more highly con-served in vertebrates than invertebrates including E. sinen-sis. In the phylogenetic tree analysis, JIP4 from E. sinensisclustered with its homolog from Fopius arisanu first, thenwith those from insects such as Harpegnathos saltator, andfinally vertebrates such as fishes, reptiles, birds, and mam-mals (see Fig. S4 in the online edition of this journal, whichcan be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x).

Expression of Es-JNK and Es-JIP4 Proteins in E. sinensis

The Es-JNK protein was found to be widely expressed inChinese mitten crabs by Western blotting without tissuespecificity. The Es-JIP4 protein was mainly expressed in re-lated to reproduction system such as testis and vas deferens,but rarely in gills, intestine, heart, and muscle. For both theEs-JNK and Es-JIP4 proteins, the highest expression was inthe testis (Fig. 4a). The expression levels of Es-JNK, Es-p-JNK and ES-JIP4 in testis were measured monthly fromJuly to December together with the Western blotting section.

688 JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 5, 2016

Fig. 2. Multiple alignment of JNK amino-acid sequences from Eriocheir sinensis and other representative invertebrates and vertebrates. Identical residuesare shaded dark black. Similar residues are shaded in dark gray (>75%) and light gray (>50%). The active sites are marked with fine boxes. The A-loopand T-P-Y motif are enclosed in a bold boxes, respectively. ATP binding sites, KIM-docking sites, and polypeptide substrate binding sites are indicated bytriangles. This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

As shown in Fig. 4b, the expression levels of total Es-JNKand Es-p-JNK both decreased gradually throughout the testisdevelopment in E. sinensis, with relatively high expressionfrom July to October and the highest expression in August.The expression level of Es-JIP4 protein was also relativelyhigh from July to September, whereas almost no expressionwas detected in October, November, and December.

Localization of Es-JNK and Es-JIP4 During TestisDevelopment in E. sinensis

Es-JNK and Es-JIP4 transcripts were detected during thetestis development in E. sinensis by using in situ hybridiza-tion (Fig. 5). HE staining was first used to show standardhistological changes of the testis at different developmen-tal stages, including the spermatogonium stage (Fig. 5A1),primary spermatocyte stage (Fig. 5B1), first division ofmeiosis stage (Fig. 5C1), secondary spermatocyte stage(Fig. 5D1), and spermatid stage (Fig. 5E1). Es-JNK andEs-JIP4 transcripts were detected with similar distributionpatterns during different testis developmental stages. Bothtranscripts were highly expressed in the nucleus from thespermatogonium stage to secondary spermatocyte stage andlowly expressed in the cytoplasm and intercellular substance(Fig. 5A2-D2, A3-D3). In the spermatid stage, Es-JNK andEs-JIP4 transcripts were found in the NC, AC, AT, and AV,with significant expression levels in the AC (Fig. 5E2, E3).A sense RNA probe was used as a control to confirm theelimination of non-specific hybridization (Fig. 5A4-E4).

Localization of Es-JNK and Es-JIP4 Proteins byImmunofluorescence Analysis

As shown in Fig. 6, the distributions of total Es-JNK and Es-p-JNK proteins were highly similar in the spermatogonium

stage (Fig. 6A), primary spermatocyte stage (Fig. 6B),secondary spermatocyte stage (Fig. 6C), and spermatid stage(Fig. 6D) in the testis of E. sinensis. The Es-JNK proteindistribution was nevertheless different from that of the Es-JNK transcript in the spermatogonium stage and primaryspermatocyte stage. For example, both Es-JNK and Es-p-JNK proteins were more highly expressed in the cytoplasmand intercellular substance than in the nucleus, where theirexpression levels were slight (Fig. 6A2, A3, B2, B3).We found that the Es-JNK and Es-p-JNK proteins in thesecondary spermatocyte stage were mainly expressed in thenucleus (Fig. 6C2, C3). Es-JNK and Es-p-JNK proteins werealso found to be widely expressed in multiple regions (AC,AT, AV, and NC) of spermatid as with the distribution of theEs-JNK transcripts in the spermatid stage, with the highestexpression in the AC (Fig. 6D2, D3).

The localization of Es-JIP4 protein was almost the sameas the distributions of Es-JNK and Es-p-JNK proteins in thespermatogonium stage (Fig. 7A2), secondary spermatocytestage (Fig. 7C2), and spermatid stage (Fig. 7D2) in the testisof E. sinensis. Es-JIP4 protein was nevertheless expressedin the nucleus at a relatively high level in the primaryspermatocyte stage (Fig. 7B2). Activated Es-JNK and Es-JIP4 proteins were initially localized in the cytoplasm andintercellular substance and then transferred to the nucleus,AV, and AC during the process of spermatogenesis. Figure 7A1-D1 clearly shows the morphological changes of thenucleus during testis development in E. sinensis. Mergedimages showed combined DAPI and Es-JIP4 protein signals(Fig. 7A3-D3).

YANG ET AL.: REPRODUCTION OF JNK/JIP4 IN E. SINENSIS 689

Localization of Es-JNK, Es-p-JNK, and Es-JIP4 Proteins inAR in E. sinensis

To track Es-JNK, Es-p-JNK and Es-JIP4 proteins in spermduring the AR, the sperm morphological changes in thefour stages of the AR were first detected by bright-field mi-croscopy (Fig. 8A1-E1, Fig. 9A1-E1), with the morpholo-gical changes of the nucleus indicated by DAPI (Fig. 8A2-E2, Fig. 9A2-E2). The distributions of Es-JNK and Es-p-JNK proteins were highly similar during the whole processof the AR in E. sinensis (Fig. 8). At the unreacted spermato-zoa stage, both Es-JNK and Es-p-JNK proteins were locatedin the nucleus and the AC (Fig. 8A3, A4). As the AC wasprotruding, Es-JNK and Es-p-JNK proteins were hardly de-tected in the nucleus, but they were expressed at high levelsin the AC and lower levels in the AV (Fig. 8B3, B4). Whenthe AV moved through the aperture and AT extended out ofthe aperture, Es-JNK and Es-p-JNK proteins were only de-tected in the AC and AV, with high levels in the AV and lowerlevels in the AT (Fig. 8C3, C4, D3, D4). At the end of the ARwith the AV disappearing, Es-JNK and Es-p-JNK proteinswere only visible in the AC (Fig. 8E3, E4). Meanwhile, thelocalization of Es-JIP4 protein was almost the same as thedistributions of Es-JNK and Es-P-JNK proteins in the fourstages of the AR (Fig. 9).

The results indicate that Es-JIP4 protein was transferredfrom the nucleus to the AC and AV during the process of theAR in E. sinensis. Es-JNK, Es-p-JNK and Es-JIP4 proteinswere not observed in the AT. Merged images showedcombined DAPI and Es-JNK protein signals (Fig. 8A5-E5),DAPI and Es-p-JNK protein signals (Fig. 8A6-E6), DAPI,and Es-JIP4 protein signals (Fig. 9A4-E4).

DISCUSSION

Capacitation and AR are important physiological processesfor fertilization. ERK1/2 has been identified in spermatozoaof fowl and mammals (Ashizawa et al., 1997; Nixon et al.,2010), and the p38 pathway has been found to participate ingerm cell apoptosis and mediate the disruption of the blood-testis barrier integrity induced by cytokines in mammals (Liet al., 2009). Both ERK and p38 have also been detectedin the tail of mature human spermatozoa and are implicatedin regulating hyper activated motility and promoting the AR(Austin, 1951; Chang, 1951; Luconi et al., 1998; Almog andNaor, 2008). These findings have triggered active researchon the MAPK pathway in sperm capacitation and the AR.Although many studies have demonstrated that JNK isexpressed in the testis and that is involved in the apoptosisof germ cells in mammals (Show et al., 2008), its functionin crustaceans remain unclear.

We had previously demonstrated that ERK and p38 par-ticipate in the regulation of spermatogenesis and AR (Zhu etal., 2014; Sun et al., 2015). We further explored the role ofthe JNK pathway in the spermatogenesis and AR processesof E. sinensis. We successfully cloned the full-length cDNAsof Es-JNK and Es-JIP4 during this study, showing that Es-JNK has a high identity with JNK in M. japonicus and H.

Fig. 3. Full-length cDNA of Es-JIP4 gene and deduced amino-acidsequences. The functional domain JNK-SapK_ap_N is indicated by thegray shadowed box.

690 JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 5, 2016

Fig. 4. Characterization of Es-JNK, Es-p-JNK, and Es-JIP4 protein expression in Eriocheir sinensis. (a) Expression of Es-JNK and Es-JIP4 proteins indifferent tissues (testis, vas deferens, gills, intestine, heart, and muscle); (b) expression of Es-JNK, Es-p-JNK, and Es-JIP4 proteins during testis differentdevelopmental stages. β-actin was detected as the internal control. Bars represent the triplicate mean ± SE from three separate individuals (n = 3). Barswith different letters differed with statistical significance (P < 0.05).

sapiens and contains a highly conserved STKc-JNK func-tional domain, a T-P-Y motif within the A-loop structureand the crucial dual-phosphorylation sites of JNK on thre-onine and tyrosine (Widmann et al., 1999). The conversedKIM is also present in different MAPK interacting partners,including substrates, inactivating phosphatases, scaffoldingproteins, and activating kinases. Because of these differentsubstrates, JNK MAPK pathway are involved in different bi-

ological functions. Es-JIP4 was nevertheless found to havelower identity with the JIP4 sequence from F. arisanus andM. musculus. All JIP family members have been shown tocontain a conserved region (JBD: JNK binding domain),which can bind JNK in mammals (Kelkar et al., 2000; En-gstrom et al., 2010). This study has shown that Es-JIP4contains a highly conserved JNK-SapK-ap-N domain and aWD40 domain. The JNK-SapK-ap-N domain contains two

Fig. 5. Localization of Es-JNK and Es-JIP4 transcripts in testis of Eriocheir sinensis by in situ hybridization. Five stages in spermatogenesis are shown,including spermatogonium stage (column A), primary spermatocyte stage (column B), first division of meiosis stage (column C), secondary spermatocytestage (column D), and spermatid stage (column E). The first row shows testis paraffin sections with H&E staining at five stages in spermatogenesis as astandard (A1-E1). In situ hybridization of testis using antisense probes for Es-JNK (A2-E2) and Es-JIP4 (A3-E3). Sense probes used as negative controlsshowed no signal (A4-E4). AC, apical cap; AT, acrosomal tubule; AV, acrosomal vesicle; NC, nuclear cup; Sg, spermatogonium (circle); PSc, primaryspermatocyte (circle); SSc, secondary spermatocyte (circle); St, spermatid (circle). Arrows in C1, A2, B2, C2, D2, A3, B3, C3, and D3 indicate the nucleus,which means both transcripts are highly expressed in the nucleus; Arrows in E2 indicate AT and AC; Arrows in E3 indicate AV and NC. Scale bar = 10 μm.This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

YANG ET AL.: REPRODUCTION OF JNK/JIP4 IN E. SINENSIS 691

Fig. 6. Localization of total Es-JNK and Es-p-JNK proteins in testisof Eriocheir sinensis by double-label immunofluorescence staining. Fourstages in spermatogenesis are shown, including spermatogonium stage(row A), primary spermatocyte stage (row B), secondary spermatocytestage (row C), and spermatid stage (row D). Es-JNK and Es-p-JNK wereprobed with specific primary antibodies and the appropriate Cys-conjugatedsecondary antibody (A2-D2) or FITC-conjugated secondary antibody (A3-D3), while DAPI was used to stain the nuclei (A1-D1). AC, apical cap;AT, acrosomal tubule; AV, acrosomal vesicle; NC, nuclear cup. Arrowsin A2, A3, B2, and B3 indicate cytoplasm and intercellular substance;Arrows in C2, C3, D1, and D2 indicate nucleus and NC; An arrow in D2indicates AT; Arrows in D3 indicate AV and AC. Scale bar = 10 μm.This figure is published in colour in the online edition of this journal,which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

polypeptide-binding sites, homodimer interface and MyoVa-GTD, which have been found to be involved in acrosomalformation and nuclear morphogenesis in the spermatogene-sis of E. sinensis (Sun et al., 2010). The WD40 domain, as aprotein-protein or protein-DNA interaction platform, partic-ipates in a variety of cellular processes, such as DNA dam-age repair, DNA replication, cell signaling transduction, andapoptosis (Xu and Min, 2011). Remarkably, Es-JIP4 wasfound lacking the JBD domain, implying perhaps that differ-ences exist in the regulatory mechanisms for JNK and JIP4between E. sinensis and mammals.

Es-JNK and Es-JIP4 were detected in various tissues, withhigh level in the testis and vas deferens. The results suggestthat both proteins function in the male reproductive physiol-ogy of E. sinensis. According to previous studies, JNK con-trols the onset of mitosis in stem cells and triggers cell apop-tosis in planarians (Almuedo et al., 2014), and the downreg-ulation of cold-inducible RNA-binding protein (CIRP) canactivate the JNK pathway, resulting in increasing apoptosisof germ cells in the mouse testis (Xia et al., 2012). Further-more, the activation of JNK also requires JIPs as scaffoldproteins during the ischemia-reperfusion (IR)-induced cellapoptosis process (Xu et al., 2010). In August, partial sper-matocytes could develop and produce spermatids by meiosisin testis of E. sinensis, and partial germ cells undergone pro-grammed apoptosis. Es-JNK and Es-JIP4 proteins expres-

Fig. 7. Localization of Es-JIP4 protein in testis of Eriocheir sinensis byimmunofluorescence staining. Four stages in spermatogenesis are shown,including spermatogonium stage (row A), primary spermatocyte stage(row B), secondary spermatocyte stage (row C), and spermatid stage(row D). Es-JIP4 protein was probed with a specific primary antibodyand the appropriate FITC-conjugated secondary antibody (A2-D2), whileDAPI was used to stain the nuclei (A1-D1). Merged images show combinedDAPI and Es-JIP4 protein signals (A3-D3). AC; apical cap; AV, acrosomalvesicle; NC, nuclear cup. Arrows in A1, A2, B1, and C2 indicate thenucleus; An arrow in A3 indicates cytoplasm and intercellular substance;Arrows in B2 and B3 indicate the nucleus and cytoplasm; An arrow in D1indicates NC; Arrows in D2 indicate NC and AV; An arrow in D3 indicatesAC. Scale bar = 10 μm. This figure is published in colour in the onlineedition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

sion level reached the highest at this stage, suggesting thatEs-JNK and Es-JIP4 proteins could be involved in the regu-lation of cell division or sperm quality monitoring. Althoughthe distribution of Es-p-JNK and Es-JIP4 were synchronousin spermatogenesis, the patterns between the transcript andprotein level of both were different (Fig. 10a). It implied thatEs-p-JNK could interact with the scaffold proteins Es-JIP4to regulate the spermatogenesis, and both are shuttling pro-teins involved in several process of spermatogenesis and par-ticipate in the subsequent AR. It must undergo the AR beforethe mammalian sperm contacts the ZP, which is a necessaryprocess for fertilization. In general, the AR is characterizedby the fusion of the outer acrosomal with the plasma mem-brane of the sperm, followed by vesiculation of these mem-branes and enzyme release from the acrosomal matrix (Oka-mura and Nishiyama, 1978). The release of the acrosomalproteolytic enzyme has been demonstrated to occur througha single circular opening formed at the base of the acroso-mal cap in fowl (Ahammad et al., 2013). As calcium caninduce the AR, the calcium ionophore A23187 was used inthis study to induce the AR as described by Zhu et al. (2014)and Sun et al. (2015). The unreacted sperm stage, Es-JNKand Es-JIP4 proteins were shown to be present in the nu-cleus and the AC (Fig. 10b). After induction by A23187,both proteins were rearranged in the AC and AV during the

692 JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 5, 2016

Fig. 8. Localization of total Es-JNK and Es-p-JNK proteins during the acrosome reaction (AR) in Eriocheir sinensis by double-label immunofluorescencestaining. Morphological changes of sperm in the four stages of the AR were detected by bright-field microscopy as a standard (A1-E1). Also shown areseveral stages of the AR, including unreacted spermatozoa stage (row A): AC protruding stage (row B), AV valgus stage (row C), extension of the AT stage(row D), and the end of the AR (row E). Es-JNK and Es-p-JNK were probed with specific primary antibodies and the appropriate Cys-conjugated secondaryantibody (A3-E3) or FITC-conjugated secondary antibody (A4-E4), while DAPI was used to stain the nuclei (A2-E2). Merge 1 images show combined DAPIand Es-JNK protein signals (A5-E5). Merge 2 images show combined DAPI and Es-p-JNK protein signals (A6-E6). AC, apical cap; AV, acrosomal vesicle;NC, nuclear cup. Arrows in A3 indicate NC; Arrows in A4, B3, B4, E3, and E4 indicate AC; Arrows in C3, C4, D3, and D4 indicate AV. Scale bar = 10 μm.This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

first three steps of the AR, and then they were only found inthe AC as the lamellar structure fell off. These results implythe involvement of Es-JNK and Es-JIP4 in enzyme releaseduring the AR, which will require further investigation. Thedistributions of Es-JNK and Es-JIP4 proteins were also verysimilar during the AR, implying that the two proteins play arole in the AR together.

This study is the first to clone the full-length cDNAsof Es-JNK and Es-JIP4 and explore the temporal andspatial expression patterns of Es-JNK and Es-JIP4 proteinsin E. sinensis. We found a striking coincidence betweenthe localization patterns of Es-JNK and Es-JIP4 in thesemale reproductive processes. The results thus suggest that

Fig. 9. Localization of Es-JIP4 protein during the acrosome reaction (AR)in E. sinensis by immunofluorescence staining. Morphological changes ofsperm in the process of the AR were detected by bright-field microscopy asa standard (A1-E1). Also shown are several stages of the AR, includingunreacted spermatozoa stage (row A), apical cap (AC) protruding stage(row B), acrosomal vesicle (AV) valgus stage (row C), extension of theacrosomal tubule (AT) stage (row D) and the end of the AR (row E). Es-JIP4 was probed with a specific primary antibody and the appropriate FITC-conjugated secondary antibody (A3-E3), while DAPI was used to stain thenuclei (A2-E2). Merged images show combined DAPI and Es-JIP4 proteinsignals (A4-E4). An arrow in A3 indicates nuclear cup; Arrows in A4, B3,B4, E3 and E4 indicate AC; Arrows in C3, C4, D3 and D4 indicate AV. Scalebar = 10 μm. This figure is published in colour in the online edition of thisjournal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

YANG ET AL.: REPRODUCTION OF JNK/JIP4 IN E. SINENSIS 693

Fig. 10. Model of Es-JNK and Es-JIP4 localization during spermatogenesis (a) and the acrosome reaction (AR) (b) in E. sinensis. Because distributionsof Es-JNK and Es-JIP4 transcripts were consistent in spermatogenesis (a). The Es-JNK and Es-JIP4 transcripts were mainly located in the nucleus in thespermatogonium stage (A), primary spermatocyte stage (B), first division of meiosis stage (C) and secondary spermatocyte stage (D). In the spermatid stage(E), Es-JNK and Es-JIP4 transcripts were located not only in the nucleus, but also in the apical cap (AC), acrosomal tubule (AT), and acrosomal vesicle(AV). The small dots indicate p-JNK and JIP4 proteins. In spermatogenesis (a), both p-JNK and JIP4 proteins were located in the cytoplasm and the nucleusfrom the stages shown in A to C, whereas they were mainly expressed in the nucleus in D and located in the nuclear cup (NC), AC, AT, and AV in E. In theAR (b), p-JNK, and JIP4 proteins were located in the NC and the AC in unreacted sperm (A). In the AC protruding stage (B), p-JNK and JIP4 proteins weremainly focused on the AC to form the aperture. During the AV valgus (C) and extension of the AT stage (D), p-JNK and JIP4 proteins were mainly locatedin the AC and the AV to break through the egg membrane. At the end of the AR with the AV disappeared (E), p-JNK and JIP4 proteins were only located inthe AC. EC, egg chorion; FL, fibrous layer; in, inside egg chorion; LS, lamellar structure; ML, middle layer; N, nucleus; out, outside of egg chorion; PM,plasma membrane; RA, radial arm. This figure is published in colour in the online edition of this journal, which can be accessed via http://booksandjournals.brillonline.com/content/journals/1937240x.

JNK and JIP4 may work together and are involved inspermatogenesis and the AR in E. sinensis. The specificmechanism of interaction between JNK and JIP4 moleculesneeds to be further explored.

ACKNOWLEDGEMENTS

Work was supported by grants from the National Natural Science Founda-tion of China (No. 31201974 and No. 41376157). We thank the College ofLife Science, East China Normal University for the support of the publicexperimental platform and the anonymous reviewers of the manuscript.

REFERENCES

Ahammad, M. U., C. Nishino, H. Tatemot, N. Okura, S. Okamoto, andY. Kawamoto. 2013. Acrosome reaction of fowl sperm: evidence forshedding of the acrosomal cap in intact form to release acrosomalenzyme. Poultry Science 92: 798-803.

Almog, T., and Z. Naor. 2008. Mitogen activated protein kinases (MAPKs)as regulators of spermatogenesis and spermatozoa functions. Molecularand Cellular Endocrinology 282: 39-44.

Almuedo, C. M., X. Crespo, F. Seebeck, K. Bartscherer, E. Salò, andT. Adell. 2014. JNK controls the onset of mitosis in planarian stemcells and triggers apoptotic cell death required for regeneration andremodeling. Plos Genetics 10: e1004400.

Ashizawa, K., K. Hashimoto, M. Higashio, and Y. Tsuzuki. 1997. The ad-dition of mitogen-activated protein kinase and p34cdc2 kinase substratepeptides inhibits the flagellar motility of demembranated fowl spermato-zoa. Biochemical and Biophysical Research Communications 240: 116-121.

Austin, C. R. 1951. Observations on the penetration of the sperm in themammalian egg. Australian Journal of Biological Sciences 4: 581-596.

Brown, G. G. 1966. Ultrastructural studies of sperm morphology andsperm-egg interaction in the decapod Callinectes sapidus. Journal ofUltrastructural Research 14: 425-440.

Chang, M. C. 1951. Fertilizing capacity of spermatozoa deposited into thefallopian tubes. Nature 168: 697-698.

De, L. E., P. Leclerc, and C. Gagnon. 1997. Capacitation as a regulatoryevent that primes spermatozoa for the acrosome reaction and fertilization.Molecular Human Reproduction 3: 175-194.

Du, N. S., W. Lai, and L. Z. Xue. 1987a. Studies on the sperm of Chinesemitten-handed crab, Eriocheir sinensis (Crustacea, Decapoda). I. Themorphology and ultrastructure of mature sperm. Chinese Journal ofOceanology and Limnology 18: 119-125 (in Chinese).

, L. Z. Xue, and W. Lai. 1987b. Induction of acrosome reactionof spermatozoa in the decapod, Eriocheir sinensis. Chinese Journal ofOceanology and Limnology 5: 118-123 (in Chinese).

, , and . 1988. Studies on the sperm of Chinesemitten-handed crab, Eriocheir sinensis (Crustacea, Decapoda). II. Sper-matogenesis. Chinese Journal of Oceanology and Limnology 19: 71-75(in Chinese).

694 JOURNAL OF CRUSTACEAN BIOLOGY, VOL. 36, NO. 5, 2016

Engstrom, W., A. Ward, and K. Moorwood. 2010. The role of scaffoldproteins in JNK signalling. Cell Proliferation 43: 56-66.

García, B. M. 2012. The mitochondria of stallion spermatozoa are moresensitive than the plasmalemma to osmotic-induced stress: role of c-JunN-terminal kinase (JNK) pathway. Journal of Andrology 33: 105-113.

Go, H., H. J. Hwang, and T. J. Nam. 2011. Polysaccharide from Cap-sosiphon fulvescens stimulate the growth of IEC cells by activating theMAPK signaling pathway. Marine Biotechnology 13: 433-440.

He, L., H. Jiang, D. D. Cao, L. H. Liu, S. N. Hu, and Q. Wang. 2013.Comparative transcriptome analysis of the accessory sex gland and testisfrom the Chinese mitten crab (Eriocheir sinensis). PLoS ONE 8: e53915.

Iwanaga, A., J. Wang, D. Gantulga, T. Sato, T. Baljinnyam, K. Shimizu,and H. Fuse. 2008. Ablation of the scaffold protein JLP causes reducedfertility in male mice. Transgenic Research 17: 1045-1058.

Jagadish, N., R. Rana, R. Selvi, D. Mishra, M. Garg, S. Yadav, andK. Koyama. 2005. Characterization of a novel human sperm-associatedAntigen 9 (Spag9) having structural homology with c-Jun N-terminalkinase-interacting protein. Biochemcial Journal 389: 73-82.

Kelkar, N., S. Gupta, M. Dickens, and R. J. Davis. 2000. Interaction ofa mitogen-activated protein kinase signaling module with the neuronalprotein JIP3. Molecular and Cell Biology 20: 1030-1043.

, C. L. Standen, and R. J. Davis. 2005. Role of the JIP4 scaffoldprotein in the regulation of mitogen-activated protein kinase signalingpathways. Molecular and Cell Biology 25: 2733-2743.

Langreth, S. G. 1969. Spermiogenesis in Cancer crabs. Journal of CellBiology 43: 575-603.

Lee, C. M., D. Onésime, R. C. Damodara, N. Dhanasekaran, and R. E.Premkumar. 2002. JLP: a scaffolding protein that tethers JNK/p38MAPKsignaling modules and transcription factors. Proceedings of the NationalAcademy of Sciences of the United States of America 99: 14189-14194.

Li, M. W., D. D. Mruk, and C. Y. Cheng. 2009. Mitogen-activated proteinkinases in male reproductive function. Trends in Molecular Medicine 15:159-168.

Luconi, M., T. Barni, G. B. Vannelli, C. Krausz, F. Marra, P. A. Benedetti,and G. Forti. 1998. Extracelluar signal regulated kinases modulatecapacitation of human spermatozoa. Biology of Reproduction 58: 1476-1489.

Mayorga, L. S., C. N. Tomes, and S. A. Belmonte. 2007. Acrosomalexocytosis, a special type of regulated secretion. IUBMB Life 59: 286-292.

Nixon, B., A. Bielanowicz, A. L. Anderson, A. Walsh, T. Hall, A.Mccloghry, and R. J. Aitken. 2010. Elucidation of the signaling path-ways that underpin capacitation-associated surface phosphotyrosine ex-pression in mouse spermatozoa. Journal of Cellular Physiology 224: 71-83.

Okamura, F., and H. Nishiyama. 1978. The passage of spermatozoathrough the vitelline membrane in the domestic fowl, Gallus. Cell TissueResearch 188: 497-508.

Show, M. D., C. M. Hill, M. D. Anway, W. W. Wright, and B. R. Zirkin.2008. Phosphorylation of Mitogen-Activated Protein Kinase 8 (MAPK8)is associated with germ cell apoptosis and redistribution of the Bcl2-modifying factor (BMF). Journal of Andrology 29: 338-344.

Snedecor, G., and W. Cochran. 1971. Statistical Methods. Iowas StateUniversity Press, Ames, IA.

Spence Bate, C. 1868. On a new genus, with four new species, of freshwaterprawns. Proceedings of the Zoological Society of London 1868: 363-368.

Suarez, S. S., and A. A. Pacey. 2006. Sperm transport in the femalereproductive tract. Human Reproduction Update 12: 23-37.

Sun, W. J., M. Zhu, Y. L. Wang, Q. Li, H. D. Yang, Z. L. Duan, and Q.Wang. 2015. ERK is involved in the process of acrosome reaction in vitroof the Chinese mitten crab, Eriocheir sinensis. Marine Biotechnology 17:305-316.

Sun, X., Y. He, L. Hou, and W. X. Yang. 2010. Myosin Va participates inacrosomal formation and nuclear morphogenesis during spermatogenesisof Chinese mitten crab Eriocheir sinensis. PLoS ONE 5: e12738.

Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA4: molecularevolutionary genetics analysis (MEGA) software version 4.0. MolecularBiology and Evolution 24: 1596-1599.

Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignmentthrough sequence weighting, position-specific gap penalties and weightmatrix choice. Nucleic Acids Research 22: 4673-4680.

Trifonov, S., T. Houtani, S. Hamada, M. Kase, M. Maruyama, andT. Sugimoto. 2009. In situ hybridization study of the distribution ofcholine acetyltransferase mRNA and its splice variants in the mouse brainand spinal cord. Journal of Neuroscience 159: 344-357.

Wang, D. H., and W. X. Yang. 2010. Molecular cloning and characterizationof KIFC1-like kinesin gene (es-KIFC1) in the testis of the Chinese mittencrab Eriocheir sinensis. Comparative Biochemistry and PhysiologyPart A: Molecular and Integrative Physiology 157: 123-131.

Wang, H. Z., H. J. Wang, X. M. Liang, and Y. D. Cui. 2006. Stockingmodels of Chinese mitten crab (Eriocheir japonica sinensis) in Yangtzelakes. Aquaculture 255: 456-465.

Wang, Q., Y. Wang, L. L. Chen, L. He, W. W. Li, and H. Jiang. 2012.Expression characteristics of the SUMOylation genes SUMO-1 andUbc9 in the developing testis and ovary of Chinese mitten crab, Eriocheirsinensis. Gene 501: 135-143.

Wang, Y. L., W. J. Sun, L. He, Q. Li, and Q. Wang. 2015. Morphologicalalterations of all stages of spermatogenesis and acrosome reaction inChinese mitten crab Eriocheir sinensis. Cell Tissue Research 360: 401-412.

Wassarman, P. M. 1999. Mammalian fertilization: molecular aspects ofgamete adhesion, exocytosis, and fusion. Cell 96: 175-183.

, L. Jovine, and E. S. Litscher. 2001. A profile of fertilization inmammals. Nature Cell Biology 3: e59-e64.

Weston, C. R., and R. J. Davis. 2007. The JNK signal transduction pathway.Current Opinion in Genetics and Development 19: 14-21.

Widmann, C., S. Gibson, M. B. Jarpe, and G. L. Johnson. 1999. Mitogen-activated protein kinase: conservation of a three-kinase module fromyeast to human. Physiological Reviews 79: 143-180.

Xia, Z. P., X. M. Zheng, H. Zheng, X. J. Liu, G. Y. Liu, and X. H. Wang.2012. Downregulation of cold-inducible RNA-binding protein activatesmitogen-activated protein kinases and impairs spermatogenic function inmouse testes. Asian Journal of Andrology 14: 884-889.

Xu, B., Y. Zhou, O. Karmin, P. C. Choy, G. N. Pierce, and Y. L. Siow. 2010.Regulation of stress-associated scaffold proteins JIP1 and JIP3 on the c-Jun NH2-terminal kinase in ischemia-reperfusion. Canadian Journal ofPhysiology and Pharmacolog 88: 1084-1092.

Xu, C., and J. R. Min. 2011. Structure and function of WD40 domainproteins. Protein Cell 2: 202-214.

Yu, H. M., Y. Wu, P. Ju, B. H. Wang, X. D. Yang, H. M. Wang, and L. C.Xu. 2014. eNOS-JNK1-AR signaling pathway mediates deltamethrin-induced germ cells apoptosis in testes of adult rats. EnvironmentalToxicology and Pharmacology 38: 733-741.

Zhu, M., W. J. Sun, Y. L. Wang, Q. Li, H. D. Yang, Z. L. Duan, L. He,and Q. Wang. 2014. P38 participates in spermatogenesis and acrosomereaction prior to fertilization in Chinese mitten crab, Eriocheir sinensis.Gene 559: 103-111.

RECEIVED: 9 December 2015.ACCEPTED: 11 May 2016.AVAILABLE ONLINE: 20 July 2016.

YANG ET AL.: REPRODUCTION OF JNK/JIP4 IN E. SINENSIS S1

Fig. S1. The functional domain of Es-JNK analysis by DELTA-BLAST.

Fig. S2. Neighbor-joining phylogenetic tree of Es-JNK protein andsimilar proteins in other species. The Es-JNK protein is indicated with thebox.

Fig. S3. The functional domain of Es-JIP4 analysis by DELTA- BLAST(a) and SMART (b). The BLAST refers to WD40 domain in b.

Fig. S4. Neighbor-joining phylogenetic tree of Es-JIP4 protein andsimilar proteins in other species. The Es-JIP4 protein is indicated with thebox.