Molecular Analysis of the Genetic Diversity of Chinese ...
Transcript of Molecular Analysis of the Genetic Diversity of Chinese ...
52
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011.
Available online at www.jstage.jst.go.jp/browse/jjshs1
JSHS © 2011
Molecular Analysis of the Genetic Diversity of Chinese Hami Melon and Its
Relationship to the Melon Germplasm from Central and South Asia
Yasheng Aierken1,2, Yukari Akashi1, Phan Thi Phuong Nhi1, Yikeremu Halidan1,
Katsunori Tanaka3, Bo Long4, Hidetaka Nishida1, Chunlin Long4, Min Zhu Wu2
and Kenji Kato1*
1Graduate School of Natural Science and Technology, Okayama University, Okayama 700-8530, Japan2Hami Melon Research Center, Xinjiang Academy of Agricultural Science, Urumuqi 830000, China3Research Institute for Humanity and Nature, Kyoto 603-8047, Japan4Kunming Institute of Botany, CAS, Heilongtan, Kunming, Yunnan 650204, China
Chinese Hami melon consists of the varieties cassaba, chandalak, ameri, and zard. To show their genetic diversity,
120 melon accessions, including 24 accessions of Hami melon, were analyzed using molecular markers of nuclear
and cytoplasmic genomes. All Hami melon accessions were classified as the large-seed type with seed length longer
than 9 mm, like US and Spanish Inodorus melon. Conomon accessions grown in east China were all the small-
seed type. Both large- and small-seed types were in landraces from Iran, Afghanistan, Pakistan, and Central Asia.
Analysis of an SNP in the PS-ID region (Rpl16-Rpl14) and size polymorphism of ccSSR7 showed that the melon
accessions consisted of three chloroplast genome types, that is, maternal lineages. Hami melon accessions were
T/338 bp type, which differed from Spanish melon and US Honey Dew (T/333 bp type), indicating a different
maternal lineage within group Inodorus. The gene diversity (D), calculated from random amplified polymorphic
DNA (RAPD) and simple sequence repeat (SSR) polymorphism, was 0.476 in 120 melon accessions; the largest
diversity was in Central Asian accessions (D = 0.377) but was low for Hami melon accessions (D = 0.243), even
though Hami melon has diverse morphological traits, earliness, and shelf life. Reflecting such small genetic
diversity, Hami melon accessions of vars. ameri and zard were grouped into cluster II, except for one accession,
by the unweighted pair group method and the arithmetic mean (UPGMA) cluster analysis. Variety chandalak
with distinct characters, such as early maturing and poor shelf life, was assigned to clusters IV and VI, indicating
inter-varietal genetic differentiation within Hami melon. Three accessions from Turkmenistan and Afghanistan,
with large seeds and T/338 bp type of chloroplast genome, were classified as cluster II with Hami melon accessions
of vars. ameri and zard. We therefore concluded that Hami melon may have been transmitted from the west. The
small-seed type melon of group Conomon grown in east China may have been introduced into China independently
of Hami melon, because it had the A/338 bp type of the chloroplast genome and was clustered distantly from Hami
melon according to nuclear genome analysis.
Key Words: chloroplast genome, Cucumis melo, genetic diversity, Hami melon, SSR.
Introduction
Melon (Cucumis melo L.) is one of the most importanthorticultural crops in China, and is cultivated in 353 kha
with a total production of 9.7 million tons a year. Chinesemelon is generally divided into two types based on thethickness of the fruit skin: thick-skinned melon isclassified as Group Inodorus or Cantalupensis amongseven horticultural groups defined by Munger andRobinson (1991), and thin-skinned melon is classifiedas Group Conomon. These two types also differ incultivation area. Thick-skinned melon is mostlyproduced in Xinjiang (Xinjiang Uyghur AutonomousRegion), and thin-skinned melon in eastern China. Bothtypes are cultivated between these two areas in Qinghai,Gansu, and Shaanxi provinces.
Received; July 5, 2010. Accepted; August 12, 2010.
This study was partly supported by a Grant-in-Aid for International
Scientific Research of Ministry of Education, Science, Culture and
Sports, Japan (No. 19255009), and JSPS Asian CORE Program. This
is Contribution number 23 from the Sato Project of Research Institute
for Humanity and Nature (RIHN), Japan.
* Corresponding author (E-mail: [email protected]).
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 53
Xinjiang is in north-west China, and is one-sixth ofChina’s national land. It has a dry continental climatewith great extremes of winter and summer temperature.Rainfall is scant, and the annual precipitation is less than500 mm in north Xinjiang and less than 100 mm in southXinjiang. It is below 40 mm in Tulufan and Hami, famousfor producing Hami melon, in the eastern part ofXinjiang. The daily fluctuation of air temperature islarge, and the average difference between day and nighttemperature is from 11.3°C to 14.8°C depending on thearea. Other important features of the climate are strongsunshine and long sunshine duration. These conditionsare advantageous for producing sweet melon. Thick-skinned melon called Hami melon (“Hami Gua” inChinese) is cultivated in 41 kha with a total productionof 1.1 million tons a year.
Local landraces of Hami melon are rich in diversity,and 101 local landraces of melon were collected inXinjiang to study melon germplasm in the 1950s and1980s (Wu, 1982). These landraces were classified asvar. cassaba Pang Greb (round fruits with three or fivecarpels, one accession), var. chandalak Pang Greb (extraearly Guadan melon, five accessions), var. ameri PangGreb (summer melon, 70 accessions), and var. zard PangGreb (winter melon, 25 accessions) (Lin, 1991). Figure 1shows photographs of typical fruits of these varieties.Var. ameri consists of early maturing and mid-seasonmaturing groups. Similarly, var. zard includes autumnmelon and late maturing winter melon groups. Thesowing time is from the end of March (south Xinjiang)to the middle of April (north Xinjiang). The harvest ofvar. chandalak starts from 10 June, and the latestmaturing winter melon (var. zard) is harvested inOctober; the fruits of var. zard are stored until May ofthe next year. Cultivation of these types facilitates theyear-round supply of Hami melon. Among these types,
var. chandalak is consumed in Xinjiang and is notexported because this type is unsuitable for long-distancetransportation because of its short shelf life. However,var. zard and the mid-season maturing group of var.ameri have a long (> six months) to moderately long(one month) shelf life and are exported as Hami melonto foreign countries, as well as to other provinces ofChina. Taking such diversification into account, Pitratet al. (2000) proposed to classify varieties cassaba andzard as var. inodorus (group Inodorus), and the varietieschandalak and ameri as independent varieties. However,the classification was primarily based on morphologicaland physiological characters, and the genetic diversitywithin each variety, and the genetic relationship betweenvarieties, has remained unclear.
In the last decade, the genetic diversity andphylogenetic relationship between various groups ofcultivated melon have been studied using analysis ofmolecular polymorphism, which can be easily detectedusing various types of DNA markers, such as randomamplified polymorphic DNA (RAPD: Dhillon et al.,2007; López-Sesé et al., 2003; Luan et al., 2008; Nakataet al., 2005; Soltani et al., 2010; Staub et al., 2000, 2004;Stepansky et al., 1999; Tanaka et al., 2007; Yi et al.,2009), simple sequence repeats (SSRs: Dhillon et al.,2007; Garcia-Mas et al., 2004; López-Sesé et al., 2002;Monforte et al., 2003; Nakata et al., 2005; Staub et al.,2000), and amplified fragment length polymorphism(AFLP: Garcia-Mas et al., 2000; Yashiro et al., 2005).These results showed distinct genetic differentiationbetween subsp. agrestis and subsp. melo, which weredefined by Pitrat et al. (2000) and Jeffrey (2001): subsp.agrestis has short hairs on the ovary and subsp. melo
has long hairs on the ovary. Seed size is also an importantcharacter to distinguish these two subspecies. Small-seedtype melon groups Conomon and Agrestis with seedlength shorter than 9 mm were classified as subsp.agrestis, and large-seed type melon groups Catalupensis,Inodorus and Flexuosus with seed length over 9 mmwere classified as subsp. melo (Akashi et al., 2002).However, the genetic differentiation between varietiesis not clear within each subspecies, and subsp. melo
accessions of groups Catalupensis, Inodorus andFlexuosus have been clustered together (López-Seséet al., 2003; Soltani et al., 2010; Stepansky et al., 1999).In contrast, the geographical variation in eachhorticultural group is often significant, as indicated byLópez-Sesé et al. (2003) who detected clear differencesbetween Spanish landraces and US-EU improvedcultivars of Inodorus, although most Inodorus accessionsanalyzed in these studies were selected from Europe andUSA, and little attention was paid to accessions fromCentral Asia and China. Although Monforte et al. (2003)analyzed one accession each of varieties chandalak andameri, these accessions were from Russia andUzbekistan, respectively. Therefore, little is known aboutthe genetic diversity and genetic structure of HamiFig. 1. Photographs of fruits of four varieties of Hami melon.
Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato54
melon, irrespective of its importance as a novel geneticresource for a wide range of shelf life, flavor, high sugarcontent, large fruit, etc. (Lin, 1991; Liu et al., 2004).
In Central Asian countries located to the west ofXinjiang, group Inodorus is mainly grown, and groupConomon vars. conomon and makuwa are mainly grownin the eastern part of China. Based on their geographicaldistribution and their similar morphological traits, suchas fruit shape and seed length, speculating that Hamimelon was introduced from Central Asia seemsreasonable. Akashi et al. (2002) also supported this ideaby indicating independent origins of Hami melon andChinese Conomon using isozyme analysis, Tanaka et al.(2006) studied the sequence polymorphism in thechloroplast genome to classify cytoplasmic types, thatis, the maternal lineage, of cultivated melon, and showedthat both Hami melon and Inodorus from Central Asiahave the same PS-ID sequence (T-type), which differedfrom that (A-type) of group Conomon. However,analysis of ccSSR markers showed contradictory results(Tanaka et al., 2006): the amplified fragment size ofccSSR7 was 333 bp in Inodorus accessions from Spain,USA, and Central Asia, and was 338 bp in Hami melonand group Conomon. These results indicated theimportance of analyzing the genetic structure of Inodorusmelon of different geographical origins to know theorigin and diversification of Hami melon.
Therefore, in this study, the genetic diversity of melonlandraces cultivated in areas from Iran to Xinjiang wasstudied using RAPD and SSR markers and chloroplastgenome markers PS-ID and ccSSR7. The geneticrelationship between melon landraces was analyzed fromDNA polymorphism data, and the origin and diversifi-cation of Hami melon are discussed.
Materials and Methods
Plant materials
This study analyzed 120 accessions of melon(C. melo), including landraces from Iran to China(Table 1, Fig. 2): 23 accessions of Hami melon fromXinjiang Uyghur Autonomous Region of China, 19accessions of small-seed type melon from eastern China(group Conomon vars. conomon and makuwa) andYunnan, 10 accessions each from Iran and Afghanistan,11 accessions from Pakistan, 17 accessions from CentralAsia (Russia, Kazakhstan, Turkmenistan, Uzbekistanand Tajikistan), and 9 accessions from Spain. Asimproved cultivars, one accession of Hami melon (X011released in 1986, Fig. 1) from Xinjiang UyghurAutonomous Region and 16 accessions from USA (var.inodorus; 8, var. cantalupensis; 8) were also used.
Also analyzed as reference accessions (RA) were‘Earl’s Favourite’, ‘Melon Cantalupo di Charentais’(group Cantalupensis), ‘Kinpyo’ (group Conomon var.makuwa) and ‘Karimori’ (group Conomon var.conomon). Accessions, ‘Kokand’, ‘Tendral o Invernalea Buccia Verde’, ‘Honey Dew’, and ‘Homegarden’ were
included as Central Asian accessions, Spanish acces-sions, US Inodorus, and US Cantalupensis, respectively,in this study, even though Tanaka et al. (2007) used themas reference accessions.
For DNA analysis, total DNA was extracted from oneplant of each accession, as described below. The 120accessions were classified into large-seed type (≥9.0 mm) and small-seed type (< 9.0 mm) based on theirseed length according to Akashi et al. (2002).
Seeds of these accessions were provided by the NorthCentral Regional Plant Introduction Station, Iowa StateUniversity (USDA-ARS), USA; National Institute ofVegetable and Tea Science (NIVTS), Japan; Institute ofPlant Genetics and Crop Plant Research (IPK), Germany.These accessions were cultivated in the field or in aglasshouse at Okayama University, Japan.
DNA extraction
Seeds were sown on filter paper and were grown at26°C in a 16 h light-8 h dark cycle at light intensity46.5 μmol·m−2·s−1. Ten-day-old seedlings were individu-ally ground in liquid nitrogen, and total DNA wasextracted using the procedure of Murray and Thompson(1980) with minor modifications.
Analysis of PS-ID and ccSSR7
As molecular markers to determine the cytoplasmictype, two chloroplast markers, SNP in the PS-ID region(Rpl16-Rpl14) and size polymorphism of ccSSR7, wereanalyzed using the same method as Tanaka et al. (2006).
The SNP (A/T) in PS-ID sequences (Nakamura et al.,1997) was analyzed using dCAPS primers. Thenucleotide sequence of each primer was: Psid2F—5'AAAAAAAAACAATTGCAGATTRAATT 3' (R = A orG) and Psid1R—5' AGCATTTAAAAGGGTCTGAGGT3'. PCR amplification was performed in a 10 μL mixturecontaining 50 ng genomic DNA, 1 μL PCR buffer(Sigma, USA: 10 mM Tris-HCl (pH 8.3), 50 mM KCl),2.5 mM MgCl2, 0.1 mM dNTP, 0.25 μM of each primerand 0.25 U Taq polymerase (Sigma, USA). Amplificationreactions were performed by using an i-Cycler (Bio-Rad,USA). The PCR cycle was: an initial denaturing step at95°C for 3 min, 35 PCR cycles at 95°C for 1 min, 52°Cfor 2 min, and 72°C for 2 min. The final extension stepwas at 72°C for 5 min. The PCR products were digestedwith Apo I (New England BioLabs, USA) and thenelectrophoresed on 3% agarose gel (GenePure LE; BMBio, Japan) at constant voltage 100 V using a horizontalgel electrophoresis system (Mupid-2; Cosmo Bio,Japan). Gels were stained with ethidium bromide andvisualized by illumination with UV light.
Another marker of the chloroplast genome, theconsensus chloroplast SSR marker, ccSSR7 (Chung andStaub, 2003), was used in this study because Tanaka etal. (2006) reported that ccSSR7 was polymorphic bydeletion of 5 bp (ATATT). The nucleotide sequence ofeach primer was: ccSSR7-F—5' CGGGAAGGGCTCG
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 55
Table 1. List of melon accessions analyzed in this study.
Accession
No.Country of origin Province/Cultivar Accession No.x Group/Varietyw Seed sizev PS-ID
ccSSR7
(bp)Clusteru
US 84 Iran Mazandaran PI 140666 — L T 338 IV
US 86 Iran Khorasan PI 140814 — L T 333 III
US 88 Iran West Azerbaijan PI 143231 — L T 333 III
US 90 Iran Esfahan PI 230185 — L T 338 Xa
US 415 Iran Kerman PI 137834 — L T 333 IV
US 417 Iran Mazandaran PI 140675 — L T 338 IV
US 422 Iran Tehran PI 211922 — L A 338 IX
US 423 Iran East Azerbaijan PI 211923 — S A 338 IX
US 425 Iran Fars PI 211942 — S A 338 IX
US 431 Iran — PI 351132 — L T 338 Ia
IPK 4 Afghanistan — CUM 254 Dudaim S, L A 338 IX
US 10 Afghanistan Balkh PI 125942 — L T 333 VIIa
US 14 Afghanistan Badakhshan PI 126050 — L T 333 IIa
US 19 Afghanistan Samangan PI 127534 — L T 338 IIa
US 21 Afghanistan Herat PI 212089 — L T 338 III
US 386 Afghanistan Takhar PI 126090 — S A 338 Xa
US 387 Afghanistan Jowzjan PI 126105 — S, L T 338 III
US 389 Afghanistan Ghazni PI 127550 — L T 338 III
US 390 Afghanistan Kabul PI 207478 — L T 338 IIa
US 392 Afghanistan Helmand PI 220515 — S T 338 VIIa
US 457 Pakistan Punjab PI 116824 — L T 338 III
US 458 Pakistan Punjab PI 123188 — S T 338 VIII
US 459 Pakistan Sind PI 124552 — L T 338 V
US 460 Pakistan Sind PI 124553 — L T 338 V
US 461 Pakistan Punjab PI 163211 — S T 338 V
US 462 Pakistan Punjab PI 217525 — S T 338 III
US 463 Pakistan Mingora PI 217945 — S T 338 VIII
US 464 Pakistan Punjab PI 218070 — S T 338 V
US 465 Pakistan Mingora PI 218071 — S T 338 V
US 466 Pakistan — PI 426629 Flexuosus S A 338 VI
US 467 Pakistan Skardu PI 532929 — L T 333 IIa
P 173 Russia, Altai region Altajskaja skorospelaja — — L T 338 VIIa
P 174 Russia, Altai region Barnaulka — — S T 338 VIIa
P 175 Russia, Ukrine Kolkhoznitsa — — L T 338 IV
US 95 Kazakhstan Imljskaja VIR 6809 PI 476342 — L T 338 Ib
US 531 Kazakhstan Alma Ata Ames 19036 — L T 338 Ib
US 119 Turkmenistan Zaami 672 VIR 40689 PI 476331 — L T 338 IIb
IPK 64 Turkmenistan — CUM 209 Agrestis S A 338 Xa
P 250 Turkmenistan — — — L A 338 VIIa
P 251 Turkmenistan — — — S A 338 VIIa
US 121 Uzbekistan Kokca 588 VIR 5149 PI 476333 — L T 333 IIc
US 122 Uzbekistan Sakor-polak 554 VIR 5883 PI 476337 — L T 333 III
P 118z Uzbekistan Kokand 930172 Inodorus L T 333 IIb
P 119 Uzbekistan Mirzuchulskaja 930177 Inodorus L T 333 IIb
P 120 Uzbekistan Ak-Urug 930190 var. ameri L T 333 IIb
IPK 61 Tajikistan Dushanbe CUM 333 — L T 333 IIc
IPK 63 Tajikistan Dushanbe CUM 334 var. chandalak L T 338 IIc
IPK 62 Tajikistan Dushanbe CUM 389 — L T 338 III
X 001 China Laoguniang — var. ameri (early maturing) L T 338 III
X 002 China Mizigua — var. ameri (early maturing) L T 338 IIa
X 003 China Kukeqi — var. ameri L T 338 IIb
X 005 China Paotaihong — var. zard L T 338 IIb
X 006 China Hongxincui — var. ameri L T 338 IIb
X 007 China Wanshudonggua — var. zard L T 338 IIb
X 008 China Kakeqie — var. ameri L T 338 IIb
X 009 China Bixiekexin — var. cassaba L T 338 IIb
X 010 China Kuche — var. ameri L T 338 IIb
X 011 China Huanghou — var. ameri L T 333 IIb
X 012 China Bawudong — var. ameri (early maturing) L T 338 IIb
X 013 China Xiekesu — var. ameri (early maturing) L T 338 IIb
X 014 China Kashi — var. ameri L T 338 IIb
X 021 China Baipicui — var. ameri (early maturing) L T 338 IIb
X 023 China Kalakusai — var. zard L T 338 IIb
X 024 China Kaernaishi — var. ameri L T 338 IIb
Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato56
Table 1. Continued.
z Reference accessions used by Tanaka et al. (2007).y Tendral; Tendral o Invernale a Buccia Verde, Charentais; Melon Cantalupo di Charentais.x Accession No. at USDA, IPK, and NIVTS.w —; Local landraces whose horticultural group/variety was not specified.v S; Small-seed type, L; Large-seed type.u Cluster number shown in Figure 6.
Accession
No.Country of origin Province/Cultivar Accession No.x Group/Varietyw Seed sizev PS-ID
ccSSR7
(bp)Clusteru
X 030 China Wangwenxiang — var. ameri (early maturing) L T 338 IIb
X 031 China Heimeimaomijigan — var. zard L T 338 IIb
X 032 China Kutuerkukeqi — var. ameri L T 338 IIb
X 043 China Huangdanzi — var. chandalak L T 338 IV
X 044 China Qingpiqingrouguadanzi — var. chandalak L T 338 VI
X 045 China Reguadan — var. chandalak L T 338 VI
X 051 China Qingpiqingroukekouqi — var. zard L T 338 IIb
X 053 China Qingpihongroukekouqi — var. zard L T 338 IIb
P 117z Spain Tendraly 950076 Inodorus L T 333 Ic
US 102 Spain Zaragoza PI 512411 — L T 333 Ic
US 103 Spain Zaragoza PI 512413 — L T 333 Ic
US 104 Spain Cadiz PI 512462 — L T 333 Ic
US 105 Spain Lerida PI 512489 — L T 333 Ic
US 106 Spain Caceres PI 512501 — S, L T 333 Ic
US 107 Spain Badajoz PI 512510 — L T 333 Ib
US 108 Spain Valencia PI 512564 — L T 333 Ic
US 109 Spain Castellon de Plana PI 512581 — S, L T 333 Ic
P 73z USA Honey Dew 940325 Inodorus L T 333 Ia
P 74 USA Honey Dew 600011 Inodorus L T 333 Ia
P 75 USA Honey Dew 610002 Inodorus L T 333 Ia
P 76 USA Honey Dew 650013 Inodorus L T 333 Ia
US 7 USA Floridew NSL 20616 Inodorus (casaba type) L T 333 Ia
US 217 USA Golden Crenshaw NSL 5647 Inodorus (casaba type) L T 338 Ib
US 218 USA Golden Beauty Casaba NSL 5659 Inodorus (casaba type) L T 338 Ib
US 221 USA Sungold Casaba NSL 5709 Inodorus (casaba type) L A 338 Ia
P 67 USA Rocky Ford 920049 Cantalupensis L T 338 VIIb
P 68z USA Homegarden 600063 Cantalupensis L T 333 VIIb
P 69 USA Georgia 47 920047 Cantalupensis L T 338 VIIb
P 72 USA #58-21 600068 Cantalupensis L T 333 VIIb
P 93 USA SC108 590034 Cantalupensis L T 338 VIIb
P 107 USA Rio Gold 600015 Cantalupensis L T 338 VIIa
P 108 USA Hales Best 600021 Cantalupensis L T 338 VIIb
P 109 USA Spicy 940326 Cantalupensis L T 333 VIIb
C 28 China Xingtangmiangua — Conomon var. makuwa S A 338 Xc
P 83 China Mi-tang-tin 910008 Conomon var. makuwa S A 338 Xb
P 142 China Damiangua 760007 Conomon var. makuwa S A 338 Xb
P 143 China Shidaodaqinggua 760008 Conomon var. makuwa S A 338 Xb
P 144 China Shilinghuangjingua 780143 Conomon var. makuwa S A 338 Xb
P 147 China Wengua 910055 Conomon var. makuwa S A 338 Xb
P 153 China Chi-86-56 940178 Conomon var. makuwa S A 338 Xb
P 155 China Qianzhong-5 940184 Conomon var. makuwa S A 338 Xb
P 208 China Chi-87-12 2000121 Conomon var. makuwa S A 338 Xc
C 32 China Heipilengzisudigua — Conomon var. conomon S A 338 Xc
P 154 China Chi-86-61 940182 Conomon var. conomon S A 338 Xb
P 158 China Qingpilürouxianggua 940307 Conomon var. conomon S A 338 Xb
P 169 China Caigua — Conomon var. conomon S A 338 Xb
P 171 China Qingpicaigua — Conomon var. conomon S A 338 Xb
CYW 37 China Yunnan — Conomon S A 338 Xd
CYW 38 China Yunnan — Conomon S A 338 Xd
CYW 49 China Yunnan — Conomon S A 338 Xd
CYW 60 China Yunnan — Conomon S A 338 Xd
CYW 61 China Yunnan — Conomon S A 338 Xd
P 62z RA UK Earl’s Favourite 900074 Cantalupensis L T 338 IIa
P 94z
RA Italy Charentaisy
910049 Cantalupensis L T 338 VIIb
P 90z RA Japan Kinpyo 920007 Conomon var. makuwa S A 338 Xc
P 130z RA Japan Karimori 940333 Conomon var. conomon S A 338 Xc
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 57
KGCAG 3' (K = T or G) and ccSSR7-R—5' GTTCGAATCCCTCTCTCTCCTTTT 3'. The PCR mixture and PCRcycle were the same as for PS-ID analysis, but annealingwas performed at 56°C for 1 min. PCR products wereelectrophoresed on 10% nondenatured polyacrylamidegel at a constant voltage of 260 V. Gels were stained asabove.
RAPD and SSR analysis
Eighteen random primers (12-mer; Bex, Japan), whichwere selected for their ability to detect polymorphismby Tanaka et al. (2007), were used in this study (Table 2).The PCR mixture was the same as for PS-ID analysis,but the concentration of primers was 0.5 μM. The PCRcycle was: an initial denaturing step at 95°C for 3 min,40 PCR cycles at 93°C for 1 min, 40°C for 2 min, and
72°C for 2 min. The final extension step was at 72°Cfor 5 min. After amplification, electrophoresis and gelstaining were performed as for PS-ID analysis, but theconcentration of agarose gel was 1.5%.
For SSR analysis, as a preliminary experiment, sizepolymorhism was examined for large-seed type melonaccessions Hami 2 (China, group Inodorus), Kokand(Uzbekistan, group Inodorus), and Melon Cantalupo diCharentais (Italy, group Cantalupensis), and a small-seedtype melon accession SUD-4 (Sudan, group Agrestis).Sixteen SSR markers showing distinct stable polymor-phism were selected among 177 SSR markers developedby Danin-Poleg et al. (2000), Akashi et al. (2001), Chibaet al. (2003), Ritschel et al. (2004), and Fukino et al.(2007). Table 3 shows details of the SSR markers used.The method for ccSSR7 analysis was used for SSRanalysis.
Data analysis
Marker bands of RAPD were scored as 1 for presentand 0 for absent. For SSR, marker fragments were scoredbased on their size from smallest (1) to largest. Fromthese data, the polymorphic index content (PIC) wascalculated according to Anderson et al. (1993). Thegenetic similarity (GS) between accessions wascalculated as described by Apostol et al. (1993), and thegene diversity (D) within each group and genetic distance(GD) among groups were calculated as described byWeir (1996) and Nei (1972), respectively. A dendrogramwas constructed using the Phylip program with theunweighted pair group method and the arithmetic mean
Table 2. Eighteen random primers used in this study, with the size of polymorphic fragments and their polymorphic
index content (PIC).
*; No polymorphism among 24 Hami melon landraces.
PIC was indicated from the larger fragment, when two or three markers were produced.
Primer number Sequence
(5' → 3')
Size of polymorphic
fragments (bp)
Polymorphic index
content (PIC)
A07 GATGGATTTGGG 970* 0.358
A20 TTGCCGGGACCA 1100*, 800* 0.219, 0.255
A22 TCCAAGCTACCA 1520* 0.255
A23 AAGTGGTGGTAT 1200 0.489
A26 GGTGAGGATTCA 1400 0.439
A31 GGTGGTGGTATC 800 0.391
A39 CCTGAGGTAACT 2027 0.499
A41 TGGTAGGTAACT 1353, 1020, 930 0.460, 0.495, 0.231
A57 ATCATTGGCGAA 800 0.460
B15 CCTTGGCATCGG 600 0.391
B32 ATCATCGTACGT 900, 700 0.193, 0.080
B68 CACACTCGTCAT 1078 0.444
B71 GGACCTCCATCG 1220 0.483
B84 CTTATGGATCCG 700, 600, 550 0.499, 0.499, 0.455
B86 ATCGAGCGAACG 1500, 1350* 0.499, 0.049
B96 CTGAAGACTATG 850, 750 0.439, 0.489
B99 TTCTGCTCGAAA 1400* 0.375
C00 GAGTTGTATGCG 1350* 0.320
Fig. 2. Map of China and neighboring countries. Countries are named
whose melon landraces were examined in this study.
Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato58
(UPGMA) method. Principal coordinate analysis (PCO:Gower, 1966) based on the genetic similarity matrix wasperformed to show multiple dimensions of each groupand the accessions in a scatter plot.
Results
Seed size
Seed size was from 4.8 mm to 16.0 mm amongaccessions, and 120 melon accessions were grouped intothe large-seed type (81 accessions) and small-seed type(35 accessions) (Table 1). The original seed samples offour accessions from Afghanistan and Spain were amixture of small and large seeds, which might reflectthe polymorphism in a farmer’s field or derive fromspontaneous hybridization in a farmer’s fields, and thus
they could not be grouped into the large- or small-seedtype. As expected, accessions of Hami melon, USInodorus, and US Cantalupensis were all large-seed type,and all accessions of Conomon from China and Japanwere small-seed type. However, both large- and small-seed types were in landraces from Iran, Afghanistan,Pakistan, and Central Asia.
PS-ID and ccSSR7 of chloroplast genome
Based on the SNP in the PS-ID region (Rpl16-Rpl14),120 melon accessions were grouped as A-type (31accessions) and T-type (89 accessions) (Tables 1 and 4).T-type accessions were further divided into two groupsby the size polymorphism of ccSSR7: 338 bp type (59accessions) and 333 bp type (30 accessions). All A-type
Table 3. Primer sequences of 16 SSR markers used in this study, with the expected size of PCR products and their polymorphic index content (PIC).
*; No polymorphism among 24 Hami melon landraces.
Marker F primer (5' → 3') R primer (5' → 3')Expected fragment
size (bp)
Polymorphic index
content (PIC)
ACS2-ms1 TCTTTTGTTCTTGGTTGTGAGT GATTGCTTTATTTTGAATCTTTTG 200 0.892
CMBR 2 TGCAAATATTGTGAAGGCGA ATCCCCACTTGTTGGTTTG 114 0.839
CMBR 12 ACAAACATGGAAATAGCTTTCA GCCTTTTGTGATGCTCCAAT 134 0.651
CMBR 22 TCCAAAACGACCAAATGTTCC ATACAGACACGCCTTCCACC 177 0.724
CMBR 53 GCCTTTTGTGATGCTCCAAT AAACAAACATGGAAATAGCTTTCA 134 0.607
CMBR 83 CGGACAAATCCCTCTCTGAA GAACAAGCAGCCAAAGACG 142 0.595
CMBR 105 TGGTAAGCATTTTGAAATCACTTTT TTCCAGACATCTAAAGGCATTG 139 0.673
CMBR 120 CTGGCCCCCTCCTAAACTAA CAAAAAGCATCAAAATGGTTG 167 0.582
CMN 04-03* ATCACAGAGACCGCCAAAAC GGTTGAAGATTGCGCTTGAT 218 0.575
CMN 04-07 GAAAGCATTAAATATGGCATTGG AAGCTTAACAGCTTCCAGGG 286 0.771
CMN 04-40 CACCTGACGATAGGGGTGTT AGTATTCGGGTTGGCAAAAA 212 0.552
CMN 08-22* CATCCTCCTCATCCTCCTCA ACGGATGAATCGGAACTTCA 223 0.406
CMN 08-90* CCACGCCCTCTATACCCATA GGGACTGTTGGGTTTTCTGA 210 0.341
CMN 21-41 GAGGAAATTTTGGAGTTTTTCAA TTCCAGACATCTAAAGGCATTG 281 0.527
CMN 22-16 CAGAGGAGGTGGAACTAACCA CCATTTTCAACCTCCCAAGA 233 0.609
CMN 61-44 TGTTGGAGTTTAATGAGGAAGGA AGAGAAGATGAATGGGGCAC 233 0.901
Table 4. Variation of chloroplast genome type among melon accessions with different geographical origin.
z Reference accessions (RA).y Chloroplast genome type was indicated by the combination of PS-ID SNP and ccSSR7, like A/338.x For accessions with large and small seeds mixed in original seed sample, the count was divided into large- and small-seed types.
Area/Group No. of
accessions
Large-seed type Small-seed type
A/338y T/338y T/333y Total A/338y T/338y T/333y Total
Iran 10 1 4 3 8 2 — — 2
Afghanistan 10 0.5x 4.5x 2 7 1.5x 1.5x — 3
Pakistan 11 — 3 1 4 1 6 — 7
Central Asia 17 1 7 6 14 2 1 — 3
Hami melon 24 — 23 1 24 — — — 0
Spain 9 — — 8 8 — — 1 1
US Inodorus 8 1 2 5 8 — — — 0
US Cantalupensis 8 — 5 3 8 — — — 0
Chinese Conomon 19 — — — 0 19 — — 19
RAz 4 — 2 — 2 2 — — 2
Total 120 3.5 50.5 29 83 27.5 8.5 1 37
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 59
accessions were 338 bp type. As a result, the 120 melonaccessions were classified into three cytoplasmic types(Table 4) by analysis of PS-ID and ccSSR7.
The frequency of the three cytoplasmic types differedbetween large- and small-seed types (χ2
= 65.97, df = 2,P < 0.01). Large-seed type accessions consisted mostlyof cytoplasmic types T/338 bp type and T/333 bp type.All accessions of Spanish melon and US Honey Dewwere T/333 bp type. Hami melon accessions wereT/338 bp type, except X011, showing a difference inmaternal lineage within group Inodorus, as well asbetween Hami melon and Chinese Conomon.
RAPD analysis
Eighteen primers provided 26 polymorphic markerbands of approximately 550–2027 bp in size, and theaverage number of marker bands produced by eachprimer was 1.44 (Table 2). Most polymorphic bands wereproduced by primers A39 and B84 (Fig. 3A), and theirmarker bands of 2027 bp and 700 bp (A39-2027 andB84-700, respectively) were amplified in 63 accessionsamong 120 melon accessions. They were followed bymarkers B84-600 and B86-1500, which were amplifiedin 58 and 62 accessions, respectively. In contrast, theleast polymorphic band was produced by primer B86,whose marker band of 1350 bp was amplified in 117accessions. Hami melon accessions were monomorphicfor seven markers (Table 2, asterisk).
The gene diversity was 0.376 for 120 melonaccessions, of which the largest diversity was for Iranaccessions (D = 0.288), except RA, followed by acces-sions of neighboring countries, such as Afghanistan,Pakistan, and Central Asia (Table 5). However, D waslow for Hami melon accessions (D = 0.194), which wassimilar to accessions of US Cantalupensis and ChineseConomon, indicating rather small genetic variations in
Hami melon, even though its morphological andphysiological traits are diverse.
SSR analysis
A total of 114 polymorphic marker bands wereamplified from 120 melon accessions using 16 primersets. The average number of polymorphic bands of eachprimer set, which was considered to represent the numberof alleles, was 7.13, and ranged from two (CMN 08-22)to 17 (CMN 61-44 and ACS2-ms1). The mostpolymorphic marker was CMN 61-44 (PIC = 0.901),followed by ACS2-ms1 (PIC = 0.892) (Fig. 3B). The leastpolymorphic marker was CMN 08-90 (PIC = 0.341),followed by CMN 08-22 (PIC = 0.406). Hami melonaccessions were monomorphic for three markers(Table 3, asterisk).
The gene diversity was 0.640 for 120 melonaccessions, and the largest diversity was for CentralAsian accessions (D = 0.522), followed by accessionsfrom neighboring countries, such as Iran, Afghanistan,and Pakistan (Table 5). However, D was low for Hamimelon accessions (D = 0.323), which was similar toSpanish and US Inodorus accessions. This result alsoindicated rather small genetic variations in Hami melon.
Analysis by combined RAPD and SSR
The gene diversity calculated by combining RAPDand SSR data was 0.476 for 120 melon accessions, andthe largest diversity was observed for Central Asianaccessions (D = 0.377), except RA, followed byaccessions from neighboring countries, such as Iran,Afghanistan, and Pakistan (Table 5). However, it waslow for Hami melon accessions (D = 0.243).
The GD between nine melon populations wascalculated from the frequency of RAPD and SSR markerbands in each population. The GD from Hami melonwas 0.089 (Central Asia) to 0.997 (Chinese Conomon)(Table 6). The genetic relationship between populations
Fig. 3. Polymorphism among melon landraces studied. (A) Random
amplified polymorphic DNA (RAPD) with B84 primer on 1.5%
agarose gel. (B) Simple sequence repeat (SSR) with primer
ACS2-ms1 on 10% nondenatured polyacrylamide gel. Arrows
show polymorphic bands. Lane M, 100 bp DNA ladder marker.
Table 5. Gene diversity within each population, calculated from
RAPD and SSR data, singly or combined.
z Reference accessions (RA).
Area/GroupNo. of
accessions
Gene diversity
RAPD SSR SSR + RAPD
Iran 10 0.288 0.518 0.376
Afghanistan 10 0.278 0.491 0.360
Pakistan 11 0.275 0.487 0.355
Central Asia 17 0.287 0.522 0.377
Hami melon 24 0.194 0.323 0.243
Spain 9 0.156 0.330 0.222
US Inodorus 8 0.147 0.338 0.219
US Cantalupensis 8 0.197 0.371 0.263
Chinese Conomon 19 0.182 0.373 0.255
RAz 4 0.293 0.516 0.378
All accessions 120 0.376 0.640 0.476
Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato60
was visualized using UPGMA cluster analysis and PCOanalysis. Cluster I consisted of Chinese Conomon, whichis related distantly to other populations (Fig. 4). ClusterII was US Cantalupensis. Hami melon formed clusterIII together with landraces from Pakistan, Iran,Afghanistan, and Central Asia. Spanish accessions andUS Inodorus were classified as cluster IV. The geneticrelationship indicated by cluster analysis was clearlyreproduced on a PCO plot of the 1st and 3rd principalcoordinates that explained 57.3% and 9.8% of totalvariance, respectively (Fig. 5).
Genetic relationship among melon accessions
The GD between the 120 melon accessions wascalculated from the RAPD and SSR data. The averageGD was 0.480 and ranged from 0.024 to 0.881 (data notshown). The largest GD was recorded between US121(Uzbekistan) and P158 (Chinese Conomon). Thesmallest GD was between accession pairs X010 andX024 (Hami melon), CYW60 and CYW61 (Yunnan),and P74 and P76 (US Honey Dew). The GD, calculatedby combining the RAPD and SSR data, related to thosecalculated singly from RAPD data (r = 0.950, P < 0.01)and from SSR data (r = 0.895, P < 0.01). The correlationcoefficient between the GDs calculated singly fromRAPD and SSR data was 0.711 (P < 0.01).
To determine the genetic relationship between melonlandraces, a dendrogram was constructed based on GDvalues calculated by combining RAPD and SSR data(Fig. 6). The 120 accessions were grouped into 10 major
clusters. Four of these clusters were further divided into12 subclusters. Table 7 summarizes the number of melonaccessions classified into each cluster and subcluster.
Cluster I was divided into three subclusters, mostlyof US Inodorus and Spanish accessions. Cluster II wasalso divided into three subclusters; 20 of 24 Hami melonaccessions were classified in this cluster, together withlandraces from Afghanistan, Pakistan, and Central Asia.Nineteen accessions of Hami melon, of var. ameri, var.zard, or var. cassaba, were grouped in subcluster IIb,which also included one accession of Turkmenistan(T/338 bp type) and three accessions of Uzbekistan(T/333 bp type). Interestingly, reference accession ‘Earl’sFavourite’ was grouped into subcluster IIa, even thoughthis is a famous Japanese cultivar of Cantalupensis, theremaining accessions of which were grouped in clusterVII. Clusters III to VI included melon landraces fromIran, Afghanistan, Pakistan, and Central Asia. Fouraccessions of Hami melon were also classified in theseclusters; three of the four were var. chandalak. ClusterVII was also divided into two subclusters. AllCantalupensis accessions, except ‘Earl’s Favorite’, weregrouped in this cluster together with landraces fromCentral Asia and Afghanistan. Clusters VIII waslandraces from Pakistan and cluster IX was landraces
Table 6. Genetic distance between nine populations of melon of different geographical origin, calculated from RAPD and SSR analysis.
Area/Group Iran Afghanistan Pakistan Central Asia Hami melon SpainUS
Inodorus
US
Cantalupensis
Afghanistan 0.086 —
Pakistan 0.130 0.110 —
Central Asia 0.124 0.086 0.130 —
Hami melon 0.195 0.153 0.182 0.089 —
Spain 0.203 0.196 0.236 0.146 0.155 —
US Inodorus 0.182 0.206 0.250 0.142 0.183 0.146 —
US Cantalupensis 0.252 0.261 0.243 0.252 0.389 0.421 0.313 —
Chinese Conomon 0.606 0.744 0.669 0.815 0.997 1.036 0.996 0.581
Fig. 4. Genetic relationship between nine melon populations, shown
by UPGMA cluster analysis based on the GD.
Fig. 5. Distribution on the first and third principal coordinates of
nine melon groups.
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 61
Fig. 6. Genetic relationship between 120 melon accessions, including 24 accessions of Hami melon, shown by UPGMA cluster analysis based
on genetic distance calculated from RAPD and SSR. Table 1 explains the accession numbers within each cluster and subcluster.
Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato62
from Iran and one accession of group Dudaim fromAfghanistan. Cluster X related distantly to other clusterswas divided into four subclusters, among which twosubclusters (Xb and Xc) comprised Chinese and Japaneseaccessions of Conomon vars. conomon and makuwa.Subcluster Xd consisted of Conomon accessions fromYunnan. Subcluster Xa included landraces from Iran,Turkmenistan, and Afghanistan.
Discussion
To show the genetic diversity of Hami melon, 16 SSRmarkers and 26 RAPD markers were used in this study.The gene diversity detected by SSR and RAPD analyseswas 0.640 and 0.376, respectively, for 120 melonaccessions (Table 5). The GD between melon accessionsalso differed depending on the marker system used. TheGD averaged 0.646 (SSR) and 0.379 (RAPD), and thevariation was 0.037 for SSR and 0.029 for RAPD (datanot shown). Such differences depending on the markersystem were also reported by Staub et al. (2000) andNakata et al. (2005), indicating that the ability of SSRmarkers to discriminate was better than that of RAPDmarkers. Polymorphism was successfully detected in allnine melon populations by five markers (CMN 04-07,CMN 61-44, CMBR 2, CMN 04-40, CMN 21-41) amongthe 16 SSR markers used (data not shown). For the firstthree markers especially, PIC was high and over 0.771(Table 3). These five SSR markers are useful for diversityanalysis of melon. Although SSR markers, CMBR 22,CMBR 83, CMBR 105, ACS2-ms1, and CMBR 53, werealso highly polymorphic, the first three markers weremonomorphic in US Cantalupensis, and the last twomarkers were monomorphic in Chinese Conomon.ACS2-ms1 was developed to detect the repeat numberpolymorphism of (TA) in the 5' flanking region of CMe-
ACS2 (Akashi et al., 2001). The amplicon size of ChineseConomon seemed unique and the same size of fragmentwas amplified only from two accessions from Iran andone accession from Afghanistan; thus, this could be used
as a unique marker for small-seed type melon from EastAsia.
Although the ability of SSR to discriminate was higherthan that of RAPD, RAPD markers A41-1353, A41-1020, B68-1078, and B71-1220 were also polymorphicin all nine populations. RAPD markers B84-700 andB84-600 were polymorphic in eight populations, exceptChinese Conomon, and in B86-1500, except USCantalupensis. For these seven RAPD markers, the PICwas from 0.444 to 0.499 (Table 2). The 18 RAPD primersused in this study were strictly selected from 176 primers,based on their ability to detect polymorphism and thestability of PCR amplification by Tanaka et al. (2007).The strictness of their selection can be seen in this studyfrom the small number of marker bands of each primer(1.44), similar to 1.69 of Mliki et al. (2001) and muchsmaller than 11.22 of Dhillon et al. (2007).
Among the melon accessions studied, ChineseConomon should be classified as C. melo ssp. agrestis
and the others as C. melo ssp. melo according to theclassification of Pitrat et al. (2000) and Jeffrey (2001).Figures 4 and 5 clearly show the genetic differentiationbetween these subspecies, as already reported byStepansky et al. (1999) and Monforte et al. (2003). Thesetwo figures also show a close relationship betweenSpanish accessions and US Inodorus, which was ratherdistantly related to US Cantalupensis. AlthoughCantalupensis (Galia type) and Inodorus (Cassaba, Pielde Sapo, and Tendral types) are grown in Spain (López-Sesé et al., 2002), Galia type was not included in theSpanish accessions examined here and thus should beclassified as group Inodorus. Therefore, Figures 4 and 5also successfully show a close relationship within groupInodorus of members of different geographical origin.These results show the usefulness of the RAPD and SSRmarker sets used in this study for diversity andphylogenetic analyses of melon, as well as for cultivaridentification.
We believe this is the first study of the genetic diversity
Table 7. Number of melon accessions classified into 10 clusters, in each melon population.
z Reference accessions (RA).
Area/GroupNo. of
accessions
Cluster
Ia Ib Ic IIa IIb IIc III IV V VI VIIa VIIb VIII IX Xa Xb Xc Xd
Iran 10 1 – – – – – 2 3 – – – – – 3 1 – – –
Afghanistan 10 – – – 3 – – 3 – – – 2 – – 1 1 – – –
Pakistan 11 – – – 1 – – 2 – 5 1 – – 2 – – – – –
Central Asia 17 – 2 – – 4 3 2 1 – – 4 – – – 1 – – –
Hami melon 24 – – – 1 19 – 1 1 – 2 – – – – – – – –
Spain 9 – 1 8 – – – – – – – – – – – – – – –
US Inodorus 8 6 2 – – – – – – – – – – – – – – – –
US Cantalupensis 8 – – – – – – – – – 1 7 – – – – – –
Chinese Conomon 19 – – – – – – – – – – – – – – – 11 3 5
RAz 4 – – – 1 – – – – – – – 1 – – – – 2 –
Total 120 7 5 8 6 23 3 10 5 5 3 7 8 2 4 3 11 5 5
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 63
of Hami melon analyzed using RAPD and SSR markers.The gene diversity of Hami melon (D = 0.243) wassimilar to the D of Spanish accessions, US Cantalupensis,and Chinese Conomon, and was smaller than the D oflandraces from Iran to Central Asia (Table 5). The genediversity in each variety of Hami melon was even smallerat 0.186 in var. ameri, 0.160 in var. zard, and 0.201 invar. chandalak (data not shown). Hami melon landracesof these varieties shared an identical chloroplast genometype (T/338 bp), while an improved cultivar of Hamimelon (X011, Fig. 1), bred by crossing with foreigngermplasm, had a different chloroplast genome type(T/333 bp) (Table 4). Therefore, the genetic variation ofHami melon was rather small, even though Hami melonconsisted of different varieties (chandalak, ameri, zard,cassaba) with diverse morphological traits, earliness,and fruit shelf life (Lin, 1991).
Figure 6 clearly shows the genetic relationship anddifferentiation between Hami melon varieties. Hamimelon accessions of vars. ameri and zard were mostlygrouped as subcluster IIb, but those of var. chandalak
as clusters IV and VI. The GD calculated between eachpair of ameri accessions and zard accessions averaged0.210, but it was 0.409 between three accessions of var.chandalak and 20 accessions of vars. ameri and zard
(data not shown). These results clearly indicated thatvar. chandalak was rather distantly related to vars. ameri
and zard, which were closely related to each other. Var.chandalak is early maturing and is grown mainly forlocal consumption because of its poor shelf life (oneweek). Var. ameri consists of early and mid-seasonmaturing groups (Lin, 1991). The fruit shelf life alsodiffers, at approximately two weeks and one month,respectively. The mid-season maturing group of var.ameri, as well as of var. zard, whose shelf life is overone month, are commonly grown for export to easternChina and other countries as Hami melon. Theseaccessions with a long shelf life were grouped intosubcluster IIb (Table 1, Fig. 6), indicating their closerelationship. Therefore, we suggest that not only var.zard but also the mid-season maturing group of var.ameri should be classified as Inodorus, even thoughPitrat et al. (2000) did not include var. ameri as Inodorus.The fruit shelf life of the early maturing group of var.ameri is 1–2 weeks, and two of six accessions weregrouped into clusters IIa and III, not into IIb (Table 1,Fig. 6). Similar variation of shelf life, from two weeksto three months, is also known in var. ameri of Uzbekmelon (Mavlyanova et al., 2005). Therefore, theclassification of var. ameri should be reconsidered.
The genetic diversity between Chinese melonlandraces has been studied in the last decade. Based onisozyme variation, Akashi et al. (2002) indicated distinctgenetic differentiation between the large-seed type,including Hami melon, and the small-seed typecultivated in eastern China. RAPD analysis has indicatedgenetic differentiation between thick-skinned and thin-
skinned Chinese melon (Luan et al., 2008). Thick-skinned melon accessions correspond to either Inodorusor Cantalupensis, and thin-skinned accessions corre-spond to Conomon. However, only one accession ofthick-skinned melon from Xinjiang was studied by Luanet al. (2008), and thus the genetic relationship betweenHami melon and melon accessions from other areasremains unknown. In this study, genetic differentiationbetween Hami melon and Conomon of eastern Chinawas clearly indicated (Table 6, Fig. 4). Analysis of thechloroplast genome type showed that Hami melon(T/338 bp type) and Conomon (A/338 bp type) belongto different maternal lineages (Table 4).
In the case of melon accessions of Central Asia,varieties chandalak, ameri, zard, cassaba, bucharica,and gurvak are grown in Uzbekistan (Mavlyanova et al.,2005). Figures 4 and 5, based on the genetic distanceshown in Table 4, show that Hami melon is relatedclosely to melon landraces of areas from Iran to CentralAsia. Large-seed type melon accessions sharing the samematernal lineages as Hami melon (T/338 bp type) werein Central Asia (Table 4), even though Tanaka et al.(2006) reported only the T/333 bp type. The T/338 bptype was distributed frequently from Iran to Central Asia(Table 4), and several accessions, such as US 119(Turkmenistan, subcluster IIb), US 19, US 390 (bothAfghanistan, subcluster IIa), were closely related toHami melon (vars. ameri and zard) by analysis of thenuclear genome (Table 1, Fig. 6). We therefore concludedthat Hami melon may have been transmitted from thewest along the so-called “Silk Road.”
Another interesting conclusion was deduced about theorigin of ‘Earl’s Favourite’, which is the leading breedof Japanese Cantalupensis melon. This cultivar wasimported from the UK in 1925. Among Cantalupensisaccessions imported from France and the UK, only‘Earl’s Favourite’ adapted to the Japanese growingconditions and it was selected as one of the sweetest.Although the mature fruit is less fragrant, this cultivarhas a good shelf life and has been intensively used as across parent for melon breeding. In this study, ‘Earl’sFavourite’ was used as a reference accession of groupCantalupensis, and was expected to show a closerelationship to accessions of US Cantalupensis. ‘Earl’sFavourite’ had an identical chloroplast genome type toUS Cantalupensis (T/338 bp type) (Tables 1 and 4).However, they were classified as distant subclusters, IIa(‘Earl’s Favourite’) and VIIb (US Cantalupensis), byanalysis of nuclear genome markers (Table 1, Fig. 6).Cluster II consisted of vars. ameri and zard of Hamimelon and landraces from Iran to Central Asia. Wetherefore suggest that ‘Earl’s Favourite’ might beselected from the hybrid of Inodorus melon from Iranto Xinjiang and European Cantalupensis melon, eventhough no information is available about the origin ofthis cultivar.
Y. Aierken, Y. Akashi, P.T.P. Nhi, Y. Halidan, K. Tanaka, B. Long, H. Nishida, C. Long, M.Z. Wu and K. Kato64
Acknowledgments
We would like to thank Dr. Y. Sakata, NationalInstitute of Vegetable and Tea Science (NIVTS), Japan,Dr. K. R. Reitsma, Iowa State University, USA, andDr. A. Graner, Leibniz Institute of Plant Genetics andCrop Plant Research (IPK), Germany, for kindlysupplying the seeds, and Dr. N. Fujishita for his kindencouragement throughout this study.
Literature Cited
Akashi, Y., N. Fukuda, T. Wako, M. Masuda and K. Kato. 2002.
Genetic variation and phylogenetic relationships in East and
South Asian melon, Cucumis melo L., based on the analysis
of five isozymes. Euphytica 125: 385–396.
Akashi, Y., S. Shiomi, Y. Kubo, M. Masuda and K. Kato. 2001.
Microsatellite and CAPS markers for ethylene-related genes,
1-Aminocyclopropane-1-Carboxylic Acid (ACC) synthase
and ACC Oxidase genes, and their variation in melon
(Cucumis melo L.). Breed. Sci. 51: 107–112.
Anderson, J. A., G. A. Churchill, J. E. Autrique, S. D. Tanksley
and M. E. Sorrells. 1993. Optimizing parental selection for
genetic-linkage maps. Genome 36: 181–186.
Apostol, B. L., W. C. I. V. Black, B. R. Miller, P. Reiter and B. J.
Beaty. 1993. Estimation of the number of full sibling families
at an oviposition site using RAPD-PCR markers: applications
to the mosquito Aedes aegypti. Theor. Appl. Genet. 86: 991–
1000.
Chiba, N., K. Suwabe, T. Nunome and M. Hirai. 2003.
Development of microsatellite markers in melon (Cucumis
melo L.) and their application to major Cucurbit crops. Breed.
Sci. 53: 21–27.
Chung, S. M. and J. E. Staub. 2003. The development and
evaluation of consensus chloroplast primer pairs that possess
highly variable sequence regions in a diverse array of plant
taxa. Theor. Appl. Genet. 107: 757–767.
Danin-Poleg, Y., N. Reis, S. Baudracco-Arnas, M. Pitrat, J. E.
Staub, M. Oliver, P. Arus, C. M. deVicente and N. Katzir.
2000. Simple sequence repeats in Cucumis mapping and map
merging. Genome 43: 963–974.
Dhillon, N. P. S., R. Ranjana, K. Singh, I. Eduardo, A. J. Monforte,
M. Pitrat, N. K. Dhillon and P. P. Singh. 2007. Diversity
among landraces of Indian snapmelon (Cucumis melo var.
momordica). Genet. Resour. Crop. Evol. 54: 1267–1283.
Fukino, N., Y. Sakata, M. Kunihisa and S. Matsumoto. 2007.
Characterisation of novel simple sequence repeat (SSR)
markers for melon (Cucumis melo L.) and their use for
genotype identification. J. Hort. Sci. Biotech. 82: 330–334.
Garcia-Mas, J., A. J. Monforte and P. Arus. 2004. Phylogenetic
relationships among Cucumis species based on ribosomal
internal transcribed spacer region. Plant Sys. Evol. 248: 191–
203.
Garcia-Mas, J., M. Oliver, H. Gomez-Paniagua and M. C. de
Vicente. 2000. Comparing AFLP, RAPD and RFLP markers
for measuring genetic diversity in melon. Theor. Appl. Genet.
101: 860–864.
Gower, J. C. 1966. Some distance properties of latent root and
vector methods used in multivariate analysis. Biometrika 53:
325–338.
Jeffrey, C. 2001. Cucurbitaceae. p. 1510–1557. In: P. Hanelt and
Institute of Plant Genetics and Crop Plant Research (eds.).
Mansfeld’s Encyclopedia on Agricultural and Horticultural
Crops. Springer, Berlin-Heidelberg-New York.
Lin, D. P. 1991. Classification of melon, p. 9–21. In: S. K. Qi,
D. K. Wu and D. P. Lin (eds.). Chinese Melon. Popular
Science Press, Beijing (In Chinese).
Liu, L., F. Kakihara and M. Kato. 2004. Characterization of six
varieties of Cucumis melo L. based on morphological and
physiological characters, including shelf-life of fruit.
Euphytica 135: 305–313.
López-Sesé, A. I., J. E. Staub and M. L. Gómez-Guillamón. 2003.
Genetic analysis of Spanish melon (Cucumis melo L.)
germplasm using a standardized molecular-marker array and
geographically diverse reference accessions. Theor. Appl.
Genet. 108: 41–52.
López-Sesé, A. I., J. E. Staub, N. Katzir and M. L. Gómez-
Guillamón. 2002. Estimation of between and within accession
variation in selected Spanish melon germplasm using RAPD
and SSR markers to assess strategies for large collection
evaluation. Euphytica 127: 41–51.
Luan, F., I. Delannay and J. E. Staub. 2008. Chinese melon
(Cucumis melo L.) diversity analyses provide strategies for
germplasm curation, genetic improvement, and evidentiary
support of domestication patterns. Euphytica 164: 445–461.
Mavlyanova, R., A. Rustamov, R. Khakimov, A. Khakimov, M.
Turdieva and S. Padulosi. 2005. Melons of Uzbekistan.
IPGRI’s Sub-regional office for Central Asia, Tashkent.
Mliki, A., J. E. Staub, Z. Y. Sun and A. Ghorbel. 2001. Genetic
diversity in melon (Cucumis melo L.): An evaluation of
African germplasm. Genet. Resour. Crop Evol. 48: 587–597.
Monforte, A. J., J. Garcia-Mas and P. Arús. 2003. Genetic
variability in melon based on microsatellite variation. Plant
Breed. 122: 153–157.
Munger, H. M. and R. W. Robinson. 1991. Nomenclature of
Cucumis melo L. Cucurbit Genet. Coop. Rep. 14: 43–44.
Murray, G. C. and W. F. Thompson. 1980. Rapid isolation of high
molecular weight DNA. Nucl. Acids Res. 8: 4321–4325.
Nakamura, I., N. Kameya, Y. Kato, S. I. Yamanaka, H. Jomori
and Y. Sato. 1997. A proposal for identifying the short ID
sequence which addresses the plastid subtype of higher plants.
Breed. Sci. 47: 385–388.
Nakata, E., J. E. Staub, A. I. López-Sesé and N. Katzir. 2005.
Genetic diversity of Japanese melon cultivars as assessed by
random amplified polymorphic DNA and simple sequence
repeat markers. Genet. Resour. Crop Evol. 52: 405–419.
Nei, M. 1972. Genetic distance between populations. Am. Nat.
106: 283–292.
Pitrat, M., P. Hanelt and K. Hammer. 2000. Some comments on
intraspecific classification of cultivars of melon. Proc.
Cucurbitaceae: 29–36.
Ritschel, P. S., T. C. L. Lins, R. L. Tristan, G. S. C. Buso, J. A.
Buso and M. E. Ferreira. 2004. Development of microsatellite
markers from an enriched genomic library for genetic analysis
of melon (Cucumis melo L.). BMC Plant Biol. 4: 9.
Soltani, F., Y. Akashi, A. Kashi, Z. Zamani, Y. Mostofi and K.
Kato. 2010. Characterization of Iranian melon landraces of
Cucumis melo L. Groups Flexuosus and Dudaim by analysis
of morphological characters and random amplified polymor-
phic DNA. Breed. Sci. 60: 34–45.
Staub, J. E., Y. Danin-Poleg, G. Fazio, T. Horejsi, N. Reis and N.
Katzir. 2000. Comparative analysis of cultivated melon
groups (Cucumis melo L.) using random amplified
polymorphic DNA and simple sequence repeat markers.
Euphytica 115: 225–241.
Staub, J. E., A. I. López-Sesé and N. Fanourakis. 2004. Diversity
among melon landraces (Cucumis melo L.) from Greece and
their genetic relationship with other melon germplasm of
diverse origins. Euphytica 136: 151–166.
Stepansky, A., I. Kovalski and R. Perl-Treves. 1999. Intraspecific
J. Japan. Soc. Hort. Sci. 80 (1): 52–65. 2011. 65
classification of melons (Cucumis melo L.) in view of their
phenotypic and molecular variation. Plant Sys. Evol. 217:
313–332.
Tanaka, K., K. Fukunaga, Y. Akashi, H. Nishida, K. Kato and
M. T. Khaing. 2006. Polyphyletic origin of cultivated
melon inferred from analysis of its chloroplast genome.
Cucurbitaceae 2006: 372–379.
Tanaka, K., A. Nishitani, Y. Akashi, H. Nishida, H. Yoshino and
K. Kato. 2007. Molecular characterization of South and East
Asian melon, Cucumis melo L., and the origin of group
Conomon var. makuwa and var. conomon revealed by RAPD
analysis. Euphytica 153: 233–247.
Weir, B. S. 1996. Genetic data analysis II. Sinauer Associate Inc.
Publisher, Massachusetts.
Wu, M. Z. 1982. Genetic resources of thick-skinned melon
collected from Turpan Depression and their utilization. China
Fruits 1982: 28–33 (In Chinese).
Yashiro, K., H. Iwata, Y. Akashi, K. Tomita, M. Kuzuya, Y.
Tsumura and K. Kato. 2005. Genetic relationship among East
and South Asian melon (Cucumis melo L.) revealed by AFLP
analysis. Breed. Sci. 55: 197–206.
Yi, S. S., Y. Akashi, K. Tanaka, T. T. Cho, M. T. Khaing, H.
Yoshino, H. Nishida, T. Yamamoto, K. Win and K. Kato.
2009. Molecular analysis of genetic diversity in melon
landraces (Cucumis melo L.) from Myanmar and their
relationship with melon germplasm from East and South Asia.
Genet. Resour. Crop Evol. 56: 1149–1161.