Molecular Biology basics

Restriction enzymes

• Natural enzymes made by bacteria to protect against viral and other infections

• Each restriction enzyme recognizes a (more or less) specific sequence of DNA

• Each restriction enzyme hydrolyzes a (more or less) specific phosphate bond along the sugar backbone of the recognized sequence

• We are going to be using restriction enzymes that are extremely specific

Restriction patterns

• Because of the specificity, any given sequence of DNA gives a predictable pattern when digested with restriction enzymes

• The pattern consists of the number and sizes of the fragments generated, usually visualized by gel electrophoresis

• As the size of the DNA fragment increases, the amount of EtBr intercalated increases.

• What effect does this have on the brightness of bands separated in the gel?

Computer programs aid in restriction analysis

• Compare known restriction site sequences against DNA sequence

• Nebcutter example – in class exercise– Find NEBcutter by using a search engine– Choose pUC18 from “Standard Sequences” at top right – which

window will you choose from?– Select “NEB enzymes”– Observe resulting map– Under “Main options” at bottom left, choose “Custom digest”– Select EcoR1 and Sal1; submit and observe resulting map– explore options in NEBcutter by mousing over, choosing

hyperlinks, etc.• Remember, you must specify whether your DNA is linear

or circular before you start your NEBcutter analysis

Southern blotting

Idea

• Separate fragments of DNA on a gel

• Transfer single-stranded fragments to another support where they won’t diffuse

• Allow labeled, single stranded fragments that you know something about to hybridize to single stranded fragments on the support

• Anything that hybridizes can be visualized

Chemistry

• Separating fragments – we already went over this

• Transferring fragments to the support• choose a support – we have positively charged

nylon membrane – why? what will stick? how? • transfer by capillary action – solution moves,

soluble DNA moves, sticks to membrane• transfer solution is high salt and basic – why? • would the Southern blot work if you used water as

the transfer buffer?

Steps in the full procedure

• separation and transfer

• making labeled probe

• allowing probe to hybridize and visualize –

Southern vs. Northern vs. Western

• Southern named after Dr. Ed Southern– DNA on gel, labeled DNA is probe

• Northern is a pun– RNA on gel, labeled DNA is probe

• Western is another pun– Protein on gel, labeled antibody is a probe

Cloning• A gene is physically a piece of DNA• To clone a gene, the DNA must be

inserted into a vector, a self replicating DNA construct which copies itself and any DNA inserted into it

• Most commonly done in bacterial systems, esp E. coli, using a plasmid

• Can also clone into yeast, cultured cells, viral systems

Transformation Overview• Transformation: cells take up

foreign DNA• Purpose of transformation?

• cells make more DNA (cloning)• cells make protein (expression)

• Cells• may be manipulated genetically

for desired purpose (e.g., protease deficient for expression)

• need to be physically messed with so they’ll take up the DNA

• DNA to be transformed• circular vectors work best but

others are possible• vector/gene combination

depends on purpose of transformation

Vector• Transformation is a rare event

– how can the vector help us out?

• Two essential things on the expression vector:

• selection for presence of vector

• control of when cells actually make the protein

• What coding sequences (open reading frames) do you think are included on the pGLO vector?

• What else needs to be on the vector besides open reading frames?

EXAMPLE: pGLO uses normal

arabinose operon – works like Lac

operon

= PBAD promoter

Polymerase Chain Reaction

• Used to make a large amount of a specific piece of DNA

• Need• thermostable DNA polymerase• dNTPs• template• primers (two) of known sequence and high

specificity

Round 15’

3’ 5’

5’

3’

5’

5’5’

melt

Round 2

melt

melt

Round 3

• Melting the products of Round 2 yields two segments of DNA of the desired size (plus some “wrong” size pieces); both of the right size pieces will be replicated in every subsequent round, eventually swamping out the “wrong” size pieces left from the original template.

Our PCR experiment

• I designed primers for hsp22

• hspf: TATTTTTCACCTCCCCATGC

• hspr: TGACCAACCTTGGACCTTTG

• What does this tell you? Not much on its own, but we’ll get there …

PCR: the details

• For the chain reaction to work, you have to consider several factors:

• Melting and annealing of the large pieces of DNA involved

• Melting and annealing of the small pieces of DNA involved

• Under what conditions the polymerase works best

• All of these factors have to be indicated in the thermocycler program

• 1) Melting and annealing of large piece – melting happens at 95C this separates even very long strands of DNA; usually 2 minutes

• 2) Melting of small pieces of DNA – this happens at 95C too; usually just less than 1 minute

• 3) Annealing of small pieces = primers – this happens at, or ideally just slightly below, the Tm of the primers; the higher the annealing temperature, the more specific the hybridization of the primers

• primer Tm around 63-65 is ideal• primer Tm below about 55 undesirable• Annealing temperature is ideally around 60 C; obviously if the Tm is lower

than 60 the annealing temperature needs to be lower than 60 as well• Annealing time is usually about 30 seconds

• 4) Extension (polymerase extends the nucleotide chain) – this is slightly different for every kind of thermostable polymerase, but is usually 68 - 72 C. The polymerase needs 1 minute for every Kb of sequence in the product

• Steps 2-4 are repeated about 20 – 30 times• 5) Final extension (polymerase extends for a longer time) – usually

about 5 min at 68 C• Products are kept at 4 C (where they are very stable) until you can

do something with them – often overnight, sometimes several days.

Primer design: the most important step of PCR

• Primer considerations• Simple (not very accurate) formula for oligo 15-20

nucleotides long: Tm = 2(A+T) + 4(G+C)• primer Tm around 63-65 ideal; below 55 bad• primers Tm should be within 1-2 C of each other – why?• primers work best if they have a G or C at the 3’ end of the

primer – GC hybridization is stronger (why?) and this makes the primer “stick” well at the 3’ end – why is that important?

• primer should not be self-complementary – why?• primer pair should not be complementary to each other –

why?• primers should be about 20 nucleotides long

– you can calculate the expected frequency of matches in a genome or cDNA library of a known size to an oligo of a known size; for example, you only expect one occurrence of any given 15-mer in the human genome.

– What happens if primers are too short? too long?