Modulation of

Enterohemorrhagic Escherichia coli

Virulence by the Global Regulator

System

Jong-Chul Kim

The Graduate School

Yonsei University

Department of Biomedical

Laboratory Science

Modulation of

Enterohemorrhagic Escherichia coli

Virulence by the Global Regulator

System

A Dissertation

Submitted to the Department of Biomedical

Laboratory Science and the Graduate School of

Yonsei University

in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy

Jong-Chul Kim

December 2008

This certifies that the dissertation of Jong-Chul Kim is approved.

Thesis Supervisor : Jong-Bae Kim

Yong-Suk Ryang : Thesis Committee Member

Ok-Doo Awh : Thesis Committee Member

Bok-Kwon Lee : Thesis Committee Member

Kwan-Hee Yoo : Thesis Committee Member

The Graduate School

Yonsei University

December 2008

“ But he knows the way that I take; when he has

tested me, I will come forth as gold.”

(Job 23: 10)

iii

CONTENTS

LIST OF FIGURES AND TABLES------------------------------------------ix

ABBREVIATION--------------------------------------- -----------------------xvi

ABSTRACT IN ENGLISH---------------------------------------------------xxi

CHAPTER I. Epidemiologic and molecular research on shiga

toxin-producing Escherichia coli isolated in Korea---------------------1

1. INTRODUCTION---------------------------------------------------2

2. MATERIALS AND METHODS--------------------------------10

STEC strains isolated from stool specimen-------------------10

Bacterial strains and culture condition for enterohemolysin

expression----------------------------------------------------------10

Detection of virulence genes by PCR--------------------------11

iv

Reversed-passive latex agglutination (RPLA) test for the

detection of Shiga toxin------------------------------------------12

Serotyping of O antigen------------------------------------------12

Antimicrobial susceptibility test--------------------------------13

Pulsed-field gel electrophoresis for STEC O157 strains----14

3. RESULTS------------------------------------------------------------16

Prevalence of STEC isolates------------------------------------16

Serotypes of STEC isolates--------------------------------------17

Stx genes and toxin production---------------------------------24

Charaterization of adherence genes----------------------------24

Resistance of antibiotics-----------------------------------------25

Relationship between hemolysin type and human patients

with manifestation------------------------------------------------32

PFGE pattern of STEC O157 isolates--------------------------37

4. DISCUSSION----------------------------------------------------------39

v

CHAPTER II. LuxS mediated quorum sensing and expression of

virulence in Escherichia coli O157:H7-----------------------------------50

1. INTRODUCTION--------------------------------------------------51

2. MATERIALS AND METHODS--------------------------------58

Bacteria and growth conditions---------------------------------58

Construction of an E. coli O157:H7 luxS mutant strain-----58

Construction of complemented strain with pEXEP5-CT----59

Growth curves-----------------------------------------------------59

Motility assays----------------------------------------------------60

RNA preparation--------------------------------------------------60

cDNA microarray-------------------------------------------------61

Data analysis------------------------------------------------------62

Transmission electron microscopic analysis (TEM)-------- 62

Cell adherence assay---------------------------------------------63

Amplification of LEE genes by reverse transcriptase real

vi

ime PCR------------------------------------------------------------63

Cytotoxicity assays-----------------------------------------------65

Determina t ion of cyto ly t ic act i v i t y for human

erythrocytes--------------------------------------------------------65

3. RESULTS------------------------------------------------------------67

Identification of luxS from clinical isolate EHEC strain----67

Growth and utilization of carbohydrates----------------------72

Influence of luxS mutation on swarming motility in EHEC

strain----------------------------------------------------------------75

Morphological analysis of flagella-----------------------------75

Adherence assays-------------------------------------------------76

Overview of microarray analysis-------------------------------82

Regulation by luxS/QS of the EHEC LEE genes-------------86

LuxS/QS regulates Stx expression-----------------------------92

Quorum sensing controls cytotoxicity for erythrocytes-----92

vii

4. DISCUSSION----------------------------------------------------------95

CHAPTER III. Quorum sensing contribute to proteomic changes of

Escherichia coli O157:H7--------------------------------------------------110

1. INTRODUCTION------------------------------------------------111

2. MATERIALS AND METHODS-------------------------------114

Preparation of secreted proteins and cellular proteins------114

SDS-PAGE-------------------------------------------------------115

Isoelectric focusing (IEF)--------------------------------------115

Two dimensional gel electrophoresis (2-DE)---------------116

In gel proteolytic digestion and MALDI-TOF--------------116

Data analysis-----------------------------------------------------117

Statical analysis--------------------------------------------------118

3. RESULTS----------------------------------------------------------119

Patterns of proteome in clinical isolate and standard

viii

strain--------------------------------------------------------------119

SDS-PAGE and 2-DE analysis of luxS/QS related

strains-------------------------------------------------------------119

Proteome profiling wild-type, luxS mutant and complement

strains-------------------------------------------------------------123

Influence of luxS mutation on protein expression in EHEC

O157:H7--------------------------------------------------------123

4. DISCUSSION---------------------------------------------------------137

CONCLUSIONS---------------------------------------------------------------145

REFERENCES-----------------------------------------------------------------148

ABSTRACT IN KOREAN---------------------------------------------------191

ix

LIST OF FIGURES AND TABLES

Figure I-1. Prevalence of patients with STEC infections and distribution

of sex in South Korea.-------------------------------------------- 19

Figure I-2. Monthly isolation of STEC, from 1998 to 2006.------- 21

Figure I-3. Frequencies of STEC isolated and the localization of South

Korea from 1998 to 2006.---------------------------------------- 23

Figure I-4. Amplification of virulence factors and adherence factor

associated genes in STEC.-------------------------------------- 27

Figure I-5. Antimicrobial resistance of 223 representative STEC strains in

South Korea.----------------------------------------------------------30

x

Figure I-6. PCR analysis for hemolysin genes and hemolytic activity

on sheep blood agar plate.---------------------------------------- 34

Figure I-7. Dendrogram of XbaI macrorestriction eletrophoretic patterns

of the 26 isolates of STEC O157.-------------------------------38

Figure II-1. Scheme of construction luxS mutant EHEC O157:H7

strain ------------------------------------------------------------69

Figure II-2. Growth curves of EHEC strains.------------------------------- 74

Figure II-3. Motility assays of EHEC strains.------------------------------- 77

Figure II-4. Measured halo and rated the differnce of motility.---------- 78

Figure II-5.Morphological analysis of flagella using by transmission

electron microscope.---------------------------------------------79

xi

Figure II-6. Adherence assay to Hep-2 cell.--------------------------------- 80

Figure II-7. Adherence assay to HeLa cell.---------------------------------- 81

Figure II-8. Microarray analysis of CI03J, RL03J and ML03J strains.- 84

Figure II-9. The amplification curves and DNA standard curve of gapA

gene.---------------------------------------------------------------87

Figure II-10. Cytotoxic activity of shiga toxin on Vero cells by WST

assays.-----------------------------------------------------------93

Figure II-11. Dose-response of hemolysis phenotypes.-------------------- 94

Figure III-1. 2-DE images of EDL933 (ATCC43895) EHEC O157:H7

and CI03J (clinical isolate) EHEC O157:H7.---------------121

Figure III-2. SDS-PAGE of proteins in CI03J, ML03J and RL03J.----122

xii

Figure III-3. Comparative 2-DE of soluble proteins fraction of

CI03J, ML03J and RL03J.-------------------------------125

Figure III-4. Cellular proteomes and secreted proteomes of strains.----126

Figure III-5. Two dimensional gel electrophoresis images of differntially

expressed proteomes in strrains.------------------------------127

Tabel I-1. Distribution of clinical manifestations and ages in patiients

with STEC infections in south Korea-----------------------------20

Table I-2. Serogroups of STEC strains isolated between 1998 and 2006

from patients in south Korea---------------------------------------22

Table I-3. PCR primers and conditions for amplification of STEC

xiii

virulence genes----------------------------------------------------26

Table I-4.Disribution of the stx genes and production of shiga toxins---28

Table I-5. Genotypic trait of STEC strains from diarrhreal patients in

south Korea---------------------------------------------------------29

Table I-6. Multidrug resistance of STEC isolates---------------------------31

Table I-7. Distribution of the hemolysin genes and relevant phenotypes

on sBAP-------------------------------------------------------------35

Table I-8. Relationship between hemolysin types and patients with

clinical signs-------------------------------------------------------36

Table II-1. Bacterial strains and plasmids used in this study--------------70

Table II-2. Oligonucleotides used in this study------------------------------71

xiv

Table II-3. Utilization of carbohydrates in strains---------------------------73

Table II-4. Fold induction of transcrit in response to luxS/QS as

determined by microarray---------------------------------------85

Table II-5. PCR primers used in qualitative and quantitative real-time

PCR assays--------------------------------------------------------88

Table II-6. Quantification of DNA in housekeeping gene, gapA---------90

Table II-7. Comparative to LEE genes using by quantitative real-time

PCR assay----------------------------------------------------------91

Table III-1.Cellular proteome profiles of CI03J, RL03J and ML03J---128

Table III-2. Secreted proteome profiles of CI03J, RL03J and ML03J-133

xv

Table III-3. Differentially expressed cellular proteins in CI03J, RL03J

strain compared to luxS mutant ML03J strain------------------------------135

Table III-4. Differentially expressed secreted proteins in CI03J, RL03J

strain compared to luxS mutant ML03J strain------------------------------136

xvi

ABBREVIATION

ACN : acetonitrile

A/E : attaching and effacing

AI : autoinducer

BSA : bovine serum albumin

DMEM : Dulbecco’s modified eagle’s medium

DNA : deoxyribonucleic acid

dNTP : deoxyribonucleotide triphosphate

DTT : dithiolthreitol

EDTA : erthylene diamine tetra acetic acid

xvii

EHEC : enterohemorrhagic Eschrichia coli

EPEC : enteropathogenic Escherichia coli

FBS : fetal bovine serum

GI : gastrointestinal

HC : hemorrhagic colitis

HUS : hemolytic uremic syndrome

IEF : isoeletric focusing

IPG : immobilized pH gradients

LEE : locus of enterocyte effacement

MALDI-TOF/MS: matrix assisted laser desorption ionization-time of

flight mass spectrometry

xviii

MTT : 3- (4,5-dimethylthiazol-2yl)-2,5-diphenyl-2H

-tetrazolium bromide

ORF : open reading frame

PBS : phosphate buffered saline

PCR : polymerase chain reaction

PFGE : pulsed field gel electrophoresis

pI : isoelectric point

PMSF : phenylmethylsulfonyl fluoride

pO157 : plasmid O157

QS : quorum sensing

RNA : ribonucleic acid

xix

RPLA : reversed passive latex agglutination

RT-PCR : reverse transcriptase polymerase chain reaction

SAM : S-adenosyl methionine

sBAP : sheep blood agar plate

SDS-PAGE : sodium dodecyl sulfate-polyacrylamide gel

electrophoresis

STEC : shiga toxin-producing Escherichia coli

Stx : shiga toxins

TBE : tris-borate EDTA

TCA : trichloroacetic acid

TEM : transmission electron microscope

xx

TFA : trifluoroacetic acid

T3SS : type III secretion system

2-DE : two dimenssional electrophoresis

VTEC : verocytotoxin-producing Escherichia coli

xxi

ABSTRACT

Modulation of Enterohemorrhagic

Escherichia coli Virulence by the Global

Regulator System

Shiga toxin-producing Escherichia coli (STEC), also called,

enterohemorrhagic Escherichia coli (EHEC) have emerged as pathogens

that cause problems such as bloody diarrhea, non-bloody diarrhea and the

hemolytic uremic syndrome (HUS). The public health impact of STEC

(EHEC) infections is high because of their systemic complications, such

as HUS, an important cause of acute renal failure in childhood, and late

xxii

sequelae and their ability to cause large outbreaks.

This study investigated the relationship between phenotypic and

genotypic characteristics of STEC strains isolated in Korea. Subsequently,

in order to determine the effect on the phenotypic variations and

regulation of virulence factors in human pathogen E. coli O157:H7 by

quorum sensing which is a process of bacterial cell to cell communication.

In this study, a defined nonpolar luxS deletion in strain CI03J was

constructed, this strain was an EHEC O157:H7 human isolate in Korea,

and the goal of this study was to investigate the effect of luxS/QS system

on phenotypes related to EHEC virulence and infection. In cytotoxicity

appearance, isogenic luxS mutant strain has shown decreased cytotoxicity

levels for mammalian cells and hemolysis activites for human erythrocyte.

Among the virulence factors, the bacterial adherence to mammalian cells,

flagella motility, chemotaxis, and type III secretion system (T3SS) were

also activated by luxS dependent quorum sensing. The microarray data

xxiii

and RT-real time PCR also indicated that several genes encoding flagella,

chemotaxis-related and T3SS associated genes were less expressed in the

mutant strain.

The expression of virulence factors in these strains were analyzed

by 2-DE. Total of 205 spots, i. e., 145 spots of intracellular proteins and

60 spots of extracellular proteins were detected and analyzed. Among the

spots, 19 intracellular protein spots and 22 differential spots of

extracellular proteins were increased or decreased between the strains.

The most interesting outcome of this study is the identification of virulent

proteins involved in FliC, Flagellin, EspG and hemolysin in the

intracellular proteins. As a result of the three extracellullar proteins, it

contains SepD, Cytolysin A and Stx2 protein and these were known to

virulence factors of EHEC. These results indicated that several proteins

were up-regulated by LuxS.

In conclusion, these findings suggest that quorum-sensing

xxiv

regulation in EHEC strain is a global regulatory system that controls not

only genes and proteins involved in pathogenesis but also factors

involved in several bacterial metabolism and biosynthesis, among other

functions.

Key words: shiga toxin producing Escherichia coli (STEC),

enterohemorrhagic E. coli (EHEC), hemolytic yremic syndrome (HUS),

quorum sensing, luxS, microarray, reverse transcriptase real time

polymerase chain reaction (RT-real time PCR), two dimensional

electrophoresis( 2-DE)

1

CHAPTER I

Epidemiologic and molecular research on

shiga toxin-producing Escherichia coli

isolated in Korea

2

1. INTRODUCTION

Escherichia coli was first described in 1885 by Theodore Escherichia as

a pure culture of occasionally curved, slim, short rods ranging from 1~5

㎛ in length and 0.3~0.4 ㎛ in thickness (Bettelheim, 1986). As a part

of the normal gut microflora, this microorganism colonizes the

gastrointestinal tract of warm-blooded animals and humans within a few

hours after birth and plays an important role in maintaining gut

physiology (Doyle et al., 2001). However, some E. coli strains have

acquired specific virulence factors by means of mobile genetic elements

such as plasmids, transposons, bacteriophages, and pathogenicity islands,

and have evolved into pathogenic E. coli (Kaper et al. 2004). Shiga like

toxin-producing Escherichia coli (STEC), also called, verocytotoxin-

producing E. coli (VTEC) have emerged as pathogens that can cause

problems such as hemorrhagic colitis (HC), mild diarrhea, severe bloody

diarrhea with abdominal pain and, in up to 10% of cases, hemolytic-

uremic syndrome (HUS) (Nataro and Kaper, 1998).

Transmission of STEC to man occurs through the consumption of

contaminated food, including under-cooked beef and meat products, un-

pasteurized milk and ready-to-eat products, including cooked meats and

vegetables that have been contaminated (Besser et al., 1993; Griffin et al.,

3

1991; Thorpe, 2004). Disease outbreaks are frequently associated with

the ingestion of food or water contaminated by bovine feces. Examples

include under-cooked ground beef, private or municipal water sources,

and other food products such as un-pasteurized apple cider or milk, fresh

vegetables, sprouts, and salami (Griffin et al., 1991; Nataro and Kaper,

1998). Healthy cattle are the most important animal reservoir associated

with human infection (Albihn et al., 2003; Hancock et al., 1994),

although other healthy animals, including sheep, goats, pigs, dogs,

chickens, horses, deer, rats, and sea gulls can also carry STEC (Cizek et

al., 2000; Doyle et al., 2001; Kudva et al., 1996).

Direct or indirect contact with animals provides an alternative route

by which infection can be acquired (Beutin et al., 1995) and person-to-

person transmission of the organism occurs in families and institutional

settings (Nataro and Kaper, 1998). The potential for airborne

transmission has also been reported recently after an exposure to a

contaminated building at an animal exhibit (Cobeljic et al., 2005). The

various transmission routes may be explained by the very low infectious

dose (10-100 organisms) of this microorganism. Therefore, minimal

exposures can cause disease (Kaper et al., 2004). STEC was first

recognized as a human pathogen in 1982 (Nataro and Kaper, 1998). Since

then, this microorganism has been associated with many disease

outbreaks in the U.S. and other countries around the world (Beutin et al.,

4

2004; Boerlin et al., 2002; Galane et al., 2001). In the U.S., there are

approximately 70,000 infections annually and 2,000 hospitalizations,

with an overall cost of ＄405 million (Banatvala et al., 2001), which

makes STEC infections a serious problem. The largest outbreak in the

U.K. occurred in Central Scotland in 1996, resulting in more than 500

cases and 21 deaths (Evans et al., 2002); a series of related outbreaks in

Japan in 1996 involved more than 10,000 cases (Nataro and Kaper, 1998).

Although O157 is the most important STEC serogroup, more than 180

serotypes of E. coli have been shown to produce shiga like toxin(s)

(STXs). In Spain, STEC is a significant cause of sporadic cases of human

infection (Almirante et al., 2005; Blanco et al., 1999; Mora et al., 2007).

Some non-O157 have been associated with outbreaks of infection (Espie

et al., 2008). The public health impact of STEC infections is high because

of their systemic complications, such as HUS, an important cause of

acute renal failure in childhood, and late sequelae (Andreoli et al., 2002),

and their ability to cause large outbreaks.

Currently, STEC infections are not treated with antibiotics, as this

has been found to increase the development of HUS in infected children

(Tarr et al., 2005), as well as the increased release of shiga toxins (Olsson

et al., 2002; Beutin et al., 1996). The clinical manifestation of STEC

infections are best characterized for illnesses caused by STEC O157:H7.

The infectious dose for this pathogen is estimated to be well under 100

5

organisms (Karch et al., 2005). After a typical incubation period of 3-4

days (Andreoli et al., 2002), patients develop watery diarrhoea

accompanied by abdominal cramping pain for 1-3 days.

The cardinal trait of STEC is their ability to produce and release

Stxs, which are considered the major virulence factors produced by these

pathogens. Based on cytotoxicity neutralization assays and sequence

analysis of stx genes, two major Stx families, Stx1 and Stx2, can be

differentiated. Each of these holotoxins is composed of five glycolipid-

binding B subunits, and one enzymatically active A subunit, which

inhibits protein synthesis by cleaving ribosomal RNA (O'Brien et al.,

1992; O’Loughlin et al., 2001). In both major toxin groups, several toxin

variants have been identified, in addition to the major toxin types. The

Stx1 group presently consists of Stx1, Stx1c (Friedrich et al., 2003), and

Stx1d (O’Brien et al., 1992), recently found also in humans (Sandvig et

al., 2002). The more heterogeneous Stx2 group is comprised of Stx2c

(Pierard et al., 1998), Stx2c2 (Dell’Omo et al., 1998), Stx2d (Melton et

al., 1996; Pierard et al., 1998), Stx2e (Gannon and Gyles, 1990), Stx2f

(Schmidit et al., 2000), and Stx2g (Leung et al., 2003), which is not yet

found in humans. Gene encoding Stx1, Stx2, and certain Stx variants are

contained on temperate lambdoid bacteriophages that integrate into

different sites of the bacterial chromosome (Schmidit, 2001). In addition

6

to their role in virulence, Stxs are also targets with which to diagnose

STEC infections (Paton et al., 1998).

An important early step in the colonization of the human

gastrointestinal tract by bacteria is the adhesion of the organism to the

host surface. Most STEC strain produce a distinct histopathological

lesion on intestinal epithelial cells known as the attaching and effacing

(A/E) lesion. All the proteins associated with the formation of A/E lesion

are encoded on a chromosomal pathogenicity island known as the locus

of enterocyte effacement (LEE). The LEE contains the eae (E. coli

attaching and effacing) gene, encoding the outer membrane protein

intimin and several type III secretion system (T3SS) related genes.

Intimin is an outer membrane protein encoded by the eae gene within the

LEE, that is required for intimate adhesion to epithelial cells, for

cytoskeletal reorganization, and for full virulence in adult volunteers

(Jerse et al., 1990; Donnenberg et al., 1993). Among the various A/E

pathogens, multiple intimin alleles have been identified that differ in

antigenicity as well as in sequence (Agin and Wolf, 1997; Adu-Bobie et

al., 1998). To date, sequence variations of the C-terminus have been

proposed to define at least nine intimin subtypes [represented by the

Greek letters a through z(zeta)] (Adu-Bobie et al., 1998). This protein

mediates intimate adherence to target eukaryotic cells upon interaction

with its translocated receptor Tir (Miyake et al., 2005), a protein encoded

7

upstream of eae gene on the LEE (Schmidt and Hensel, 2004).

PCR analysis revealed that 223 STEC isolates tested positive for

several virulence genes and putative virulence genes. Together with

detection of the virulence genes, we compared the distribution pattern of

the genes associated with adherence. Several proteins were proposed to

be novel adhesion factors; these include ToxB (a protein identified from

large, 93-kb plasmid pO157 and required for full expression of adherence

of O157:H7 strain Sakai) (Stevens et al., 2004; Tatsuno et al., 2001;

Tozzoli et al., 2005), Saa (an autoagglutinating adhesion identified in

LEE-negative strains) (Paton et al., 2001; Tarr et al., 2000), Iha

(adherence-conferring protein similar to Vibrio cholerae IrgA) (Tarr et al.,

2000), and EfaI (EHEC factor for adherence) (Stevens et al., 2004).

These putative adhesions are encoded in the large plasmid harbored by

STEC strains.

A factor that may also affect the virulence of STEC is the

enterohemolysin Ehly, also called enterohemorrhagic E. coli hemolysin

(EHEC-HlyA), which is encoded by an ehxA gene (Beutin et al., 1996;

Boerlin et al., 1998; Eklund et al., 2001). Hemolysin production is a

common attribute of Escherichia coli strains and was shown to be

involved in defines a novel type of cytolysin(sheA) (Kerenyi et al., 2005;

Westermark et al., 2000) with regard to structure, secretion and activation

and is expected to display particular properties with regard to pore

8

formation. In E. coli isolates associated with diseases, pore-forming

cytolysins have been identified. To characterize the cytolysis of the

STEC-derived RTX (repeates in toxin) and other pore-forming toxins, we

compared its activities for lysis of RBC. In this study, we analyzed

various STEC isolates belonging to different phenotypes with regard to

the presence of hlyA, ehx, sheA. In addition, we investigated the

comparison between symptoms of patients and genetic profiles.

The first case of HUS due to STEC infection in Korea was isolated

in 1998 (Kim et al., 1998). The outbreak in Korea occurred in Kwang-ju

city in 2004, resulting in more than 70 cases. Infections caused by STEC

have increased in Korea, although prevalence remain low as compared to

other gastrointestinal pathogens, such as Salmonella, Shigella and Vibrio

(Cho et al., 2006). However, the potential severity of the disease results

in high patient morbidity and a significant economic cost. It is essential to

maintain and enhance surveillance to identify risk factors and to obtain

more evidence on the diversity of transmission routes. This information is

essential to implement measures to reduce STEC infection. Surveillance

of STEC-associated infection is now undertaken by several countries and

elsewhere, although the criteria and methods applied vary.

Since the last detailed report of laboratory surveillance in Korea,

there has been a rise in the number of infections caused by STEC and in

the number of outbreaks. Our current investigation is the first large study

9

in Korea on the prevalence of STEC in patients with diarrhea. The

objective of this study was to determine the prevalence and molecular

characterization of STEC in Korea from 1998 to 2006. The relationship

between STEC serotype, STEC virulence factors, Stx1 and Stx2, and the

clinical signs in the patients were investigated. To describe the

surveillance activities and epidemiological laboratory markers of STEC

that used at the clinical laboratory to investigate sporadic cases and

outbreaks of E. coli O157:H7 and non-O157 STEC in Korea.

10

2. MATERIALS AND METHODS

STEC strains isolated from stool specimen

Between 1998 and 2006, stool samples were collected from patients

with diarrhoea enrolled in an ongoing active surveillance system at

National Institute of Health (NIH) operated by Korea Centers for Disease

Control and Prevention (KCDC). 223 E. coli strains isolated from the

stool of symptomatic and asymptomatic patients between 1998 and 2006

were investigated in this study. Specimens were plated on MacConkey

agar (Difco Co., Ltd., Detroit, U.S.A.), eosin methylene blue agar (Difco

Co., Ltd., Detroit, U.S.A) and sorbitol MacConkey agar (Difco Co., Ltd.,

Detroit, U.S.A.). All isolates were biochemically characterized with the

API20E system (Biomerieux, Marcy l'Etoile, France).

Bacterial strains and culture condition for

enterohemolysin expression

Of the strains examined for ehx, hlyA, and sheA, among the 223 STEC,

221 were positive for hemolysin genes. For the detection enterohemolytic

activity, strains were inoculated from well-spaced single colony onto

washed human blood agar plates and the plates were incubated at 37 ℃

for 18 hrs, followed by 6hrs at room temperature. Defibrinated sheep

11

blood was washed three times in phosphate-buffered saline (pH 7.4) at

950 × g and added (5%, vol/vol) to Luria-Bertani (LB) medium agar

(Difco Co. Ltd., Detroit, U.S.A) cooled to 50 .℃

Detection of virulence genes by PCR

A loopful of human stool samples was directly inoculated into 3 ml of

LB medium (Difco Co., Ltd., Detroit, U.S.A) for enrichment and

incubated overnight at 37ºC under shaking conditions. After incubation,

enriched broth culture was centrifuged at 13,000 rpm (Sorvall Biofuge

Pico, Thermo Fisher Scientific Inc., Waltham, U.S.A.) for 1 min and the

pellet was heated at 100ºC for 10 min. Following centrifugation of the

lysate, 5 ㎕ of the supernatant was used in the PCR. To detect STEC,

PCR assays were performed using in the primers and anneling conditions

shown in Table I-3. PCR assays were carried out in a 50 ㎕ volume with

2 U DNA Taq polymerase (Takara Ex TaqTM, Kyoto, Japan) in a thermal

cycler (PTC-100, MJ Research, Watertown, U.S.A.) under the following

conditions: initial denaturation for 5 min at 94 , 30 cycles, each for 1 ℃

min, denaturation (94 ), ℃ annealing, extension (72 ) and final cycle ℃

72 for 5 min. Amplified PCR products were analysed by gel ℃

electrophoresis in 2% agarose gels stained with ethidium bromide,

visualized with UV illumination, and imaged with the Gel Doc 2000

12

documentation system (Bio-Rad, Hercules, U.S.A.).

Reversed-passive latex agglutination (RPLA) test for

the detection of Shiga toxin

The production of Stx1 and Stx2 by the isolates was determined by

using a reversed-passive latex agglutination kit (VTEC-RPLA; Denka

Seiken Co., Ltd., Tokyo, Japan) after having been grown and shaken in 5

ml of tryptone soy broth (TSB) (Difco Co. Ltd, Detroit, U.S.A.) overnight

at 37 . Of this suspension, 1 ml was centrifuged for 20 min at 13,000 ℃

rpm (Sorvall Biofuge Pico, Thermo Fisher Scientific Inc., Waltham,

U.S.A.). The titer of the supernatant was determined in the VTEC-RPLA

test according to the manufacture's instructions up to 1:256. All STEC

strains were tested for the production of Stx1 and Stx2. Titers lower than

1:2 were interpreted as negative control.

Serotyping of O antigen

The presence of O antigens was determined by microplate based

agglutination with the method of Guinée et al. (1972) employing all

available O (O1 to O181) antisera (E. coli O antisera kit, LREC

laboratory, Lugo, Spain). All antisera were absorbed with the

corresponding cross-reacting antigens to remove the nonspecific

13

agglutinins.

Antimicrobial susceptibility test

Once a single E. coli isolate was isolated and identified from each

sample collected, the standard Kirby-Bauer disk diffusion method was

used to determine the antimicrobial sensitivity profiles of the E. coli

isolates (Clinical and Laboratory Standard Institute, 2006) for 18

antimicrobial agents(BD, Franklin lakes, U.S.A.) (ampicillin; 10 ㎍,

amikacin; 30 ㎍, ampicillin-sulbactam; 10/10 ㎍, cephalothin; 30 ㎍,

cefazolin; 30 ㎍, cefepime; 30 ㎍, cefotetan; 30 ㎍, cefotaxime; 30 ㎍,

ciprofloxacin; 5 ㎍, chloramphenicol; 30 ㎍, gentamicin; 10 ㎍,

imipenem; 10 ㎍, nalidixic acid; 30 ㎍, tetracycline; 30 ㎍, ticarcillin;

75 ㎍, trimethoprim -sulfamethoxazole; 1.25 / 23.75 ㎍). A 150 mm

Mueller-Hinton agar (Difco Co., Ltd., Detroit, U.S.A) plate was swabbed

with TSB inoculated with E. coli and incubated to a turbidity of 0.5

McFarland standard. Eighteen commercially prepared antimicrobial agent

disks were place on the inoculated plates. The plates were incubated at

37 for 18 to 20 hrs. The diameters (in millimeters) of the clear zones of ℃

growth inhibition around the antimicrobial agent disks, including the 6

mm disk diameter, were measured by using precision calipers (CLSI,

2006). The breakpoints used to categorize isolates as resistant or not

14

resistant to each antimicrobial agent were those recommended by the

National Antimicrobial Resistance Monitoring System for E. coli. E. coli

ATCC 25922 (American Type Culture Collection) was used for quality

control. Data for the antimicrobial resistance of each bacterial isolate

were reported in two forms: either as the diameter of the zone of

inhibition (in millimeters) or as resistant or not resistant (based on CLSI

breakpoints).

Pulsed field gel electrophoresis (PFGE) for STEC

O157 strains

Bacterial cells were grown overnight at 37 on tryptic soy agar (Difco ℃

Co. Ltd., Detroit, U.S.A.). They were suspended in TE buffer (100 mM

Tris and 100 mM EDTA, pH 7.5) and partially embedded in low-melting-

temperature agarose (FMC Corp., Newyork, U.S.A.) and digested

overnight with 10 U of ProteinaseK (Invitrogen, Carlsbad, U.S.A.) at

55 . Briefly, DNA was digested with the enzyme ℃ XbaI (New England

Biolabs, Beverly, U.S.A.) following electrophoresis performed with the

Gene Path system (Bio-Rad Laboratories, Sunbyberg, Sweden) in a 1%

agarose gel in 0.5 × TBE (Tris Borate EDTA) buffer at 14 with a linear ℃

ramp time of 2.16 to 35.07 s over a period of 18 hrs, a 120 seitch angle,

and a gradient of 6.0 V per cm. After PFGE, the gels were stained with

15

ethidium bromide and photographed under UV transillumination. The

gels were also digitized for computer-aided analysis. The Molecular

analysis software package (Bionumerics, Applid Maths., Inc., Austin,

U.S.A.) was used for analysis. Calculation of the similarity matrix was

done with the Jacquard algorithm after defining each band between sizes

145 and 582 kb. Percent similarities were identified on a dendrogram

derived from the unweighted pair group method using arithmetic

averages and based Jacquard coefficients.

16

3. RESULTS

Prevalence of STEC isolates

The presence of STEC in stool specimen of patients with diarrhea or

other gastrointestinal alterations, symptoms and asymptomatic from 17

Institute of Health and Environment of Korea were analyzed. STEC

strains were detected in 223 cases, with a progressive increase in the

incidence from 0.4% (1 isolate) in 1998 to 46.2% (103 isolates) in 2004

(Fig. I-1). The isolation proportion for STEC were not significantly

different for male (57.4%, 128 cases) and female (43%, 96 cases) patients

(Fig. I-1). STEC strains were more frequently isolated during the summer

months. Of 223 strains that yielded STEC, 126 (56.5%) were isolated

from June through August (Fig. I-2). STEC strains were isolated

throughout the year with only a moderate seasonal variation, 92.3% of

cases being detected from March to September.

As shown in Table I-1 , age-specific patterns were observed in

these STEC infections, with a high rate of prevalence in children and the

elderly. The largest number of STEC isolates was obtained from children

0 to 10 years of age 123 (55.1%). The rate of bacterial isolation was

drastically lower in adults, especially in people from the 21- to 40-year-

old age group, where it was 6 (2.7%) and this climbed to 9 (4%) in people

17

greater than 60 years of age. STEC infections were distributed without an

obvious variation among the different age groups. In these results of the

symptoms of the STEC infected patients, diarrhea (37.2%) among most

of the patients showed the largest distribution, and other diverse

symptoms including bloody diarrhea (involved in hemolytic uremic

syndrome (HUS), 20.6%), headache (1.8%), flu-like symptoms (12.5%)

(involved in chill, fever, headache and cough) and vomiting (6.3%) were

recognized (Table I-1). Also, quite a number of the patients with the

complexity of these various symptoms were identified, and not a few

patients were confirmed to be subclinical without any symptoms (13.5%).

Of these strains, 223 were isolated from the metropolitan area and 6

providences (Fig. I-3). The geographical distribution of STEC showed a

concentration in the metropolitan area involved in Seoul (17%) and

Kyungki area (26.5%). This may indicate that the occurrence of person-

person carrying STEC is correlated to the geographical distribution of the

human population. The lagest distribution of STEC isolates was obtained

from patients in Cholla-do (39.9%). This result might be that the cases

contained isolates of outbreak (73 strains) in 2004. STEC infections were

distributed without an obvious variation among the different areas.

Serotypes of STEC isolates

STEC strains were identified in 186(83.4%) of the 233 STEC strains

18

analyzed, and the frequency varied among the different serogroups

studied (Table I-2). The STEC strains belonged mainly to serogroups

O91(75 of 233[33.6%]) and O26(20 of 233[9%]), but serogroups O4,

O14, O25, O44, O64, O69, O89, O106, O108, O115, O116, O121, O128,

O152 and O16 (one strain each) were also detected. Of all 223 STEC

isolates detected in Korea since 1998, 26(11.7%) strains were sorbitol

negative and belonged to the O157 serogroup and 37(16.6%) strains were

undetemined serogroup.

19

Figure I-1. Prevalence of patients with STEC infections and

distribution of sex in South Korea.

0

20

40

60

80

100

120

1998 1999 2000 2001 2002 2003 2004 2005 2006

year

No.

of S

TE

C is

olat

es

Male

Female

Cases

20

Table I-1. Distribution of clinical manifestations and ages in patients with STEC infections in South Korea

Age in years

Patients with Symptoms No. Positive(%)

Bloody diarrhea Diarrhea Abdominal pain Chill Fever Vomiting Asymtomatic Headache Cough Total

0-5 24(10.8) 59(26.5) 0(0) 0(0) 2(0.9) 4(1.8) 0(0) 0(0) 0(0) 89(39.9)

6-10 12(5.4) 9(4) 15(6.7) 0(0) 2(0.9) 0(0) 0(0) 0(0) 0(0) 34(15.2)

11-20 1(0.4) 7(3.1) 4(1.8) 2(0.9) 14(6.3) 9(4) 28(12.6) 2(0.9) 1(0.4) 75(33.6)

21-40 1(0.4) 4(1.8) 1(0.4) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 6(2.7)

41-60 2(0.9) 2(0.9) 1(0.4) 1(0.4) 1(0.4) 1(0.4) 2(0.9) 2(0.9) 1(0.4) 10(4.5)

60< 6(2.7) 2(0.9) 1(0.4) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 9(4)

Total 46(20.6) 83(37.2) 22(9.9) 3(1.3) 19(8.5) 14(6.3) 30(13.5) 4(1.8) 2(0.9) 223(100)

Age in years

Patients with Symptoms No. Positive(%)

Bloody diarrhea Diarrhea Abdominal pain Chill Fever Vomiting Asymtomatic Headache Cough Total

0-5 24(10.8) 59(26.5) 0(0) 0(0) 2(0.9) 4(1.8) 0(0) 0(0) 0(0) 89(39.9)

6-10 12(5.4) 9(4) 15(6.7) 0(0) 2(0.9) 0(0) 0(0) 0(0) 0(0) 34(15.2)

11-20 1(0.4) 7(3.1) 4(1.8) 2(0.9) 14(6.3) 9(4) 28(12.6) 2(0.9) 1(0.4) 75(33.6)

21-40 1(0.4) 4(1.8) 1(0.4) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 6(2.7)

41-60 2(0.9) 2(0.9) 1(0.4) 1(0.4) 1(0.4) 1(0.4) 2(0.9) 2(0.9) 1(0.4) 10(4.5)

60< 6(2.7) 2(0.9) 1(0.4) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 9(4)

Total 46(20.6) 83(37.2) 22(9.9) 3(1.3) 19(8.5) 14(6.3) 30(13.5) 4(1.8) 2(0.9) 223(100)

21

0

10

20

30

40

50

60

Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

Month

No.

of S

TE

C is

olat

es

Figure I-2. Monthly isolation of shiga toxin producing E. coli (STEC),

from 1998 to 2006.

22

Table I-2. Serogroups of STEC strains isolated during 1998-

2006 from patients in South Korea

2232220103441118311Total

385291255Unidentified

22O171

11O163

422O159

25266611111O157

11O152

624O146

22O145

11O128

21O121

11O116

11O115

1O112

4122O111

11O108

11O106

1311731O104

12125O103

767041O91

11O89

11O69

11O64

971O55

11O44

21925221O26

11O25

22O21

11O14

1O5

11O4

200620052004200320022001200019991998Total

YearsSerogroups

2232220103441118311Total

385291255Unidentified

22O171

11O163

422O159

25266611111O157

11O152

624O146

22O145

11O128

21O121

11O116

11O115

1O112

4122O111

11O108

11O106

1311731O104

12125O103

767041O91

11O89

11O69

11O64

971O55

11O44

21925221O26

11O25

22O21

11O14

1O5

11O4

200620052004200320022001200019991998Total

YearsSerogroups

23

Figure I-3. Frequencies (No. of isolates and percentages) of STEC

isolated and the localization of South Korea from 1998 to 2006.

Kangwon-do:8(3.6)

Kyongsang-do:20(8.9)

Jeju-do:3(1.3)

Cholla-do:89(39.9)

Chungchong-do:89(39.9)

Kyungki-do:59(26.5)

Seoul:38(17)Kangwon-do:8(3.6)

Kyongsang-do:20(8.9)

Jeju-do:3(1.3)

Cholla-do:89(39.9)

Chungchong-do:89(39.9)

Kyungki-do:59(26.5)

Seoul:38(17)

24

Stx genes and toxin production

In the present study 223 STEC isolates were charaterized (Table I-4). Of

the 223 STEC strains, 63(28.3%) carried the stx2 gene only, 45(20.2%)

isolates carried the stx1 gene only, and 115(51.5%) isolates carried both

genes. The corresponding toxin(s) shown by the reversed passive latex

agglutination test was produced by 220 of 223 strains, with the titers

varying from 1:2 to 1: 128 for Stx1 and 1:2 to 1:256 for Stx2.

Characterization of adherence genes

PCR showed that 91(40.8%) isolates carried putative adhesin genes

involved in saa gene, 181(81.2%) possessed iha gene, 132(59.2%) and

187(83.9%) strains carried toxB gene and efaI gene. Intimin (eae) genes

were detected in 209(93.7%). The eae-positive STEC strains could be

subtyped for their intimins by PCR with specific primers as previously

described(Reid et al., 1999). Three intimin types, namely intimin-α (0

strain), β(42 strain), γ(118 strains) were detected. Of the 209 eae-positive

STEC strains, 134(60.1%) isolates carried translocated intimin receptor

encode gene, tir. Also, the translocators encode genes espA (37.7%),

espD (34.1%) and espB (29.6%) were detected (Table I-5 and Fig. I-4).

25

Resistance of antibiotics

The resistance patterns of the 223 isolates from the point prevalence

study are shown in Fig. I-5. Most of the 196 isolates (87.9%) were

resistant to at least one antibiotic, whereas 27 isolates (12.1%) were

sensitive to all 16 antibiotics tested. The antibiotic for which resistance

was most frequently observed was tetracycline (51%), followed by

ampicillin (42.3%). The prevalence rate of resistance to cefepime,

cefotetan, cefotaxime and imipenem among the STEC isolates was 0.7%.

Multidrug resistance (defined as resistance to three or more classes of

antimicrobial agents) was common(33.6% of all STEC isolates) and

frequently(5.8%) included resistance to ampicillin, ampicillin and

sulbactam, cephalothin, tetracycline, and ticarcillin (Table I-6 ).

26

Table I-3. PCR primers and conditions for amplification of STEC virulence genes

S e q u e n c e ( 5 ' t o 3 ') T a r g e t g e n e s A m p l i c o n s i z e ( b p ) A n n ea l i n g t e p m p e r a t u r e R e f e r e n c e T A K A R A ™ f o r m a tT A K A R A ™ f o r m a tT A K A R A ™ f o r m a tT A K A R A ™ f o r m a t

C G T G A T G A A C A G G C T A T T G CA T G G A C A T G C C T G T G G C A A CC A G T T C A G T T T C G C A T T C A C C

G T A T G G C T C T G A T G C G A T GA T A C C T A C C T G C T C T G G A T T G AT T C T T A C C T G A T C T G A T G C A G C

G A G A C T G C C A G A G A A A GG G T A T T G T T G C A T G T T C A G

G T C T G C A A A G C A A T C C G C T G C A A A T A A AC T G T G T C C A C G A G T T G G T T G A T T A G

C A G T G A C G C A C A T A C A GT C G G G A T A T A T A A T C A T C C

G A G G C G A A T G A T T A T G A C T GA C T T C A G G T A C C T C A A A G A GC T G A A C G G C G A T T A C G C G A A

C C A G A C G A T A C G A T C C A GC T G G G A G T T G T C G A T G T T e a e a l l e l e -α 1 , 6 4 8

G T A A T T G T G G C A C T C C e a e a l l e l e -β 1 , 7 7 0G C C T C T G A C A T T G T T A C e a e a l l e l e -γ 1 , 9 2 6

G C T T G C A G T C C A T T G A T C C TG G G C T T C C G T G A T A T C T G A

G A C T G C G A G A G C A G G A A G T TC A G G T C T G C C C T T C T T C A T TG T T T T T C A G G C T G C G A T T C TA G T T T G G C T T T C G C A T T C T T

A A A A A G C A G C T C G A A G A A C AC C A A T G G C A A C A A C A G C C C AG C C G T T T T T G A G A G C C A G A AA A A G A A C C T A A G A T C C C C A

e s p A

K e r e n y i e t a l . , 2 0 0 5

T h i s s t u d y

5 5 ℃

9 1 7

C o m m e r c i a l k i t

P a t o n e t a l . , 2 0 0 1

5 3 ℃

5 7 ℃

5 6 ℃

e f a I

6 2 ℃9 2 0s h e A

e h x 2 1 2

1 4 5

e s p B

i h a

t o x B

h l y A

1 9 2

1 0 7

e s p D

l e r

t i r

s t x 1

s t x 2

s a a

1 0 6

e a e

1 , 3 0 5

6 0 2

4 7 9

1 8 7

5 6 1

3 4 9

1 1 9

4 0 4

6 0 ℃ S c h m i d t e t a l . , 2 0 0 2

T h i s s t u d y

6 2 ℃

6 0 ℃

R e i d e t a l . , 1 9 9 9

T a r r e t a l . , 2 0 0 2

N i c h o l l s e t a l . , 2 0 0 0

B o e r l i n e t a l . , 1 9 9 8

6 2 ℃

5 5 ℃

27

M 1 2 3 4 5 6 M 7 8 9 10 M M1 11 12 13 14 15 16 M1 17 18

1,000

1,600

100

200

300

400

500

600

700800900

1,200

2,0002,961

Sxt1 (349bp)

Sxt2 (404bp)

hlyA(561bp)

FliC(1,771bp)

ler(192bp)

tir(142bp)

saa(119bp)

iha(1,305bp)

efaI(479bp)

toxB(602bp)

1,000

1,600

100

200

300

400

500

600

700800900

1,200

2,0002,961

Sxt1 (349bp)

Sxt2 (404bp)

hlyA(561bp)

FliC(1,771bp)

ler(192bp)

tir(142bp)

saa(119bp)

iha(1,305bp)

efaI(479bp)

toxB(602bp)

ΒΒΒΒ-intimin(1,926bp)

αααα-intimin

(1,770bp)

eae(917bp)

ΓΓΓΓ-intimin

(1,770bp)

eae(917bp)

500

1,000

1,600

2,000

2,961

ΒΒΒΒ-intimin(1,926bp)

αααα-intimin

(1,770bp)

eae(917bp)

ΓΓΓΓ-intimin

(1,770bp)

eae(917bp)

500

1,000

1,600

2,000

2,961

Figure I-4. Amplification of virulence factors and adherence factor

associated genes in STEC. Lane M, 100bp DNA ladder; M1, 1kb DNA

ladder marker; lane 1 to 7, EDL933(STEC O157:H7); lane 8, ATCC

51434 (E. coli O91:H21); lane 9 to 10, EDL933(STEC O157:H7); lane

11 to 13, enteropathogenic E. coli(EPEC) O117; lane 14 to 16, EPEC

O162; lane 17 to 18, EDL933(STEC O157:H7). The size and positions of

DNA markers are indicated on the left.

28

Table I- 4. Distribution of the stx genes and production of shiga

toxins

1:12551.6115Shiga toxin 1,2stx1,2

1:6428.363Shiga toxin 2stx2

1:3220.245Shiga toxin 1stx1

Averages of RPLA titer*Distribution(%)No.ofpositive strainsEncoded proteinstx types

1:12551.6115Shiga toxin 1,2stx1,2

1:6428.363Shiga toxin 2stx2

1:3220.245Shiga toxin 1stx1

Averages of RPLA titer*Distribution(%)No.ofpositive strainsEncoded proteinstx types

* The titer of the supernatant was determined in the VTEC-RPLA test

according to manufacture’s instructions from 1:2 to 1: 256 ratios.

29

Table I- 5. Genotypic trait of STEC strains from diarrheal patients in

South Korea

Genes Categories Encoded protein No.of positive strainseae Intimin 209

Intimin-α 0Intimin-β 42Intimin-γ 118

saa Autoagglutination adhesin 91iha Adherence-conferring protein 181

toxB Potential adhesin ToxB 132efaI EHEC factor for adherence 187

eae-α, β, γ LEE*

non-LEE**

* LEE: encoded from LEE(locus of enterocytes effacement).

** Non-LEE: not encoded from LEE or independent LEE.

30

Figure I-5. Antimicrobial resistance of 223 representative STEC

strains in South Korea. The graph indicates the resistance of all isolates

to different antimicrobial agents, including ampicillin(AM),

amikacin(AN), ampicillin-sulbactam(SAM), cephalothin(CF),

cefazolin(CZ), cefepime(FEP), cefotetan(CTT), cefotaxime(CTX),

ciprofloxacin(CIP), chloramphenicol(C), gentamicin(GM),

imipenem(IPM), nalidixic acid(NA), tetracycline(TE), ticarcillin(TIC)

and trimethoprim –sulfamethoxazole(SXT).

0%

10%

20%

30%

40%

50%

60%

AM AN SAM CF CZ FEP CTT CTX CIP C GM IPM NA TE TIC SXT

Antimicrobial agents

Perc

enta

ge o

f res

ista

nce

31

Table I-6. Multidrug resistance of STEC isolates

Multidrug resistant toa: No. of isolates

AM, SAM, CF 12

SAM, CF, TIC 11

AM, AN, SAM, CF 8

AM, SAM, TE, TIC 6

AM, SAM, CF, TIC 1

AM, SAM, CF, TE, TIC 13

AM, SAM, CF, C, TE, TIC 6

AM, SAM, CF, CZ, C, TE, TIC 3

AM, SAM, CF, C, TE, TIC, SXT 2

AM, SAM, CF, CZ, TE, TIC, SXT 2

AM, SAM, CF, C, GM, TE, TIC, SXT 5

AM, AN, SAM, CF, CZ, CIP, C, TE, TIC 1

AM, AN, SAM, CF, CIP, GM, NA, TE, TIC, SXT 1

AM, AN, SAM, CF, CZ, CIP, C, NA, TE, TIC 3

AM, AN, SAM, CF, CZ, FEP, CTT, CTX, CIP, C, GM, IPM, NA, TE, TIC 1

Susceptible to all antimicrobial agents 27

Multidrug resistant toa: No. of isolates

AM, SAM, CF 12

SAM, CF, TIC 11

AM, AN, SAM, CF 8

AM, SAM, TE, TIC 6

AM, SAM, CF, TIC 1

AM, SAM, CF, TE, TIC 13

AM, SAM, CF, C, TE, TIC 6

AM, SAM, CF, CZ, C, TE, TIC 3

AM, SAM, CF, C, TE, TIC, SXT 2

AM, SAM, CF, CZ, TE, TIC, SXT 2

AM, SAM, CF, C, GM, TE, TIC, SXT 5

AM, AN, SAM, CF, CZ, CIP, C, TE, TIC 1

AM, AN, SAM, CF, CIP, GM, NA, TE, TIC, SXT 1

AM, AN, SAM, CF, CZ, CIP, C, NA, TE, TIC 3

AM, AN, SAM, CF, CZ, FEP, CTT, CTX, CIP, C, GM, IPM, NA, TE, TIC 1

Susceptible to all antimicrobial agents 27

AM, ampicillin; AN, amikacin ; SAM, ampicillin-sulbactam ; CF,

cephalothin ;CZ, cefazolin; FEP, cefepime ; CTT, cefotetan ; CTX,

cefotaxime ; CIP, ciprofloxacin; C, chloramphenicol ; GM, gentamicin;

IPM, imipenem; NA, nalidixic acid; TE, tetracycline; TIC, ticarcillin.

32

Relationship between hemolysin type and human

patients with manifestation

Correlating the hemolytic phenotype of STEC isolates with the presence

of hemolysin genes and relevant phenotypes were detected. In this study,

98.2% of the 219 STEC isolates contained the hlyA gene, 59.6%(ehx) and

99%(sheA) were founded by PCR analysis (Fig. I-6). Clinical data were

provided for 223 patients. The patients were divided into nine groups

according to their clinical status (Table I-8). A majority (83 cases)

suffered from nonbloody diarrhea, 46 patients had bloody diarrhea. A

group of asymptomatic excreters(30 cases) was formed from patients who

had recovered from diarrhea or were sampled in control investigations. A

few patients(94 cases) were reported to have disease other than bloody or

non-bloody diarrhea. Hemolysin type were arranged in six mainly

characteristics, type 1 to 6, which show Table I-7. These were type 1

(hlyA+, ehx+ and sheA+); type 2 (hlyA+ and sheA+), type 3(only hlyA+),

type 4 (only ehx+), type 5 (only sheA+), and type 6 (ehx+ and sheA+).

Severe disease, such as bloody diarrhea and HUS, was significantly

associated with ehx, hlyA, and sheA-positive STEC (type 1).

The characterization of hemolysis pattern in STEC by

detection hemolytic activity on human blood agar plates has shown that

the α hemolysis pattern in type I(Fig. I-6 and table I-7) and other patterns

33

were not observed the hemolysis(γ).

34

(A) (B)

Figure I-6. PCR analysis for hemolysin genes and hemolytic activity

on sheep blood agar plate. (A) Amplification of hemolysin genes. DNA

was extracted from STEC EDL933 and subjected to PCR amplification.

Lane M, 100bp DNA ladder; lane 1 to 3, PCR products for ehx (212bp)

amplification; lane 4 to 6 amplicon of hlyA gene(561bp); lane 7 to 9,

amplicon of sheA(920bp) gene. (B) Phenotypically, the bacteria

expressing hemolytic activity showed a clearance zone on sheep blood

agar plates. a: ehx+ and sheA+(type6) STEC strain, b: hlyA+, ehx+ and

sheA+(type1) STEC strain, c: hlyA+ and sheA+(type2) STEC strain.Arrow

indicate that partial hemolysis(α-hemolysis).

561bp

212bp

920bp

M 1 2 3 M 4 5 6 M 7 8 9

561bp

212bp

920bp

M 1 2 3 M 4 5 6 M 7 8 9

aaaa bbbb ccccaaaa bbbb cccc

35

Table I- 7. Distribution of the hemolysin genes and relevant

phenotypes on sBAP

49γor nonetype6 (ehx, sheA)

25γtype5 (sheA)

7γtype4 (ehx)

11γor nonetype3 (hlyA)

40γ**type2 (hlyA, sheA)

91α*type1 (hlyA, ehx, sheA)

No. of casesHemolysispatterns on sBAPTypes of hemolysingenes

49γor nonetype6 (ehx, sheA)

25γtype5 (sheA)

7γtype4 (ehx)

11γor nonetype3 (hlyA)

40γ**type2 (hlyA, sheA)

91α*type1 (hlyA, ehx, sheA)

No. of casesHemolysispatterns on sBAPTypes of hemolysingenes

* α: partial hemolysis, ** γ: no hemolysis.

36

Table I-8. Relationship between hemolysin types and patients with

clinical signs

Type1 (hlyA, ehx, sheA ) Type2 (hlyA, sheA )Type3 (hlyA )Type4 (ehx )Type5 (sheA )Type6 (ehx, sheA )bloody diarrhea( n =46 ) 40 2 - - 2 2

diarrhea( n =83 ) 17 14 4 3 13 32abdominal pain( n=22 ) 9 2 3 2 - 6

chill ( n=3 ) 2 - - - - 1fever ( n=19 ) 10 4 1 1 2 1

vomiting(n =14 ) 6 3 - - 2 3asymtomatic( n=30 ) 7 12 2 1 4 4

headache ( n=4 ) - 1 1 - 2 -cough( n=2 ) - 2 - - - -

SymtomesDistribution of cases( n )

37

PFGE pattern of STEC O157 isolates

A dendrogram based on similarities of XbaI digested DNA PFGE

patterns among STEC O157 strains was created with the Bionumerics

software (Applid Maths. Inc., Austin, U.S.A.) using Jaccard similarity

indices as described above. Digestion of chromosomal DNA with XbaI

yielded 17 to 24 bands. PFGE patterns were arranged in three mainly

clusters, A to C, which show more than 55% similarity in their band

patterns (Fig. I-7). These were cluster A (57.79% similarity, 6 strains

from metropolitan areas); cluster B (75.67% similarity, 4 strains carried

stx1 and stx2); cluster C (82.91% similarity, 4 strains possessed stx2 only)

38

Figure I-7. Dendrogram of XbaI macrorestriction electrophoretic patterns of the 26 isolates of STEC O157. Percent

similarities were identified on a dendrogram derived from the unweighted pair group method using arithmetic averages and

based Jaccard coefficients. a Pt means patient and stx means gene encode shiga toxin.

Pt1(R:seoul, stx1,2)Pt2(R:kangwon, stx1,2)Pt3(R:kyonsang, stx2)Pt4(R:chunchong, stx2)Pt5(R:seoul, stx2)Pt6(R:kyongki stx2)

Pt17(R:chungchong, stx2)

Pt20(R:cholla stx2)

Pt25(R:kyongsang, stx2)

Pt7(R:seoul, stx1)Pt8(R:kyungki, stx1,2)Pt9(R:seoul, stx1,2)Pt10(R:kyungki, stx1,2)Pt11(R:seoul, stx1,2)Pt12(R:seoul, stx1,2)Pt13(R:kyungki, stx1,2)Pt14(R:seoul, stx1,2)Pt15(R:cholla, stx1,2)Pt16(R:kyungki, stx2)

Pt18(R:kyungki, stx2)Pt19(R:kyungki, stx2)

Pt20(R:kyongsang, stx2)

Pt20(R:kyungki, stx2)Pt20(R:chungchong, stx2)Pt20(R:kyongsang, stx2)

Pt26R:kyongsang, stx2)

Cluster A (57.79%)

Cluster B (75.67%)

Cluster C (82.91%)

Pt1(R:seoul, stx1,2)Pt2(R:kangwon, stx1,2)Pt3(R:kyonsang, stx2)Pt4(R:chunchong, stx2)Pt5(R:seoul, stx2)Pt6(R:kyongki stx2)

Pt17(R:chungchong, stx2)

Pt20(R:cholla stx2)

Pt25(R:kyongsang, stx2)

Pt7(R:seoul, stx1)Pt8(R:kyungki, stx1,2)Pt9(R:seoul, stx1,2)Pt10(R:kyungki, stx1,2)Pt11(R:seoul, stx1,2)Pt12(R:seoul, stx1,2)Pt13(R:kyungki, stx1,2)Pt14(R:seoul, stx1,2)Pt15(R:cholla, stx1,2)Pt16(R:kyungki, stx2)

Pt18(R:kyungki, stx2)Pt19(R:kyungki, stx2)

Pt20(R:kyongsang, stx2)

Pt20(R:kyungki, stx2)Pt20(R:chungchong, stx2)Pt20(R:kyongsang, stx2)

Pt26R:kyongsang, stx2)

Cluster A (57.79%)

Cluster B (75.67%)

Cluster C (82.91%)

39

4. Discussion

The death rate for Koreans with intestinal infectious diseases is about 97

people per year. Thirteen (13.4%) deaths were attributed to bacterial

food-born disease (http://www.nso.go.kr). Most of the patients were

found to be children under 10, as well as those 60 and older. Fortunately,

those deaths with STEC infections have not been reported since 2003

(http://www.cdc.go.kr). However, STEC can cause severe disease and

death in humans (Kaper, 1998), and it has also emerged as an important

food-borne pathogen in humans in Korea (Cho et al., 2006; Kim et al.,

1989).

In the late 1990s, low STEC infection among patients with diarrhea

was reported. The reason for this might be the lack of proper surveillance

for STEC, or that STEC is present, but relatively few infections occurred

due to acquired immunity in the population. The present isolated

condition of STEC, since its designation as a first-grade legal epidemic in

2000, has been identified to increase from 2001 to 2004, and about 20 to

25 cases have been detected every year since its mass outbreak in 2004.

Because these isolated cases maintain the figure persistently, the

operation of a continuous lab surveillance network and the maintenance

of the diagnoses are necessary. This includes the long term research

40

through symptoms, the progress of patients, and the exchange of

information between research groups.

Our findings suggest that STEC strains are a significant cause of

human infections in Korea; infections by non-O157 STEC strains are

more common than those caused by O157 strains. Figure I-1 and Table I-

2 indicates that STEC strains were detected in 223 cases, with a

progressive increase from 0.4% (1 isolate) in 1998 to 46.2% (103

isolates) in 2004. Sex had no statistically significant influence on STEC

excretion for patients in each year. There was an insignificant tendency

for the number of male patients to be higher than female patients.

The seasonal prevalence of the isolated bacterial species was

analyzed. In general, the number of sporadic STEC infections peaks in

the summer (Almirante et al., 2005; Banatvala et al., 2001; Pradel et al.,

2000; Vaz et al., 2004). In Korea, the peak of cases occurred from June

through August (Fig. I-2). Recently, it was caused by high temperature

with a climate change, and infected patients were found in September and

October. In other studies (Banatvala et al., 2001; Beutin et al., 2004),

infections with STEC had seasonal peaks in the warmer months.

Human infection with involved in E. coli O157 has been reported

in at least 30 countries on six continents. In the U.S., 196 outbreaks or

sporadic cases were documented throughout 1998, and the number of

reported outbreaks increased from two cases in 1982 to 42 cases in 1998

41

(Nataro and Kaper, 1998). According to outbreak surveillance data from

the CDC, reported infections of E. coli O157 increased annually since

1994, had a peak of 4,744 individual patients in 1999, and then decreased

to 2,544 in 2004 and 2,621 in 2005. The distributions of isolates in

humans were markedly different in the U.S.A. comparison of increasing

tendency produced similar results to our own.

In the Korean outbreaks, the mode of transmission is most often

food, followed by person-to-person distribution, usually in elementary

school in 2004 (more than 70 cases). According to previous studies, large

outbreaks or sporadic cases of STEC O157 and non-O157 STEC strains

have been reported in Canada, Japan, and the U.K. (Nataro and Kaper,

1998). However, increasing data indicates that non-O157 STEC

infections may be more frequent than E. coli O157:H7 infections in

continental Europe, Australia, and Latin America, indicating the

possibility of differential geographic distribution(Beutin et al., 2004;

Boerlin et al., 2002; Cobelijic et al., 2005; Espie et al., 2008; Leotta et al.,

2008). In this study, a concentration in the metropolitan area involved in

Seoul and Kyungki-do was confirmed (Fig. I-3). This may indicate that

the occurrence of person-to-person STEC infection correlates with the

geographical distribution of the human population.

Since the early 1940s, it has been known that the antigenic

specificities of the bacterial cells could constitute a solid basis for a

42

refined subdivision into serotypes (Nataro and Kaper, 1998). A

classification system, in which E. coli was subdivided into different O

(lipopolysaccharide), K (capsular), and H (flagellar) antigens, was

proposed. Presently, 173 O, 56 H and 80 K antigens are recognized

(Blanco et al., 1996). In many developed countries, O157:H7 is the most

prevalent STEC serotype associated with severe disease in humans

(Kaper et al., 2004). The VTEC serotypes most frequently associated

with human disease include O26:H11, O111:H8, O157:NM, and

O157:H7 (http://www.microbionet.com.au). This study indicated that the

largest cases among all the strains were from the O91 serogroup, and it

was because the outbreak in Kwangju city in 2004 was included. In

addition, the serogroup of the strains that had many cases were

unidentified form. The undetermined serogroup that can not be detected

by the currently commercialized kit method and other undetermined

serogroups are on the rise. It is necessary that the detection method for

the O serogroup be improved. We also noted that the domestic cases of

O157 have been detected constantly every year. Most of serogroups were

O157 from STEC isolates in Korea.

The present study employed a range of all STEC organisms

isolated from symptomatic and asymptomatic patients in Korea with

virulence factor genes. Most of the STEC infections detected in this study

were sporadic, and the sources of infection were not identified in most

43

cases. In this study, 63(28.3%) STEC strains carried the stx2 gene only,

45 (20.2%) isolates carried the stx1 gene only, and 115 (51.5%) isolates

carried both genes. The key virulence factor for STEC is Stx, which is

also known as verocytotoxin (VT) (Nataro and Kaper, 1998). Previous

studies have shown that the virulence of STEC for humans may be

related to the type of Shiga toxin which is produced by gut bacteria

(Boerlin et al., 1999). In a study concerning Stx production as a single

microbial factor, the most pathogenic strains for humans have been found

to produce Stx2 only. The Stx2 toxin has been described as being 1,000

times more cytotoxic than Stx1 toward human renal microvascular

endothelial cells (O’brien and Holmes, 1987). In other studies, Stx2 was

found to be related to high virulence and was significantly associated

with STEC strains from bloody diarrhea and HUS patients (Bielaszewska

et al., 2007). Most previous studies (Beutin et al., 1996; Boerlin et al.,

1998; Eklund et al., 2001) on the distribution of virulence genes focused

on stx genes, enterohemolysin, and other putative virulence genes. Like

other authors (Blanco et al., 1996; James et al., 2006; Medellin et al.,

2007), these results indicated that STEC isolated from beef and human

STEC have similar virulence properties.

Production of intimin is not essential for pathogenesis because a

number of sporadic cases of HUS have been caused by eae-negative non-

O157 STEC strains (Scaletsky et al., 2005; Schmidt et al., 2001).

44

Additionally, by identifying the expression difference of the putative

adherence factors of eae-negative strains, the tests to confirm the

expression difference between the auxiliary factors which substitute LEE

based adherence factors as well as eae and tir could be performed

together. According to this result, the existence of LEE-based adherence

factors controls the expression difference of the putative genes (iha, toxB,

saa, and efaI) and substitutes their roles. Although an additional test is

necessary, it is possible to assume that they will take a critical role in the

pathogenic factor of STEC.

These results indicated that several genes were proposed to be

novel adhesion factors and putative adhesions, It might be that complex

mechanisms regulating among the several adhesion genes. Differentiation

of intimin alleles represents an important tool for STEC typing in routine

diagnostics as well as in pathogenesis, epidemiological, clonal, and

immunological studies (Karmali et al., 1989; Karmali et al 1983; Kim et

al., 1989; Leotta et al., 2008; Lu et al., 2006). This observation led to the

construction of allele-specific PCR primers, which has made it possible to

differentiate three variants of the eae gene encoding three different

intimin types (α, β, and γ). In this study, two eae variants were

differentiated: γ (in 118 isolates) and β (in 42 isolates). Also, type III

secretion system (T3SS) mediated and LEE-encoded genes from STEC

strains were detected; these genes were involved in ler (LEE-regulator),

45

tir, espA, espB, and mediated espD.

The surprising finding of this study was that 39 isolates from

bloody diarrheal patients tested, 36 cases possessed hlyA, ehx and sheA

carried all of them. As yet, the role of enterohemolysin as an E. coli

virulence factor has not been fully elucidated. It is likely that the

enterohemolysin is expressed during human infection and subsequent

disease, as patients suffering from O157-associated HUS produce serum

antibodies specific to the enterohemolysin from STEC O157 in almost all

cases (Schimidt et al., 2001). It might be that the complex mechanisms

regulating expression of hemolysin genes assist with each other, posing a

selective condition their coexistence in host cell. With in vitro culture on

washed human blood agar, a variety of enterohemolysin activity levels

were noted in this study (Fig. I-6B). It has also been suggested previously

the variation in levels of enterohemolysin secretion and, therefore, of

visible hemolysis may be a characteristic of double or single methionine

residue in the N-terminal region of EhxB (Taneike et al., 2002). However,

this possibility has not been substantiated, and additional work is required

to establish a correlation between the hemolysin genes.

An antibiotic susceptibility test for STEC strains was performed to

examine the resistance patterns. A total of 16 were used to examine the

patterns for the test, and the drugs used were composed of 4 β-lactams, 3

cephems, 4 aminoglycosides, 2 quinolones, and chloramphenicol,

46

tetracycline, and sulfamethoxazole. 51% of the total strains had a

tolerance to tetracycline; these were ampicilin (AM), ticarcillin (TIC),

and cepalothin (CF) in order of the highest tolerance rate. Most strains

among them showed multidrug resistance patterns, of more than 2 to 3

antibiotics. We found a high prevalence of antimicrobial resistance in our

study. The results for the multidrug resistant patterns are shown in Table

I-8. Previous studies reported that the majority of E. coli showed

resistance to ampicillin, aztreonam, cefaclor, cephalothin, cinoxacin, and

nalidixic acid, and all isolates were susceptible to chloramphenicol and

florfenicol. Mora et al. (2007) also detected, among STEC strains, an

association between higher levels of multiple resistances to antibiotics.

Antibiotics should not be administered to patients with definite or

possible EHEC infections, because antibiotics use during E. coli

O157:H7 infections has been associated with an increased risk of

developing HUS in children(Wong et al., 2000) and adults(Dundas et al.,

2001). Similarly, anti-motility diarrhoea, because these agents have also

been associated with an increased risk of HUS development (Cimolai et

al., 1994).

By PFGE, three distinct clusters were discovered among STEC

O157 strains isolated from 1998 to 2006. In addition, all O157 strains

found during the enhanced surveillance period differed from one another.

However, strains of the genotypes of the domestic STEC O157:H7

47

isolates detected during the enhanced surveillance period have been

found since then. The number of PFGE genotypes found in this study was

lower than the number found, for example, in a previous study in

Minnesota, U.S. (Tenover et al., 1995), where 317 O157:H7 STEC

isolates were subtyped by PFGE and XbaI digestion, and 143 distinct

PFGE patterns were generated with the software that the investigators

used. On the other hand, in a previous Japanese study, 825 STEC

O157:H7 isolates were similary subtyped but were classified into only six

PFGE types (Watanabe et al., 1999). Similarly, Kawano et al. (2008)

found that four clusters identified by PFGE using restriction enzyme XbaI,

stx genotypes, and clinical manifestations correlated with one another.

Reports of outbreaks and sporadic cases of STEC infection have

been increasing in recent years, in part due to better reporting and in part

due to a genuine increase in infections. Despite the increasing awareness

of STEC infections on the part of public health officials and the public in

general, the outbreak of STEC disease in Japan in the summer of 1996

was a great surprise because the size of the outbreak far exceeded any

reported outbreaks. Over 9000 cases were reported, which exceeded the

largest previously reported outbreak by an order of magnitude. Molecular

epidemiologic techniques, specifically pulsed-field gel electrophoresis

(PFGE) and random amplified polymorphic DNA polymerase chain

reaction (RAPD-PCR), showed that this large outbreak actually consisted

48

of multiple outbreaks with the largest cluster of cases (more than 6,000

cases) showing PFGE and random RAPD-PCR patterns different from

those found in isolates epidemiologically unrelated to this cluster (Vogel

et al., 2000). PFGE has also been used for routine surveillance to identify

otherwise undetected outbreaks (Beutin et al., 2005; Islam et al., 2007;

Manning et al., 2008; Schmidt et al., 2005) and is being adapted to

establish national databases for rapid strain comparison.

These results show the distribution of virulence genes and

serotypes of STEC isolated from symptomatic and asymptomatic patients

in Korea. Thus, this study can provide useful information about the trend

of STEC infections in the general population, and it represents an

important means to identifying serogroups and the distribution of

virulence genes that are highly pathogenic to human. The present study

has identified bacterial pathogens that are significantly associated with

diarrhea. This new knowledge regarding the etiology of diarrhea in the

surveyed patients will help us plan studies to investigate the various

aspects of diarrhea.

In conclusion, STEC represents a serious public health threat in

Korea in terms of the potential to cause life threatening human disease.

Prevention and control of STEC strains causing human illness is a high-

priority concern for Korea and is driven by the high associated medical

care costs, the loss of productivity, economic loss, and the increased

49

morbidity and mortality associated with this condition. This further

emphasizes the need for more rapid, sensitive, and simple methods to

improve diagnostic yield. We have been targeted to various virulence

genes and profiled them. Clinical laboratory in Korea have limitation for

diagnostic approaches and it should be improved. Profiling of virulence

factors is very important for STEC diagnosis and understanding of STEC

pathogenesis. General recommendations for optimal sampling should be

established so that cost-effective routines can be designed for both

epidemiological investigations and clinical use. Profiling of several

virulence genes could be a candidate for vaccine development, although

their roles as a factor for pathogenesis in STEC strains should be proved

experimentally. Continuous comparison and analysis between the

epidemiological data and the research on the molecular characteristics of

STEC in this study will help prepare the data and to understand the

etiological mechanism of STEC.

50

CHAPTER II

LuxS mediated quorum sensing and

expression of virulence in Escherichia coli

O157:H7

51

1. INTRODUCTION

Quorum sensing (QS) is an important mechanism of cell-to-cell

communication that involves density dependent recognition of signaling

molecules, resulting in modulation of gene expression. The first report of

a potential role for QS in gastrointestinal (GI) infections was published in

1999 (Surette et al., 1999), and many reports for different GI pathogens

have followed. QS was first characterized in the marine bacterium Vibrio

fischeri (Nealson et al., 1970). Since the initial description for V. fischeri,

QS has now been recognized to regulate a wide range of activities in

diverse bacteria, including plasmid transfer and plant tumor induction by

Agrobacterium tumefaciens, antibiotic production in Erwinia carotovora,

biofilm production and virulence gene expression in Pseudomonas

aeruginosa, competence for DNA uptake in Streptococcus pneumoniae,

and virulence gene expression in numerous pathogens, including

Staphylococcus aureus, Vibrio cholerae, and pathogenic E. coli(Anand et

al., 2003; Barrios et al., 2006; Clarke et al., 2003; Cloak et al., 2002;

Henke et al., 2004). Three major QS circuits have been described; one is

used primarily by gram-negative bacteria; another is used primarily by

gram-positive bacteria; and the third has been proposed to be universal

and allows interspecies communication and is found in both gram

52

negative and gram positives. This mechanism regulates important

microbial processes such as growth, toxin production, virulence,

sporulation, antibiotic synthesis, colonization and motility in a variety of

bacteria through alterations in the pattern of gene expression (Armitage et

al., 2005; Crepin et al., 2005; Delisa et al., 2001; Donnenberg et al.,

1998; Xu et al., 2006; Yang et al., 2006).

A recent breakthrough in the field of bacterial pathogenesis is that

bacterial virulence expression is controlled by quorum sensing, a

universal adaptive response triggered by small signaling molecules called

Autoinducers (AIs). AIs are secreted and accumulated outside the cells as

bacterial cell population increases. In bacteria, 4 different AI molecules

have been reported: AI-1, AI-2, AI-3, and AI-peptides like Streptococcal

pheromones. Among those molecules, however, AI-2 and -3 mediated QS

signaling have been extensively studied in EHEC O157:H7. The

synthesis of AI-2 requires a series of biochemical conversions of S-

adenosylmethionine to homocysteine catalyzed by the enzymes Pfs and

LuxS (Keersmaecker et al., 2006; Schauder et al., 2001; Zavilgelsky and

Manukhov, 2001). However, the LuxS function does not seem to be

limited to the production of AI-2 because increasing evidence suggests

that luxS mutation shows pleiotropic phenotypes, some of which could

not be restored by a simple addition of purified AI-2. Such phenotypes

include swarm motility and LEE expression.

53

Indeed, recent studies demonstrated that LuxS is involved in

the production of another signaling molecule AI-3, QS-dependent

motility, and LEE expression. Interestingly, it is known that both AI-2

and -3 are universal to many bacterial species as well as AI-3, and

mammalian hormones, such as epinephrine and norepinephrine, are

proposed to be recognized by the same receptor(s) such as QseBC and/or

QseEF component systems. However, the biological significance of both

AI-2 and -3 is not clearly understood; therefore, those signaling

molecules are important for both inter-species and inter-kingdom

communication. AI-3 has also been shown to regulate EHEC virulence

and flagellar gene expression (Sperandio et al. 2003) and function similar

to the human hormone epinephrine (Walters and Sperandio, 2006), on

EHEC virulence and infection has not been fully understood.

The ability to coordinate behaviour in a cell-density-

dependent fashion has several obvious advantages. In the case of

pathogenic microorganisms, the regulation of virulence determinants

throughout the infection process is believed to play an important role in

pathogenicity. Evading host defenses is a major goal of pathogens, and as

such, quorum sensing is an important asset because it enables bacteria to

appropriately time the expression of immune response activating products.

Using quorum sensing, bacteria can amass a high cell density before

virulence determinants are expressed, and in doing so, the bacteria are

54

able to make a concerted attack, produce ample virulence factors, and be

present in sufficient numbers to overwhelm the host defences (Kievit and

Iglewski, 2000). It has been shown that many pathogens use quorum

sensing to regulate virulence (Miller and Bassler, 2001). In this regard,

enterohaemorrhagic E. coli (EHEC), which have caused great concern to

the food industry, has an important case for establishing any such quorum

sensing-based system for virulence expression so that it may distinguish

between an intestinal environment containing large bacterial populations

and an extra-intestinal location where bacterial numbers would probably

be low. These organisms colonize the large intestine and produce a potent

toxin, Shiga toxin (Stx), resulting in haemorrhagic colitis and haemolytic

uremic syndrome in a significant proportion of infected people (Nataro

and Kaper, 1998).

The EHEC causes a histopathological lesion on intestinal

epithelial cells termed attaching and effacing (AE). This lesion is

characterized by the destruction of microvilli and the rearrangement of

the cytoskeleton to form pedestal-like structures that cup the bacteria

individually. The genes involved in the formation of the AE lesion are

located on a pathogenicity island termed the Locus of Enterocyte

Effacement (LEE) (McDaniel et al., 1995; Elliot et al., 1998). The region

contains (i) sep and esc genes encoding a type III secretion system (Jarvis

et al., 1995); (ii) the eae gene encoding an adhesin called intimin that is

55

responsible for the intimate attachment of bacteria to the epithelial cell

(Jerse and Kaper, 1991); (iii) the espABD genes, which encode proteins

secreted by the type III secretion system, including EspA, which forms a

filamentous secretion tube and EspBD, which are believed to facilitate

pore formation at the host surface and thereby complete the conduit for

delivery of proteins from the bacterium into the host cell cytoplasm

(Donnenberg et al., 1993; Kenny et al., 1996; Lai et al., 1997; Knutton et

al., 1998); (iv) the tir gene, which encodes the translocated intimin

receptor, the receptor for intimin (Kenny et al., 1997); and (v) the ler

gene (LEE-encoded regulator), which encodes a positive regulator of

LEE genes (Mellies et al., 1999). Sequence analysis of the conserved

sequence of LEEs for EHEC revealed 41 ORFs that are highly conserved

at the DNA and protein levels for the type III secretion genes, but were

more variable for the esp, eae, and tir genes.

The majority of the LEE genes were reported to be in five

major polycistronic operons named LEE1 through LEE4 and tir (Perna et

al., 1998; Mellies et al., 1999; Elliot et al., 1999). A definite role for

quorum sensing in the regulation of expression of the type III secretion

system in EHEC has been shown. Using lacZ reporter gene fusions, it

was shown that the expression of the LEE operons encoding the type III

secretion system, translocated intimin receptor, and intimin was regulated

by quorum sensing in enterohaemorrhagic E. coli (Sperandio et al., 1999).

56

Mutation and complementation studies showed the luxS gene

to be responsible for the production of autoinducer in both V. harveyi and

for the regulation of LEE operons in E. coli. It was also suggested that

intestinal colonization by E. coli O157:H7, which has a very low

infectious dose, could be induced by the quorum sensing of signals

produced by nonpathogenic E. coli and other organisms that possess the

luxS gene (e.g., Enterococcus and Clostridium), which are present as part

of the normal intestinal microflora. By hybridizing an E. coli gene array

with cDNA synthesized from RNA that was extracted from EHEC strain

86-24 and its isogenic luxS mutant, it was shown that expression of 404

genes were effected by the luxS mutation. The transcriptional regulation

was further confirmed using operon: lacZ fusions to class-I, -II, and -III

flagellar genes. Quorum sensing was suggested as a global regulatory

mechanism for basic physiological functions of E. coli, as well as for the

control of virulence factors (Sperandio et al., 2001).

Previously, several phenotypical studies were used to

understand LuxS/AI-2 mediated signaling in EHEC O157:H7 using a

defined luxS mutant strain (e.g., VS94) and in-vitro purified/synthesized

AI-2 molecules. However, the results might vary depending on the

culture conditions (i.e., culture media, growth phase, or anaerobiosis,

etc.) and the strains isolated from the different sources. In this study, a

defined nonpolar luxS deletion in strain CI03J was constructed, this strain

57

was an EHEC O157:H7 human isolate in Korea, and the goal of this

study was to investigate the effect of luxS/QS system on phenotypes

related to EHEC virulence and infection.

58

2. MATERIALS AND METHODS

Bacteria and growth conditions

The bacterial strains and plasmids used in this study are listed in table

II-1. All E. coli strains were grown at 37 with aeration at 200 rpm in ℃

Luria-Bertani medium (LB) or LB containing 0.2% glucose. When

necessary, the antibiotics were added into the media at the following

concentrations: ampicillin(Ap), 200 ㎍/ml; kanamycin(Km), 50 ㎍/ml;

chloramphenicol(Cm), 30 ㎍/ml.

Construction of an E. coli O157:H7 luxS mutant

strain

An clinical isolate EHEC O157:H7 luxS deletion mutant was

constructed by the linear recombination (λRed) method of Datsenko and

Wanner (2000). Briefly, the oligonucleotides (Table II-2) were used to

amplify by PCR the kanamycin resistance cassette from the nonpolar

plasmid template pKD13. The resulting product was then transformed by

electroporation into CI03J carrying pKD46, grown at 30 in the ℃

presence of 10 mM arabinose). Integrates cured of pKD46 and lacking

the luxS coding sequence were selected by growth on LB agar containing

59

ampicillin(100 ㎍/ml) and kanamycin(50 ㎍/ml) at 42 , and mutations ℃

were confirmed by PCR. More than 95% of coding sequence of luxS was

deleted, leaving behind the 5' and 3' ends of the gene encoded by the

oligonucleotides. The strain was designated ML03J.

Construction of complemented strain with pEXEP5-

CT

A strain having the luxS gene complemented was created using a

topoisomerase system. The luxS gene was amplified from purified CI03J

template by PCR using primers (Table II-2). The gene was inserted into

topoisomerase recognition sites of pEXEP5-CT and transformed by

electroporation into the donor strain ML03J, creating a strain called

RL03J. The strain RL03J were conjugated with ML03J. This resulted in

strain RL03J, which is the RL03J that carries a single copy of luxS on the

ampicillin at the topoisomerase recognition site and has restored luxS

expression.

Growth curves

Strains CI03J, ML03J, and RL03J were grown for 12hrs in Luria Bertani

medium (Difco, Detroit, U.S.A.) and 0.2% glucose containing LB

medium at 37 , diluted 1:500 in fresh LB medium, and grown at 37 ℃ ℃

60

with shaking at 200 rpm. OD600 measurements were taken every hour.

Motility assays

Motility assays were performed at 37 on 0.3% agar plates containing ℃

DMEM, DMEM without glucose, tryptone broth. Plates were inoculated

using sterilized toothpicks and incubated for 24 hrs. in a 37°C incubator

and the diameter of each motility halo was measured at 4, 7, 12, and 24

hrs.

RNA preparation

Bacterial strains were routinely grown at 37 in LB containing gl℃ ucose

(0.2%, vol/vol). Cultures were grown with good aeration (250 rpm) and

growth was measured at OD600 using a GeneQuatTM pro

spectrophotometer. RNA from 500 ㎕ of mid-logarithmic culture was

stabilized using the RNA protect reagent (Qiagen, Valencia, U.S.A.)

according to the manufacturer's instructions. Total RNA was isolated

using the RNeasy mini kit for total RNA isolation (Qiagen, Valencia,

U.S.A.).The eluted RNA was subjected to DNase I digestion using the

RQ1 RNase-free DNase (Promega, Wisconsin, U.S.A,) according to the

manufacturer's instructions, to remove the possibility of DNA

contamination.

61

cDNA microarray

The integrity of bacterial total RNA was checked by capillary

electrophoresis with an Agilent 2100 Bioanalyzer (Agilent, Palo Alto,

U.S.A.) and further purified with an RNeasy Mini Kit (Qiagen, Valencia,

U.S.A.). cDNA probes for cDNA microarray analysis were prepared by

the reverse-transcription of total RNA (50 ㎍) in the presence of

aminoallyl-dUTP and 6ug of random primers (Invitrogen, Carlsbad,

U.S.A.) for 3 hrs. The cDNA probes were cleaned up using Microcon

YM-30 column (Millipore, Bedford, U.S.A.) and then followed by

coupling of Cy3 dye (for reference) or Cy5 dye (for test sample)

(Amersham Pharmacia, Uppsala, Sweden). The Cy3 or Cy5-labeled

cDNA probes were purified with QIAquick PCR Purification Kit (Qiagen,

Valencia, U.S.A.). Dried Cy3 or Cy5 labeled cDNA probes were

resuspended in hybridizationbuffer containing 30% formamide, 5 × SSC,

0.1% SDS, 0.1 mg/ml salmon sperm DNA. The Cy3 or Cy5 labeled

cDNA probes were mixed together and hybridized to a microarray slide.

After overnight at 42 , the slide was washed twice with washing ℃

solution 1 containing 2 × SSC, 0.1% SDS for 5 min at 42 , and once ℃

with washing solution 2 containing 0.1 × SSC, 0.1% SDS for 10 min at

room temperature, and finally four times with 0.1 × SSC for 1 min at

room temperature. The slide was dried by centrifugation at 650 rpm for 5

62

min. Hybridization image on the slide was scanned by Axon 4000B

(Axon Instrument, Union City, U.S.A.).

Data analysis

Hybridization image was analyzed by GenePix Pro 3.0 software (Axon

Instrument, Union City, U.S.A.) to obtain gene expression ratios

(reference vs test sample). Gene expression ratios were normalized by

GenePix Pro 3.0 software (Axon Instrument, Union City, U.S.A.).

Clustering image was obtained from hierarchical clustering (Eisen et al.,

1998), which involves computing 'distances' between data elements.

Transmission electron microscopic (TEM) analysis

In general, samples were prepared for TEM by negative staining on glow

discharged Formvar-coated grids, using 3% uranyl acetate. A sample of

bacteria culture (5 ml) was centrifuged at 10,000 rpm for 1.5 min and the

cell pellet was resuspended in 1 ml 50 mM KH2PO4 buffer. 10 ml cell

suspensions were applied to cover the grid surface and sedimented for 2

minutes. 5 ml of 3% uranyl acetate was applied onto each grid and

staining for 1 min. Excess liquid was removed by using filter paper. Grids

were examined in a transmission electron microscope JEOL JEM1010 at

a voltage of KV80.

63

Cell adherence assay

Assessment of bacterial adherence to tissue culture cells was performed

as described by Cravioto et al. (1991) with HEp-2 and HeLa cells with

some modifications. Briefly, HEp-2 cells maintained in D-MEM

supplemented with 10% fetal bovine serum (FBS) and HeLa cells D-

MEM supplemented with 10% FBS, were plated onto coverslips in 24-

well tissue culture plates at a density of 2 × 105 cells per well and then

incubated at 37 for 16 h fo℃ r HEp-2 and HeLa cell in the presence of

5% CO2. Before infection, old medium was replaced with D-MEM

supplemented with 10% FBS for HEp-2 or HeLa cell, respectively, with

1% (w/v) D-mannose. E. coli cells were grown overnight at 37 in LB ℃

medium, and 107 bacterial cells were inoculated into each well. The cells

were incubated for 1.5 hrs at 37 in the presence of 5% CO℃ 2, washed 3

times with phosphate-buffered saline (PBS) to remove nonadherent

bacteria, and incubated an additional period of 5 h in the same medium.

Following the incubation period, cells were washed 5 times with PBS,

fixed in methanol, and stained with Giemsa solution (Gibco, Carlsbad,

U.S.A) for microscopic evaluation.

Amplification of LEE genes by reverse transcriptase

real time PCR

64

Cultures of strains CI03J, ML03J and RL03J were grown aerobically in

LB medium at 37 overnight and then were diluted 1:100 in LB and ℃

grown in a shaking incubator at 37 . RNA was extracted from each ℃

strain per condition at the late exponential growth phase (optical desity at

600 nm, 0.8~0.9) using the RNeasy mini kit (Qiagen, Valencia, U.S.A.).

For reverse transcriptase real time PCR, the 20㎕ reaction mixture was

prepared by 2㎕ of total RNA, 0.6 mM of each primer, respectively, and

reference dye SYBR Green. The number of copies was calculated, and

dilutions ranging from 100 pg to 100 ng copies of this standard wrer

prepared in a TE buffer. Aliquots of these dilutions were frozen at -20 . ℃

Throughout this study, the Quantitect SYBR Green master mix kit

(Qiagen, Valencia, U.S.A.) was used for all reactions with real time PCR.

The parameters for RT-PCR included 30min incubation at 50 for ℃

converting mRNA to cDNA. Subsequent amplification of cDNA was

carried out by using an initial cycle of 95 for 10 min followed by 40 ℃

cycles of 94 for 30s, 55 for 30s, and 72 for 60s. The final ℃ ℃ ℃

extension was carried out at 72 for 2 min. Reaction conditions for ℃

amplification and parameters for fluorescence data collection were

programmed into a Opticon Monitor Software package 1.4. (DNA engine

Opticon 2; MJ Research, Watertown, U.S.A.).

65

Cytotoxicity assays

The WST assay was carried out. In the present study, results obtained

with the WST assay are shown mainly because it is more sensitive than

the MTT assay, while the principle of the measurement is similar. The

WST assay is based on the conversion of the tetrazolium salt WST to

highly water soluble formazan by viable cells. Ten microliters of the Cell

Count Reagent SF (Nacalai Tesque, Wisconsin, U.S.A.), which consists

of 5 mM WST, 0.2 mM 1-methoxy-5-methylphenazinium methosulfate,

and 150 mM NaCl was added to each well. After incubation for 1 hr at

37℃ the absorbance of each well was measured at 450 nm with a

reference wavelength at 655 nm. For the purpose of calculating percent

cytotoxicity values, background release from tissue culture cells was

considered as low (media only) control and Triton-X 100 (0.01%) treated

cells as high control. In case of bacterial mixture, 105 bacteria cell per

well was treated and incubated for 6 hrs at 37°C. Verotoxin producing

EDL933 (EHEC O157:H7) was used as positive controls, and E. coli

JM109 was used as negative controls in all assays.

Determination of cytolytic activity for human

erythrocytes

Bacterium-mediated lysis of erythrocytes was scored by a clearance

66

zone on blood agar plates incubation for 16 to 17 hrs at 37℃. As a

convenient assay for hemolysin activity, the release of hemoglobin from

erythrocytes essentially were quantified as described previously. Fresh,

toxin-containing supernatants were serially diluted twofold in 0.85%

NaCl and incubated with a 1% (final concentration) suspension of human

RBC at 37 for 2 h℃ rs. Reactions were terminated and unlysed cells were

removed by centrifugation at 740 × g. The amount of lysis was

determined by measuring released hemoglobin spectrophotometrically at

A572. RBC were incubated in H2O to measure total lysis, and background

lysis was determined with RBC incubated in saline. Percent lysis was

calculated from A572 measurements as follows: 100 × (A572 of sample -

A572 of background) / (A572 of total - A572 of background). Each dose-

response curve was graphed to display the points from the lower dilutions

of supernatant.

67

3. RESULTS

Identification of luxS from clinical isolate EHEC

strain

In order to determine whether EHEC has a luxS-dependent QS system,

the available EHEC genome was examined information and identified a

candidate ORF whose predicted protein was 43% identical and 63%

similar to the V. harveyi LuxS protein. The luxS gene of EHEC is an

dependent ORF (Fig. II-1), and its promotor is most likely located

upstream of the ORF. To investigate the effect of luxS mutation in CI03J,

a clinical isolate of E. coli O157 in Korea, this strain was constructed its

isogenic luxS mutant strain missing the entire structural gene by standard

one-step gene inactivation technique (Datsenko et al., 2000). Defined

genomic deletion was analyzed by PCR (Fig. II-1) and further confirmed

by DNA nucleotide sequencing.

As show in Fig. II-1, the DNA sequence analysis revealed that

the 698 bp genomic region containing both 164 bp upstream and 20 bp

downstream nucleotides of the intact luxS gene in CI03J was deleted and

replaced by the 81 bp scar nucleotides originated from the template

plasmid pKD13, where all three forward stop codons but no translation

signals have been reported (Doublet et al., 2008). The resultant luxS

68

mutant of CI03J was designated ML03J and further analyzed in this study.

69

Figure II-1. Scheme of construction luxS mutant EHEC O157:H7

strain. DNA sequence analysis revealed that the 698 bp genomic region

containing both 164 bp upstream and 20 bp downstream nucleotides of

the intact luxS gene in CI03J was deleted and replaced by the 81 bp scar

nucleotides originated from the template plasmid pKD13.

emrA emrB luxS gshA

emrA gshA

3605644 3606159

3605625 3606322

luxS+

luxS-

emrA emrB luxS gshA

emrA gshA

3605644 3606159

3605625 3606322

luxS+

luxS-

1,100bp

403bp

1,100bp

403bp

70

Table II-1. Bacterial strains and plasmids used in this study

Complementation strainRL03J

IsogenicluxS mutantML03J

Clinical isolate from patient with EHEC O157:H7(stx1 and stx2 possesed)CI03J

DH5α carrying pKD46ECK-04

DH5α carrying pKD13ECK-01

DH5α carrying pCP20BT340

Competent cellBL21

Competent cellTopo One shot Top10

Prior to adaptation with topoisomerase I, expression vectorpEXP5-CT

Ampr, Cmr, temperature-sensitive replication and thermal induction of FLP synthesispCP20

Red recombinase expression plasmidpKD46

Kmr casettespKD13

DescriptionStrains and Plasmids

Complementation strainRL03J

IsogenicluxS mutantML03J

Clinical isolate from patient with EHEC O157:H7(stx1 and stx2 possesed)CI03J

DH5α carrying pKD46ECK-04

DH5α carrying pKD13ECK-01

DH5α carrying pCP20BT340

Competent cellBL21

Competent cellTopo One shot Top10

Prior to adaptation with topoisomerase I, expression vectorpEXP5-CT

Ampr, Cmr, temperature-sensitive replication and thermal induction of FLP synthesispCP20

Red recombinase expression plasmidpKD46

Kmr casettespKD13

DescriptionStrains and Plasmids

71

Table II-2. Oligonucleotides used in this study

Primers Sequence(5'-3')

ygaG-F TACGCATAAAACCAGCAAAC

ygaG-R CGGGTGGCGAAAACAATGAA

FRT-1 GTGCGCACTAAGTACAACTA

FRT-2 CAGCAACGAAGAACTGGCACT

Lux test B CGCGAGGCGTCTGAACGC

Lux test T GGATGACGCAACAGCAGG

LuxS F GCGGTGCGCACTAAGTACAACTAAGCCAGTTCATTTGGTGTAGGCTGGAGCTGCTTC

LuxS R TGCGGTGTGGCTGGAAAAACACGCCTGACAGAAAAGATTCCGGGGATCCGTCGACC

Primers Sequence(5'-3')

ygaG-F TACGCATAAAACCAGCAAAC

ygaG-R CGGGTGGCGAAAACAATGAA

FRT-1 GTGCGCACTAAGTACAACTA

FRT-2 CAGCAACGAAGAACTGGCACT

Lux test B CGCGAGGCGTCTGAACGC

Lux test T GGATGACGCAACAGCAGG

LuxS F GCGGTGCGCACTAAGTACAACTAAGCCAGTTCATTTGGTGTAGGCTGGAGCTGCTTC

LuxS R TGCGGTGTGGCTGGAAAAACACGCCTGACAGAAAAGATTCCGGGGATCCGTCGACC

72

Growth and utilization of carbohydrates

To test if the luxS mutation results in any metabolic burdens in E. coli

O157:H7, therfore bacterial growth in LB medium containing 0.2%

glucose as well as examined the bacterial ability to utilize various

carbohydrates were monitored. As shown in Fig. II-2(A), the luxS mutant

strain ML03J showed a similar growth kinetic in glucose-containing LB

media compares to wild type strain CI03J, indicating no obvious growth

and/or metabolic defects by luxS mutation.

In contrast, this result indicated that difference growth kinetics

between CI03J, RL03J and ML03J cultured in LB media (no glucose)

(Fig. II-2(B)). These results indicating obvious growth and/or metabolic

defects by luxS/QS system. Carbohydrates were measured availability to

examine the change of the microorganism by metabolism related to

luxS/QS system. Total 25 carbohydrates were used as metabolic

utilization. As a result, only exception was seen in utilization of sorbose

(Table II-3 ). Indeed, the luxS mutant strain ML03J was unable to utilize

sorbose whereas the wildtype strain CI03J and its complemented strain

with the pEXP5-CT/luxS could.

73

Table II-3 Utilization of carbohydrates (25 carbohydrates) in strains

SubstanceStrains

Cl03J ML03J RL03J

lactose + + +

xylose + + +

maltose + + +

fructose + + +

dextrose + + +

galactose - - -

raffinose + + +

trehalose + + +

melibiose + + +

sucrose - - -

L-arabinose + + +

mannose + + +

Inulin - - -

sodium gluconate + + +

glycerol + + +

salicin - - -

glucosamine + + +

dulcitol + + +

Inositol - - -

sorbitol - - -

mannitol + + +

adonitol - - -

α-methyl-D-glucoside - - -

ribose + + +

rhamnose - - -

cellobiose - - -

melezitose - - -

α-methyl-D-mannoside - - -

xylitol - - -

ONPG + + +

esculin + + +

D-arabinose + + +

citrate - - -

malonate - - -

sorbose + - +

SubstanceStrains

Cl03J ML03J RL03J

lactose + + +

xylose + + +

maltose + + +

fructose + + +

dextrose + + +

galactose - - -

raffinose + + +

trehalose + + +

melibiose + + +

sucrose - - -

L-arabinose + + +

mannose + + +

Inulin - - -

sodium gluconate + + +

glycerol + + +

salicin - - -

glucosamine + + +

dulcitol + + +

Inositol - - -

sorbitol - - -

mannitol + + +

adonitol - - -

α-methyl-D-glucoside - - -

ribose + + +

rhamnose - - -

cellobiose - - -

melezitose - - -

α-methyl-D-mannoside - - -

xylitol - - -

ONPG + + +

esculin + + +

D-arabinose + + +

citrate - - -

malonate - - -

sorbose + - +

74

(A)

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

0 1 2 3 4 5 6 7 8 9 10 11 12

Time(h )

Cel

l den

sity

(OD

600)

Cl03J

ML03J

RL03J

(B)

0

0.2

0.4

0.6

0.8

1

1.2

0 1 2 3 4 5 6 7 8 9 10 11 12

Time(h)

Cel

l den

sity

(OD

600)

CI03J

RL03J

ML03J

Figure II-2. Growth curves of EHEC strains. (A) Growth curves of

EHEC wild-type strain CI03J, ML03J(luxS-) and RL03J (ML03J

complemented with pEXP5-CT(luxS+) in LB with 0.4% glucose at 37 . ℃

(B) Growth curves of EHEC strains in LB without glucose at 37 . ℃

Growth curves were performed in triplicate.

75

Influence of luxS mutation on swarming motility in

EHEC strain

In motility assay, this resuls showed that luxS/QS system affects the

motility of strains, and the test of the culture medium with 0.4% glucose

and without glucose showed that while the culture medium with glucose

had almost no difference among the strains, the one without glucose had

apparent difference among them. The motility condition in the culture

medium is shown in Figure II-3, and halos were measured and rated the

difference of motility to measure the motility of the strain during each

hour (Fig. II-4 A and B). As a result, while the culture medium without

glucose showed almost same level of motility from 4 to 7 hrs, it showed

clear difference when it became over 10 and reached up to 24 hrs. The

culture medium with glucose showed the low level of motility until 12 h,

and it showed the difference after passing 24 hrs.

Morphological analysis of flagella

Provided there is a difference in the formation of flagella, the shape of

flagella was observed by TEM. As a result, this results showed that there

was no difference in the formation of flagella among the three strains.

The rates of formation or expression of flagella was not found under the

microscope and all the three strains showed no difference in their

76

formation and shape of flagella(Fig. II-5).

Adherence assays

The results were performed cell adherence assay to the influence

luxS/QS has on pathogenesis of EHEC. The luxS mutants formed smaller

microcolonies than the wild type and complemented strains on cultured

HeLa cells(Fig. II-7) and Hep-2 cells(Fig. II-6). The tests were conducted

5 times repeatedly and the results were the similar. 10 different field on

microscope were observed, respectively.

77

A

C

B

D

A

C

B

D

Figure II-3. Motility assays of EHEC strains. Panel A, motility test of

strains CI03J(wild-type strain), ML03J(luxS mutant), and RL03J(ML03J

complemented with pEXP5-CT) in DMEM with 0.3% agar; panel B,

motility test of strains in tryptone medium with 0.3% agar and 0.4%

glucose; panel C, motility test of strains in DMEM agar without glucose;

panel D, tryptone agar without glucose. All strains were incubated at

37 ℃, 24hrs.

78

(A)

0

2

4

6

8

10

12

14

16

18

4 7 10 12 24

Time(h )

Dia

met

er o

f ha

los(

mm

)

CI03J

ML03J

RL03J

(B)

0

5

10

15

20

25

30

35

4 7 10 12 24

Time(h )

Dia

met

er o

f ha

los(

mm

)

CI03J

ML03J

RL03J

Figure II-4. Measured halo and rated the difference of motility.

Motility assays were performed at 37 on 0.3% agar plates containing ℃

media and the diameter of each motility halo was measured at 4, 7, 10, 12,

24 hrs. Tryptone medium with glucose (0.4%) (A), without glucose (B).

79

Figure II-5. Morphological analysis of flagella using by transmission electron microscope. The arrows indicate that

bacterial flagella. Samples were prepared for TEM by negative staining on glow discharged Formvar-coated grids, using 3%

uranyl acetate.

500nm 1umX 12,000 X 5,000 X 8,000

C I03J(luxS+) M L03J(luxS -) RL03J(luxS+)

500nm 1umX 12,000 X 5,000 X 8,000

C I03J(luxS+) M L03J(luxS -) RL03J(luxS+)

80

Figure II-6. Adherence assay to Hep-2 cell. A: uninfected cell, B:

infected cell with CI03J , C: infected cell with ML03J, D: infected cell

with RL03J. Hep-2 cells D-MEM supplemented with 10% FBS, were

plated onto coverslips in 24-well tissue culture plates at a density of 2 ×

105 cells per well and then incubated at 37 for 16 h℃ rs for HEp-2 in the

presence of 5% CO2. Cells were washed 5 times with PBS, fixed in

methanol, and stained with Giemsa solution.

A

C

B

D

Hep-2

ⅹⅹⅹⅹ100

ⅹⅹⅹⅹ200

A

C

B

D

A

C

B

D

Hep-2

ⅹⅹⅹⅹ100

ⅹⅹⅹⅹ200

81

Figure II-7. Adherence assay to Hela cell. A: uninfected cell, B:

infected cell with CI03J ,C: infected cell with ML03J, D: infected cell

with RL03J. HeLa cells D-MEM supplemented with 10% FBS, were

plated onto coverslips in 24-well tissue culture plates at a density of 2 ×

105 cells per well and then incubated at 37 for 16 h℃ rs for HeLa cell in

the presence of 5% CO2. Cells were washed 5 times with PBS, fixed in

methanol, and stained with giemsa solution.

A B

C D

HeLa

ⅹⅹⅹⅹ400

ⅹⅹⅹⅹ400

A B

C D

A B

C D

HeLa

ⅹⅹⅹⅹ400

ⅹⅹⅹⅹ400

82

Overview of microarray analysis

404 of 4,290 genes were observed on the array were regulated at least

1.5 folds by quorum sensing, which comprise ca. 10% of the K-12 gene

array, suggesting that quorum sensing is a global regulatory mechanism

in E. coli. Of the 4,290 genes on the array, 144 were not expressed at

detectable levels and 3,886 genes were not affected by the luxS mutation.

Of the 404 genes regulated by luxS/QS, 235 were up-regulated and 169

were down-regulated in the wild-type strain compared to in the luxS

mutant. To investigate the role of LuxS in global genomic expression, the

E. coli O157:H7-specific whole genomic transcriptome profiling was

performed in both wildtype CI03J and its luxS mutant strain ML03J (see

Materials and Methods). The results revealed that total 35 genes were

differentially expressed by luxS/QS. Among them, 12 genes whose

functions are mostly associated with motility or chemotaxis were up-

regulated while the other 13 genes coding for charperons or some

metabolic enzymes were down-regulated. However, these results were

not found any virulence associated genes such as LEE genes. The

molecular basis underlying the effect of luxS/QS on ML03J chemotaxis,

motility, and other metabolic or virulence factors were analyzed by DNA

microarrays. ML03J was in the presence of 0.4% glucose, and cells were

isolated at mid-exponential phase. Genes whose expression was

decreased by 1.5-fold in ML03J were selected and sorted into operons or

83

various fuctional groups (e.g., flagellar genes, table II-4 ). Induction of

flagellar and fimbrial genes has been associated previously with virulence

(Sperandio et al.,1999; Sperandio et al., 2004; Sperandio et al., 2002),

and in these studies, 4 fimbrial genes were regulated by luxS/QS system

were observed.

84

(A) (B)

Figure II-8. Microarray analysis of CI03J, RL03J and ML03J strains.

(A): electrophoresis of preparated total RNA, land M: DNA ladder

marker, lane 1 and 2: CI03J, lane 3 and 4: ML03J, lane 5 and 6: RL03J

(B): plates of arrays.

M 1 2 3 4 5 6kb

5.7

4.0

2.0

1.0

0.5

0.1

M 1 2 3 4 5 6kb

5.7

4.0

2.0

1.0

0.5

0.1

5.7

4.0

2.0

1.0

0.5

0.1

85

Table II-4. Fold induction of transcript in response to luxS/QS as

determined by microarray

Reference ORF Gene_symbolFold difference(vs luxS) Description

CI03J ML03J

Z3013 fliC 5.6 flagellar biosynthesis; flagellin, filament structural protein

Z2936 cheY 2.9 chemotaxis regulator transmits chemoreceptor signals to flagelllar motor components

Z3014 fliD 2.8 flagellar biosynthesis; filament capping protein; enables filament assembly

Z2935 cheZ 2.6 chemotactic response; CheY protein phophatase; antagonist of CheY as switch regulator

Z2940 tar 2.5 methyl-accepting chemotaxis protein II, aspartate sensor receptor

Z2946 flhD 2.2 regulator of flagellar biosynthesis, acting on class 2 operons; transcriptional initiation factor

Z3012 fliA 2.2 flagellar biosynthesis; alternative sigma factor 28; regulation of flagellar operons

Z3011 fliZ 2.1 orf, hypothetical protein

Z3015 fliS 2.1 flagellar biosynthesis; repressor of class 3a and 3b operons (RflA activity)

Z5711 yjdA 2 putative vimentin

Z2942 cheA 2 sensory transducer kinase between chemo- signal receptors and CheB and CheY

Z4692 rpsJ 2 30S ribosomal subunit protein S10

Z3988 ygaG 8.8 orf, hypothetical protein

Z2591 asr -6.9 -2 acid shock protein

Z3886 clpB -4.4 -1.9 heat shock protein

Z5351 metE -3.4 1.5 tetrahydropteroyltriglutamate methyltransferase

Z1389 hyaA -3.2 hydrogenase-1 small subunit

Z0014 dnaK -3.1 -2 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins

Z4930 gadA -2.5 -2.2 glutamate decarboxylase isozyme

Z2769 osmE -2.4 -1.6 activator of ntrL gene

Z1390 hyaB -2.4 hydrogenase-1 large subunit

Z2215 gadB -2.3 -2.3 glutamate decarboxylase isozyme

Z4981 cspA -2.2 cold shock protein 7.4, transcriptional activator of hns

Z1418 cbpA -2.1 curved DNA-binding protein; functions closely related to DnaJ

Z5678 fdhF -2.1 selenopolypeptide subunit of formate dehydrogenase H

Z0606 ybaS -2.1 -1.6 putative glutaminase

Z5748 mopA -2.1 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein

Z2712 ydiC -2.1 -1.5 orf, hypothetical protein

Z2711 ynhE -2 -1.5 orf, hypothetical protein

Z1391 hyaC -2 probable Ni/Fe-hydrogenase 1 b-type cytochrome subunit

Z3526 elaB -2 orf, hypothetical protein

Z4424 yqjI -2 orf, hypothetical protein

Z4972 yhjX -2 -1.6 putative resistance protein

Z5479 hslV -2 -1.7 heat shock protein hslVU, proteasome-related peptidase subunit

Z5747 mopB -2 -1.5 GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase activity

Reference ORF Gene_symbolFold difference(vs luxS) Description

CI03J ML03J

Z3013 fliC 5.6 flagellar biosynthesis; flagellin, filament structural protein

Z2936 cheY 2.9 chemotaxis regulator transmits chemoreceptor signals to flagelllar motor components

Z3014 fliD 2.8 flagellar biosynthesis; filament capping protein; enables filament assembly

Z2935 cheZ 2.6 chemotactic response; CheY protein phophatase; antagonist of CheY as switch regulator

Z2940 tar 2.5 methyl-accepting chemotaxis protein II, aspartate sensor receptor

Z2946 flhD 2.2 regulator of flagellar biosynthesis, acting on class 2 operons; transcriptional initiation factor

Z3012 fliA 2.2 flagellar biosynthesis; alternative sigma factor 28; regulation of flagellar operons

Z3011 fliZ 2.1 orf, hypothetical protein

Z3015 fliS 2.1 flagellar biosynthesis; repressor of class 3a and 3b operons (RflA activity)

Z5711 yjdA 2 putative vimentin

Z2942 cheA 2 sensory transducer kinase between chemo- signal receptors and CheB and CheY

Z4692 rpsJ 2 30S ribosomal subunit protein S10

Z3988 ygaG 8.8 orf, hypothetical protein

Z2591 asr -6.9 -2 acid shock protein

Z3886 clpB -4.4 -1.9 heat shock protein

Z5351 metE -3.4 1.5 tetrahydropteroyltriglutamate methyltransferase

Z1389 hyaA -3.2 hydrogenase-1 small subunit

Z0014 dnaK -3.1 -2 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins

Z4930 gadA -2.5 -2.2 glutamate decarboxylase isozyme

Z2769 osmE -2.4 -1.6 activator of ntrL gene

Z1390 hyaB -2.4 hydrogenase-1 large subunit

Z2215 gadB -2.3 -2.3 glutamate decarboxylase isozyme

Z4981 cspA -2.2 cold shock protein 7.4, transcriptional activator of hns

Z1418 cbpA -2.1 curved DNA-binding protein; functions closely related to DnaJ

Z5678 fdhF -2.1 selenopolypeptide subunit of formate dehydrogenase H

Z0606 ybaS -2.1 -1.6 putative glutaminase

Z5748 mopA -2.1 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein

Z2712 ydiC -2.1 -1.5 orf, hypothetical protein

Z2711 ynhE -2 -1.5 orf, hypothetical protein

Z1391 hyaC -2 probable Ni/Fe-hydrogenase 1 b-type cytochrome subunit

Z3526 elaB -2 orf, hypothetical protein

Z4424 yqjI -2 orf, hypothetical protein

Z4972 yhjX -2 -1.6 putative resistance protein

Z5479 hslV -2 -1.7 heat shock protein hslVU, proteasome-related peptidase subunit

Z5747 mopB -2 -1.5 GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase activity

86

Regulation by luxS/QS of the EHEC LEE genes

Genes, which encoded a type III secretion system was diminished in the

luxS mutant (ML03J). This study indicated that CJ03J and RL03J induced

the expression of 22 virulence genes (belonging to all five LEE operons

LEE1 through LEE5) by an average of two folds (table II-7 ). To examine

the relationship between luxS/QS and LEE, strains were tested on the

expression difference of LEE related genes using reverse transcription

real-time PCR. All 22 genes were selected for the confirmation and

relative quantification was performed based on housekeeping gene of E.

coli. The DNA density of gapA, the housekeeping gene, was prepared

from 0.1 ng to 100 ng and was used as the standard sample. The standard

curve with the result were examed and confirmed for the 100 ng sample,

the Ct value on the basis of amplification of DNA was produced at

around cycle 11, and at 14 for 10 ng, at 18 for 1 ng, and at 21.3 for 0.1 ng,

respectively. The amplification curve and the standard curve are shown in

the Table 6. The result of relative quantification showed that almost all of

the LEE genes related to T3SS had differences. They consisted of the

genes expressing the structural protein and effector protein related to

T3SS, and also included the genes which are connected with the

adherence of the bacteria such as eae and tir. On the average these genes

showed high expression level in CI03J and RL03J, while the level

declined in ML03J.

87

(A) (B)

Figure II-9. The amplification curves(A) and DNA standard curve(B)

of gapA gene.

88

Table II-5. PCR primers used in qualitative and quantitative real-

time PCR assays

Primers Genes Sequences ( 5' - 3' ) Described

EPA-FespA

CGGCACAAAAGATGGCTAATSecreted protein EspA

EPA-R ACCAGCGCTTAAATCACCAC

EPB-FespB

TCAGCATTGGGGATCTTAGGSecreted protein EspB

EPB-R CTGCGACATCAGCAACACTT

EPD-FespD

ACGAACGGTATTCGTTCTGCSecreted protein EspD

EPD-R TAACTCGCTTGCCGCTTTAT

EPF-FespF

AGCAGCCAGGTGACTTCATTSecreted protein EspF

EPF-R GGCGGGCTTAAAACCTAAAG

EPG-FespG

CGAGATTCGCACAGCAAATASecreted protein EspG

EPG-R GAAAGCGGATCTGTTTGAGC

TR-Ftir

ACTTCCAGCCTTCGTTCAGATranslocated intim receptor

TR-R TTCTGGAACGCTTCTTTCGT

GIT-Feae

CAACATGACCGATGACAAGGIntimin

GIT-R GATTAACCTCTGCCGTTCCA

LER-Fler

GACTGCGAGAGCAGGAGTTLEE encoded regulator

LER-R CAGGTCTGCCCTTCTTCATT

SPD-FsepD

TGCTTTCTTGCACGATTTTGType III secretion system protein

SPD-R ACATGTTTGCGCCATGATTA

SPL-FsepL

CAAAGGTAGCGCAAGGAAAGType III secretion system protein

SPL-R ATCGCCAAAGTAGGATCGTG

SPQ-FsepQ

GAGGTCAGCGGTCATGGTATType III secretion system protein

SPQ-R ACCTTCCGGTAAGGCAGTCT

Primers Genes Sequences ( 5' - 3' ) Described

EPA-FespA

CGGCACAAAAGATGGCTAATSecreted protein EspA

EPA-R ACCAGCGCTTAAATCACCAC

EPB-FespB

TCAGCATTGGGGATCTTAGGSecreted protein EspB

EPB-R CTGCGACATCAGCAACACTT

EPD-FespD

ACGAACGGTATTCGTTCTGCSecreted protein EspD

EPD-R TAACTCGCTTGCCGCTTTAT

EPF-FespF

AGCAGCCAGGTGACTTCATTSecreted protein EspF

EPF-R GGCGGGCTTAAAACCTAAAG

EPG-FespG

CGAGATTCGCACAGCAAATASecreted protein EspG

EPG-R GAAAGCGGATCTGTTTGAGC

TR-Ftir

ACTTCCAGCCTTCGTTCAGATranslocated intim receptor

TR-R TTCTGGAACGCTTCTTTCGT

GIT-Feae

CAACATGACCGATGACAAGGIntimin

GIT-R GATTAACCTCTGCCGTTCCA

LER-Fler

GACTGCGAGAGCAGGAGTTLEE encoded regulator

LER-R CAGGTCTGCCCTTCTTCATT

SPD-FsepD

TGCTTTCTTGCACGATTTTGType III secretion system protein

SPD-R ACATGTTTGCGCCATGATTA

SPL-FsepL

CAAAGGTAGCGCAAGGAAAGType III secretion system protein

SPL-R ATCGCCAAAGTAGGATCGTG

SPQ-FsepQ

GAGGTCAGCGGTCATGGTATType III secretion system protein

SPQ-R ACCTTCCGGTAAGGCAGTCT

89

Table II-5. (continued)

Primers Genes Sequences ( 5' - 3' ) Described

SPZ-FsepZ

GCGACCTCACTCAGTGGAAType III secretion system protein

SPZ-R ATTCTGTGCTGCTCGTCTCC

ECD-FescD

TGCAGGATGGGAAATACACAType III secretion system protein

ECD-R CTGCTGAAATGTACGGCTGA

ECF-FescF

GCGATTCTGTGCCAGAGTTAType III secretion system protein

ECF-R CGGTTAGAAATGGTTGAGAC

ECJ-FescJ

CCCGAAAAAGAAATTTGCAGType III secretion system protein

ECJ-R GACTAAAACGGCTGCTGAGG

ECN-FescN

CAACGTTTAGCCGAGGTGATType III secretion system protein

ECN-R GCATACAAGCTGCGTTCAAA

ECR-FescR

CTGTTACCGGCTTTCACGATType III secretion system protein

ECR-R ATAATTTTTGCCAGCCTCCA

ECS-FescS

CATAGCGGCCTCTGTTATCGType III secretion system protein

ECS-R TCACCTTCGGAATCATTTCA

ECT-FescT

GATGCGGCTGGACAGATTATType III secretion system protein

ECT-R TGCTTTGTATCCCACCATGA

ECU-FescU

AAAAACCCGACTCACATTGCType III secretion system protein

ECU-R TTGTGCCACAGGTTCAAAAA

CSD-FcesD

AACCGCAAGAAATCTATTCCAPutative type III secretion system protein

CSD-R AAGGCTTTCTTGGCCATTTT

CST-FcesT

TCCCTCTCGATGATGCTACCThe chaperon for Tir

CST-R TGTCGCTTGAACTGATTTCCT

Primers Genes Sequences ( 5' - 3' ) Described

SPZ-FsepZ

GCGACCTCACTCAGTGGAAType III secretion system protein

SPZ-R ATTCTGTGCTGCTCGTCTCC

ECD-FescD

TGCAGGATGGGAAATACACAType III secretion system protein

ECD-R CTGCTGAAATGTACGGCTGA

ECF-FescF

GCGATTCTGTGCCAGAGTTAType III secretion system protein

ECF-R CGGTTAGAAATGGTTGAGAC

ECJ-FescJ

CCCGAAAAAGAAATTTGCAGType III secretion system protein

ECJ-R GACTAAAACGGCTGCTGAGG

ECN-FescN

CAACGTTTAGCCGAGGTGATType III secretion system protein

ECN-R GCATACAAGCTGCGTTCAAA

ECR-FescR

CTGTTACCGGCTTTCACGATType III secretion system protein

ECR-R ATAATTTTTGCCAGCCTCCA

ECS-FescS

CATAGCGGCCTCTGTTATCGType III secretion system protein

ECS-R TCACCTTCGGAATCATTTCA

ECT-FescT

GATGCGGCTGGACAGATTATType III secretion system protein

ECT-R TGCTTTGTATCCCACCATGA

ECU-FescU

AAAAACCCGACTCACATTGCType III secretion system protein

ECU-R TTGTGCCACAGGTTCAAAAA

CSD-FcesD

AACCGCAAGAAATCTATTCCAPutative type III secretion system protein

CSD-R AAGGCTTTCTTGGCCATTTT

CST-FcesT

TCCCTCTCGATGATGCTACCThe chaperon for Tir

CST-R TGTCGCTTGAACTGATTTCCT

90

Table II-6. Quantification of DNA in housekeeping gene, gapA

SamplesAmt. of DNA Ct valuegapA-1 100 ng 11.8±0.5gapA-2 10 ng 14.09±1.2gapA-3 1 ng 17.8±0.8gapA-4 0.1 ng 21.3±0.3

91

Table II-7. Comparative to LEE genes using by quantitative real-

time PCR assay

GenesCI03J ML03J RL03J

Amt. of DNA Ct values Amt. of DNA Ct values Amt. of DNA Ct values

espA 47.3 12.01 23.2 13.8 58.4 11.9

espB 86.5 11.9 39.4 12.1 92.5 11.8

espD 31.05 13.01 7.3 17 15.2 12.9

espF 7.7 17.02 5.3 16.08 5.4 16.1

espG 54.6 11.9 37.8 12.9 53.8 11.9

tir 93.6 11.8 37.9 12.9 62.8 11.9

eae 110.8 11.75 50.9 12 95.6 11.8

ler 33.7 12.93 12 14.3 32.2 13.01

sepD 16.7 13.1 7.04 17 17.3 13.1

sepL 67.8 12 57.8 12 56.4 12

sepQ 92.6 11.8 35.2 12.9 66.7 11.9

sepZ 61.7 11.9 23.7 13.7 36.4 12.9

escD 50.4 11.9 29.2 13.03 30.4 13.03

escF 60.6 12 40.8 12.2 57.8 12

escJ 87.6 11.9 61.9 12 71.6 12

escN 74.9 12 38.6 12.4 40.5 12.2

escR 87.2 11.91 60.5 12 75.4 12

escS 60.9 12 32.3 13.01 46.7 12.01

escT 71.5 12 50.4 11.9 62.2 12

escU 24.4 13.9 7.3 17.2 10.3 14.1

cesD 43 12 31.3 13.04 50.7 11.9

cesT 44.5 12 17.6 13.1 20.2 13.2

GenesCI03J ML03J RL03J

Amt. of DNA Ct values Amt. of DNA Ct values Amt. of DNA Ct values

espA 47.3 12.01 23.2 13.8 58.4 11.9

espB 86.5 11.9 39.4 12.1 92.5 11.8

espD 31.05 13.01 7.3 17 15.2 12.9

espF 7.7 17.02 5.3 16.08 5.4 16.1

espG 54.6 11.9 37.8 12.9 53.8 11.9

tir 93.6 11.8 37.9 12.9 62.8 11.9

eae 110.8 11.75 50.9 12 95.6 11.8

ler 33.7 12.93 12 14.3 32.2 13.01

sepD 16.7 13.1 7.04 17 17.3 13.1

sepL 67.8 12 57.8 12 56.4 12

sepQ 92.6 11.8 35.2 12.9 66.7 11.9

sepZ 61.7 11.9 23.7 13.7 36.4 12.9

escD 50.4 11.9 29.2 13.03 30.4 13.03

escF 60.6 12 40.8 12.2 57.8 12

escJ 87.6 11.9 61.9 12 71.6 12

escN 74.9 12 38.6 12.4 40.5 12.2

escR 87.2 11.91 60.5 12 75.4 12

escS 60.9 12 32.3 13.01 46.7 12.01

escT 71.5 12 50.4 11.9 62.2 12

escU 24.4 13.9 7.3 17.2 10.3 14.1

cesD 43 12 31.3 13.04 50.7 11.9

cesT 44.5 12 17.6 13.1 20.2 13.2

92

LuxS/QS regulates Stx expression

In the cytotoxicity test to examine the expression difference of Stx, the

main virulence factor of EHEC, cytotoxicity reduced about 4 folds in

ML03J. The EDL933 was used as the positive control and JM109 strain

and the control group only with culture medium was used as the negative

control. As the result shows, the EDL933 strain produced the highest

cytotoxicity value, and CI03J and RL03J, the strains in this study, also

produced comparatively high cytotoxicity value.

Quorum sensing controls cytotoxicity for erythrocytes

In the test result of hemolysis assay with human RBC, while CI03J and

RL03J showed high hemolysis phase as in the result of vero cell

cytotoxicity, ML03J showed twice less value. The supernatant of the

culture fluid was filtered with the 0.2um syringe filter for the hemolysis

assay, and the prepared supernatant was diluted from 1 to 1:256 and the

hemolysis rate was measured at each density.

93

Figure II-10. Cytotoxic activity of shiga-like toxin on Vero cells by WST assays.

94

0.0%

10.0%

20.0%

30.0%

40.0%

50.0%

60.0%

1 1:2 1:4 1:8 1:16 1:32 1:64 1:125 1:256

Dilution

hem

olys

is o

f RB

C(%

)

CI03J

RL03J

ML03J

0.0%

10.0%

20.0%

30.0%

40.0%

50.0%

60.0%

1 1:2 1:4 1:8 1:16 1:32 1:64 1:125 1:256

Dilution

hem

olys

is o

f RB

C(%

)

CI03J

RL03J

ML03J

Figure II-11. Dose-response of hemolysis phenotypes

95

4. DISCUSSION

The gene encoding the AI-2 synthetase was cloned, sequenced, and

named luxS by Surette et al. (1999). Besides production of light, quorum-

sensing mechanisms have been demonstrated to regulate competence in

Streptococcus (Metritt et al., 2005; Sztajer et al., 2008), production of

hemolysins and other virulence genes in Staphylococcus (Villaruz et al.,

2008), production of elastase and biofilm formation in Pseudomonas

aeruginosa(Miller and Bassler, 2001), iron acquisition in V. harveyi(Mok

et al., 2003), and type III secretion in EHEC(Fuqua and Green berg,

1998; Gally et al., 2003; Kaper and Sperandio, 2005).

The different patterns of growth kinetic were found in the strains

cultured in the each medium with glucose. The observation of the growth

curves showed that CI03J and RL03J had a similar growth pattern

whether or not they had glucose. ML03J, however, showed a remarkably

reduced growth kinetics under the condition without glucose, while it

showed an almost similar growth to the other two strains under the

condition with glucose. The difference was apparent between 4~8 hours.

It showed a same level of cell density as the other two strains when it

reached the stationary phase. A hypothesis could be formed from this

result that, under conditions with abundant nutrition, QS-related genes

96

could substitute the role. Previous studies also have reported the change

in QS pattern through glucose, but the exact reason for this has not been

discovered. The presence of glucose in culture is important, as it is well

established that AI-2 uptake is regulated by catabolite repression in the

presence of glucose through down-regulation of lsr operon (Wang et al.,

2005; Xavier and Bassler, 2005); hence, glucose can mask the impact of

AI-2 on gene expression. In most bacteria examined, extracellular AI-2

activity peaks in mid-late exponential phase and declines precipitously in

stationary phase. This phenomenon has been most thoroughly studied in

E. coli and S. typhimurium, where AI-2 levels are further influenced by

environmental factors such as osmolarity, pH and carbohydrates(Kievit et

al., 2000; Liu and Ferenci, 2000; Turovskiy et al., 2006; Turovskiy et al.,

2007).

In their recent study, Kaper et al., (2005) have conducted research

on related gene and its mechanism based on the fact that QS can be

controlled by another mechanism under the condition in which all the

nutrition is exhausted. The diameters of halo actively motile from

cultures grown in the presence and absence of glucose were assessed.

Considering these results were found out that there is a close relationship

between motility and luxS/QS, and the change pattern of the phenotype

could be different depending on a nutritious element, including glucose.

This result also corresponds with the microarray result, and the 2~5.6

97

folds difference of genes related to flagella formation and motility, and

chemotaxis supports the fact.

The luxS mutant strain ML03J was able to produce the flagellum,

but it was less motile than the wild type strain. It is well known that the

luxS gene product is responsible for producing the quorum sensing

signaling molecules called AI-2 and -3. A recent study demonstrated that

AI-3 (not AI-2) mediated signaling transduces into the cells through the

QseB/C two-component system, which controls biosynthesis of the

flagellum in E. coli O157:H7. To compare the flagella biosynthesis and

their functionality in the wild type and luxS mutant strains, the bacterial

flagellum was studied via electron-microscopic analysis, and its

functionality in bacterial motility was examined on a 0.3% tryptone agar

plate (Fig. II-3). As shown in Figure II-5, interestingly, the TEM analysis

of both the wild type and luxS mutant strains revealed that they possessed

the flagella, although they did not quantitated. As expected, simple

complementation of the luxS mutant strain ML03J via intact luxS gene in

trans still retained the flagellum like the wild type and luxS mutant strains.

These results were unexpected because the previous studies demonstrated

that luxS mutation causes repression of several genes involved in flagella

biosynthesis. Therefore, the flagellum of the luxS mutant strain might not

be fully functional or that the luxS mutant strain has a reduced number of

flagella as compared to the wild type strain CI03J(Fig. II-5) were

98

hypothesized. To test this hypothesis, bacterial swamming motility was

examined. As expected, the luxS mutant strain ML03J was less motile

than the wild type strain CI03J and complemented strain RL03J,

indicating that ML03J was able to build up the flagellum, but was

somehow defective in its function. As in the study of Sperandio et al.

(2001) further research on motility activation factor, such as motA or

motB and chemotaxis related genes, such as cheA and cheW, is necessary.

This could also be solved by studying the relationship between the

different regulation factors, such as slyA and QS. The transcriptome

analysis data revealed that, in addition to altering the expression of genes

involved in virulence, AI-2 also controlled the expression of genes

involved in other phenotypes and functions (e.g., metabolism). In this

regard, have reported on the role of luxS-mediated AI-2 in metabolism

(Kendall et al., 2007; Wang et al., 2005).

Many bacteria swim by using flagella, helical propellers driven by

a reversible rotary motor in the cell membrane (Macnab, 1999, 2003).

Rotation is powered by a transmembrane gradient of ions, usually protons

(Berg, 2003), and the increase in the proton motive force strongly drives

the flagellar rotation (Kojima and Blair, 2004). In E. coli, the expression,

synthesis, assembly, and function of flagella and motility require the

expression of more than 50 genes divided among at least 17 operons,

constituting a large and coordinately regulated flagella regulon. It has

99

been known that flagellar proteins are transiently induced following heat

shock, salt, and acid stress of limitation of glucose (Kojima and Blair,

2004). It is also interesting to note that the synthesis of S-

ribosylhomocysteinase (LuxS), which is involved in the synthesis of

autoinducer-2(AI-2) from E. coli K-12, was significantly activated after

the luxS gene restored. It was reported that the luxS/AI-2 quorum-sensing

system activates the expression of genes involved in the assembly of

flagellar and motility through the activation of flhDC transcription

(Sperandio et al., 2002).

Genes potentially regulated by AI-2 in other species have been

identified by constructing a luxS mutant of comparing gene expression in

the wild type and luxS mutant. Among the phenotypes and functions

affected by luxS mutations are type III secretion system(T3SS) and

flagellum expression in EHEC O157:H7(Nataro et al., 2005; Sperandio et

al., 2002), expression of VirB in Shigella flexneri (Day and Manrelli,

2001), secretion of SepB cysteine protease in Streptococcus pyogenes

(Federle and Bassler, 2003), T3SS in V. harveyi and Vibrio

parahaemolyticus (Henke and Bassler, 2004). The most comprehensive

analysis published so far has been the analysis of E. coli, and two

microarray analyses by two different groups have compared genomic

differences in gene expression between luxS-negative mutants and their

isogenic luxS positive parent strains. Using an E. coli K-12 microarray

100

and mRNA and cDNA from EHEC, Sperandio et al. (2001) found that

approximately 10% of the genes in the K-12 genome were differentially

regulated fivefold in a wild-type EHEC strain and its isogenic luxS

mutant, with roughly equal numbers of genes being positively regulated

and negatively regulated (Sperandio et al, 2001). In separate study, Delisa

et al. (2001) regulated reported that about 5.6% of K-12 genome was

differentially regulated in a wild-type K-12 strain and its isogenic luxS

mutant. The difference in the number of genes regulated in the two

reports may have been due to differences in methodology, including

differences in growth temperature, nutrient availability, and E. coli strain

analyzed. The observation that up to 10% of the array genes are

differntially regulated in an EHEC wild-type strain and its isogenic luxS

mutant is not surprising if one considers the pleiotropic nature of a luxS

mutation.

A recent breakthrough in distinguishing the potential cell signaling

functions from general metabolic functions was the discovery of new

signaling molecule called AI-3(Kendall et al., 2007; Walters and

Sperandio, 2006; Walters et al., 2006), whose synthesis is dependent on

LuxS. Building on their previous studies showing that a luxS mutant of

EHEC was deficient in T3S and flagellum production, Sperandio et al.,

(2002 and 2004) showed that purified flagellum. These results suggest

that some of the phenotypes attributed to AI-2 signaling need to be

101

revised in light of the fact that LuxS is not devoted to AI-2 production; it

is in fact an important enzyme whose absence affects the metabolism of

SAM and various amino acid pathway.

Given the widespread nature of the luxS/AI-3 system in bacteria, an

interesting extrapolation is that the AI-3/luxS quorum sensing system

might have initially evolved to mediate microflora-host interactions but

was subsequently exploited by EHEC to activate its virulence genes. In

this manner, the AI-3/luxS system alerts EHEC to when it has reached the

large intestine, where large numbers of commensal E. coli, Enterococcus,

Clostridium, and Bacteroides, all of which contain the AI-3/luxS quorum

sensing system, reside. The most recent study in this series demonstrated

that an EHEC luxS mutant, which was unable to produce AI-3 and unable

to express the LEE-encoded T3SS at normal levels, nonetheless still

produced AE lesions on epithelial cells that were indistinguishable from

those seen with the wild type (Zhu et al., 2007). The luxS mutant still

responded to a eukaryotic cell signal to activate expression of the LEE

genes.

These results imply that there is potential cross-communication

between the luxS/AI-3 bacterial QS system and the epinephrine-

norepinephrine host signaling system. QS might be a "language" by

which bacteria and host cells communicate. Several features of the AI-2

biosynthetic pathway are intriguing because they suggest that AI-2

102

harbors information about cell number and also the growth phase and

prosperity of the cells in a population. AI-2 is well suited to be a signal

that specifies the growth phase of the population. Clostridium perfringens

uses AI-2/LuxS to regulate toxin production. The timing of production is

critical for virulence in C. perfringens and occurs at mid-late exponential

phase. Interestingly, this coincides with the timing of maximal AI-2

production. Analysis of toxin mRNA levels shows that compared with the

wild-type, C. perfringens luxS mutants have reduced toxin transcription at

mid-log phase, whereas at stationary phase, mutant and wild type toxin

mRNA levels are similar. Apparently, redundant regulatory mechanisms

exist for controlling toxin expression and timing. Stevenson and Babb

(2002) showed that LuxS from Borrelia burgdorferi proteins showed

altered expression following exogenous addition of AI-2. However, B.

burgdorferi did not produce detectable AI-2, suggesting that it is not

made under laboratory conditions and/or that AI-2 production requires a

signal from the host.

The type III secretion systems (T3SS) are utilized by gram-

negative pathogenic bacteria to deliver target-specific effector proteins

into eukaryotic cells. STEC O157:H7 strain had a well-defined T3SS

involved in attachment and critical for virulence (Schauder et al.,2001).

In general, the level of expression of most of the LEE genes such as

espABDFG and cesD, T, escD, F, J, N, R, S, T, and U, sepD, L, Q, G and

103

ler gene were not significantly changed. On the other hand, the level of

mRNA for the gene including escD (predicted to be major components of

the T3SS basal body) was higher in adherent bacteria, but their precise

biological functions and localizations in the STEC T3SS apparatus

remain still unclear. Recently, Ogino et al. (2006) demonstrated that escD

and escJ are required for the secretion of both the Esp proteins and the

translocated intimin receptor (Tir) effector. In addition, the global

regulator H-NS (Tavender et al., 2008) gene was recently to be negative

regulator of several LEE gene expressions.

Adherence of the luxS mutant was two orders of magnitude lower

than those of the wild-type and complemented strains (Fig. II-6 and 7).

These results are consistent with the lower transcription of the LEE genes

(LEE5 encodes both Tir and intimin) (Table II-7). Expression of flagella

was reduced in a luxS mutant, in agreement with this phenotype, the luxS

mutant showed reduced motility in both D-MEM without glucose and

tryptone medium (Fig. II-3 C and D). These phenotypes suggest that

successful microcolony formation and adhesion are dependent in the

correct timing and dosage of flagellar and LEE gene expression. While

flagella in EHEC are used mostly for swimming, they are involved in

adherence and microcolony formation in EPEC (Giron et al., 2002;

Sperandio et al., 2004), thus causing the need to coordinate transcription

of the LEE genes with flagellation. The results of the array indicated that

104

genes involved in cell growth and division are generally down-regulated

by quorum sensing.

We found that expression levels of LEE-encoded genes from each

strain, these genes were involved in espA, espB and mediated T3SS genes

(Table II-7). EspA composes the filament of the T3SS (Sekiya et al.,

2001), while EspB helps to form a pore in the eukaryotic memebrane that

is necessary to translocate effector proteins into the eukaryotic cell

(Sperandio et al., 2004).

The luxS gene is necessary for the efficient production of the AI-3

quorum sensing signal (Kendall et al., 2007).

The regulation of virulence genes (LEE genes) and several other

operons importance of luxS/QS system in EHEC infections. Several

studies (Anand and Griffiths, 2003; Lupp and Ruby, 2004; Qin et al.,

2007) have used whole transcriptome analysis to understand the effect of

luxS/QS system on gene expression in both nonpathogenic and

pathogenic bacteria. While the role of luxS/QS system in nonpathogenic

E. coli biofilm formation has been established (Iglewski and Kievit,

2000) its effect on EHEC phenotypes is less well understood. One study

(Cloak et al., 2002) recently observed that AI-2 down-regulated several

virulence genes including rpoS (positive regulator of LEE3 operon) and

prgH (cell invasion protein) in S. typhimurium delta luxS. However,

another recent study (Gonzalez and Keshavan, 2006; Hardie et al., 2003;

105

Holden et al., 2002; Ren et al., 2004) observed that several metabolism

genes, but only two virulence genes, espA and eae, belonging to LEE4

and LEE5, respectively. Irrespective of the effect exerted to luxS/QS or

the extent to which virulence genes were altered in expression, our data

and these studies clearly indicate that luxS/QS ia an important signal in

GI tract infections.

The chemotactic recognition of molecules mediated luxS/QS

system and increase in motility by EHEC in presence of AI-2 or AI-3 and

the suggest that this signal is involved in the initial migration of EHEC to

epithelial cells. Consistence with this increase in chemotaxis and motility,

the presence of luxS/QS system also causes an increase in adherence to

HeLa and Hep-2 cells. Given the direct correlation between colonization

to epithelial cells and increase virulence (Lyte et al. 1996; Lyte et al.

1997), these results strongly suggest that luxS/QS system leads to

increased EHEC colonization of host cells and virulence. This is also

corroborated by gene expression results showing that genes involved in

bacterial colonization and adherence are up-regulated by luxS/QS system.

The up-regulation of these genes is consistent with increased attachment

of EHEC to HeLa and Hep-2 cells in our experiments.

Previously, studies demonstrated that the genes encoding Stx1 and

Stx2 are located withn the late genes of a λ-like phage. Recently Kimmitt

et al., (2000) reported that induction of an SOS response in EHEC

106

induces the production of Stx2. Moreover, Fuchs et al., (2004) reported

that recA induction in vivo is involved in increased production of Stx2

phage induction, which is controlled by RecA. Genes encoding Stx are

induced by an SOS response were also regulated by quorum sensing

(Griffiths and Anand, 2003). Increased expression of Stx, using a RPLA

and Vero cytotoxicity assay in the wild-type and complemented strains

compared to that in the luxS mutant were observed (Fig. II-10 ).

Each strains have discrimination of cytolytic activity for human

erythrocytes were found (Fig. II-11). It might be mediated iron uptake or

correlations of other virulence mechanisms. Iron has been reported to

increase virulence of certain strains of E. coli along with other species

such as Vibrio, Neisseria, and Hemophilus, through the production of

cytotoxins and leukotoxins (Xavier and Bassler, 2003). These results

indicated that luxS/QS regulates the conclusive virulence factor, which

helps the bacteria cell adhere to the host, and, as in previous studies, that

luxS/QS influences the expression of LEE gene, resulting in the change of

adherence in the STEC strain. Although few specific studies have been

done previously on hemolysis phenomena and luxS/QS, a test using a

Serratia and Stapylococcus had similar results as these results did (Fig.

II-11).

The discovery of QS in human pathogens has led to considerable

interest in developing new therapeutic interventions to interfere with

107

these signaling molecules. Thus, instead of using an antibiotic to kill

pathogenic bacteria, a compound that interferes with the QS mechanism

would be used to repress expression of the virulence genes responsible

for the disease. Such an approach is particularly promising in light of

increasing resistance to conventional antimicrobial agents, and

encouraging results in animal models have been obtained with P.

aeruginosa and S. aureus (Schauder and Bassler, 2001). However, the

development of anti-QS therapy has been primarily directed towards

nonintestinal pathogens, which do not have to deal with the high numbers

of commensal organisms present in the GI tract. The presence of this

complex microbial flora and the variety of signaling molecules that might

be produced by the microbial flora or even the host itself greatly

complicate the application of this approach to GI pathogens. The

occurrence of C. difficile associated colitis after broad-spectrum antibiotic

use is an example of the negative consequences that can potentially result

from disruption of the normal intestinal flora.

There are at least three major strategies for the development of

drugs that interrupt bacterial QS (Nataro et al., 2005): (i) inhibition of QS

signal synthesis, (ii) destruction or degradation of the signal, and (iii)

inhibition of signal reception. As an example of the first approach, Parsek

and Greenberg (2005) used analogs of SAM to inhibit the synthesis of

AHL by the P. aeruginosa RhlI protein (Xavier and Bassler, 2006).

108

Several examples can be found for the second approach since

several naturally occurring compounds have been found that can degrade

signal molecules. One enzyme that catalyzes the hydrolysis of AHL

signals, called AiiA, is produced by Bacillus species (Jones and Blaser,

2003). Expression of AiiA in the plant pathogen Erwinia carotovora

resulted in reduced levels of AHL molecules and attenuated pathogenicity

in a variety of plant species. The application of the third approach,

inhibition of signal reception, has yielded several promising results in

animal models of disease due to human pathogens. Sun et al. (2004)

developed a synthetic derivative of natural furanone compounds that can

act as potent antagonist of bacterial QS in P. aeruginosa. In a mouse

pulmonary model of infection, addition of this compound 2 days after

inoculation with P. aeruginosa resulted in the down-regulation of

bacterial genes regulated by QS in the bacteria present in the mouse (Li et

al., 2006). Application of this compound also resulted in substantial

clearance of the organism from the lungs and rendered P. aeruginosa

present in biofilms significantly more susceptible to tobramycin, an

antibiotic routinely used to treat cystic fibrosis patients. Studies by other

investigators have resulted in the development of compounds that inhibit

QS-mediated virulence gene expression in S. aureus, thereby protecting

mice against S. aureus infection (Turovskiy et al., 2007). Fortunately, the

recent identification of AI-2 controlled genes in many different bacteria

109

provides us with the necessary outputs to monitor for the identification of

their cognate AI-2 sensory apparatuses.

This expands the knowledge on luxS/QS system in EHEC, showing

that luxS/QS is a global regulatory system that controls not only genes

involved in bacterial metabolism, DNA repair, nucleotide and protein

biosynthesis, and cell growth and division, among other functions. These

results suggest that quorum sensing is a very important regulatory

mechanism through which EHEC strain senses and adapts to a given

environment.

110

CHAPTER III

Quorum sensing contribute to proteomic

changes of Escherichia coli O157:H7

111

1. INTRODUCTION

Proteomics is widely accepted as a key technology in the postgenomic

era to investigate global protein synthesis and gene expression. Technical

developments in separation methods allow the simultaneous analysis of a

significant proportion of cell’s proteome. Improved methods of protein

identification can reliably link the proteome and genome to provide a

global picture of a cell’s metabolism. These technological advancements

have led to the continued expansion of proteomic applications in the

biomedical science and include studies on bacterial pathogenesis. The

characterization of the proteomes of bacterial pathogens growing in their

hosts remains a future challenge.

In the last decade, rapid advancements in sequencing technology

have lead to the completion of a whole tranche of bacterial genomes. Two

main routes to bacterial genomics have been followed. The first was

contingent upon the generation of a physical map using cloned genomic

fragments in a phage or plasmid library, with the individual cloned

fragments then being sequenced and aligned to the physical map. The

genome sequence of Escherichia coli was determined in this way

(Blattner et al., 1997). In the second, essentially random fragments of the

genome were cloned in plasmid and phage libraries, with the inserts’

112

terminal sequences then determined and the sequenced fragments

assembled into the complete genome sequence.

This methodology has been used to determine the genome

sequences of many other bacteria including Haemophilus influenzae

(Fleischmann et al., 1995), Mycoplasma genitalium (Fraser et al., 1995),

Methanococcus jannaschii (Bult et al., 1996), and Helicobacter pylori

(Tomb et al., 1997). The rest, of course, is history. Presently, the number

of completed or partially completed sequencing projects is in the region

of hundreds, rather than tens, of genomes (Paine et al., 2002). Once

determined, analysis of genome sequences using gene prediction

programs has identified large numbers of ORFs, many were previously

unknown. While, it proved possible to assign functions to proteins

encoded by the majority of ORFs on the basis of their homology to extant

sequences, a significant number of ORFs show no obvious similarity to

genes of known function.

This has led to the development of many postgenomic strategies,

such as proteomics, which seek to determine function. Bacteria have

special features, generally lacking in other organisms, for proteomic

analysis, that result from the abundance of information on their genomes,

their low levels of functional redundancy, their relative simplicity of gene

regulation, and their experimental tractability. Within the context of

vaccinology, one of the key goals of postgenomic research is to

113

determine differences between two related microbes, or, more generally,

cells, or between the same microbe or cell under different growth

conditions (Grandi et al., 2001).

Recently, the application of global identification methodologies has

resulted in identification of quorum-regulated processes as well as the

characterization of quorum circuit archithcture in E. coli, Streptococcus

pneumoniae and Pseudomonas aeruginosa (Delisa et al., 2001). Among

these, transcriptom analysis using DNA microarray has resulted in a huge

amount of data in genes likely to be involved in virulence factors.

However, this method only represents mRNA levels, the transmitters of

genetic information, not levels of functional cellular and extracellular

proteins.

The aim of this study was to determine the protein changes of

EHEC strain by inactivated luxS gene. E. coli, a species with a well-

known protein patterns in proteomics databases (Han and Lee, 2006)

were chosen as a test organism. The results should contribute to the

understanding of the function of luxS gene and its biological effect on

bacterial proteins. The production of new proteins and/or changes in a

regulatory mechanism can have unforeseen effects on the physiology of

the host cells, with possibly detrimental consequences to the desired

application.

114

2. MATERIALS AND METHODS

Preparation of secreted proteins and cellular proteins

The bacterial cells were harvested by centrifugation for 40 min at 4 at ℃

8000 × g. The supernatant was discarded and the pellet was washed three

times with PBS. Following centrifugation, pellet was suspended in a lysis

buffer (40 mM Tris-HCl, 1% Triton X-100, 1 mM MgSO4• 7H2O, 1 mM

EDTA; pH 8.0) containing 1 mM PMSF. The cells were lysed on ice by

sonicating 5 to 6 times for 10s with an 80% pulse duration until a clear

solution was obtained. For the preparation of secreted proteins of

EHEC strains, overnight cultures in Nutrient broth were diluted 1:50 in

Dulbecco’s modified Eagle’s medium (DMEM) and were incubated for

12 hrs, respectively, at 37 in a 5%℃ (vol/vol) CO2 atmosphere. Bacterial

cells were removed from the culture by centrifugation (5,500 × g, 10 min,

4 ), and the supernatant was filtered through a 0.22 ℃ ㎛-pore size small-

protein binding filter (Millex; Millipore, Bedford, U.S.A). PMSF (3 mM)

was added when the cultures were harvested to prevent proteolysis during

sample preparation. The secreted protein fraction was isolated by

trichloroacetic acid precipitation, and the protein pellet was washed thrice

with -20 acetone and then℃ air dried. The protein pellet was solubilized

in ReadyPrep reagent 3 (5 M urea, 2 M thiourea, 2%[wt/vol] CHAPS,

115

2%[wt/vol] SB 3-10, 40 mM Tris, and 0.2% [wt/vol] Bio-Lyte 3/10

ampholyte; Bio-Rad, Richmond, U.S.A.) and was stored at -20℃ until

analysis. The protein concentration was determined by use of a Bio-Rad

protein assay kit, with bovine serum albumin as a standard.

SDS-PAGE

Protein concentration was measured by the method of Bradford (1976),

using bovine serum albumin (BSA) (Sigma, St. Louis, U.S.A.) as

standard. The specificactivity was expressed as the enzymatic activity (U)

per mg of protein. Polyacrylamide gel electrophoresis (PAGE) (12.5%,

w/w) in the presence of sodium dodecyl sulfate (SDS) was carried out by

the method of Laemmli (1970). The electrophoresed protein gels were

stained with Coomassie brilliant blue R250 (Sigma, St. Louis, U.S.A.).

Isoelectric focusing (IEF)

IEF was carried out using 13 cm, pH 4-7 linear Immobiline IPG gels

(Amersham Biosciences, Piscataway, U.S.A.). The sample was loaded by

in-gel rehydration by mixing 100 ㎍ of protein sample with re-swelling

solution containing 8 M urea, 2.0% w/v CHAPS, 0.3% w/v DTT, 2.0%

v/v pH 4-7 IPG buffer (Amersham Biosciences, Piscataway, U.S.A.), and

a trace of bromophenol blue, to a final volume of 350 ㎕. This final

116

sample mixture was applied to an IPG gel, which was incubated at room

temperature for 10 hrs. IEF was carried out for 76500 Vhr at 20 in a ℃

IPG phor (Amersham Biosciences, Piscataway, U.S.A.), whrerin the

voltage was linearly increased from 500 V to 3500 V over the first 5 hrs,

and then maintained at 3500 V for the final 17.5 hrs by an EPS 3500 XL

power supply (Amersham Biosciences, Piscataway, U.S.A.).

Two dimensional gel electrophoresis (2-DE)

After equilibration, the IPG gels were transferred to the top of 12 % SDS

gel, with the IPG gels pressed firmly to the slab gel surface to ensure

successful protein transfer. SDS-PAGE was carried out in a Pretean ll xi

Multi-Cell (Bio-Rad, Richmond, U.S.A.) at 40 mA per gel, using the

PlusOne Sliver Staining Kit (Amersham Biosciences, Piscataway,

U.S.A.).

In gel proteolytic digestion and MALDI-TOF

The sample preparation for MALDI-TOF/MS was performed using a

method described elsewhere. Briefly, the protein spots of interest were

excised and destained by washing with 25 mM ammonium bicarbonate

containing 50% CAN. The gels were dehydrated by adding 100% CAN,

rehydrated in ice by adding 20 ㎕ of 25 mM ammonium bicarbonate

117

containing 10 mg/mL of sequencing grade modified trypsin(Promega,

Madison, U.S.A.). After incubation at 37 for 20 hrs, the peptides were ℃

extracted with 0.1% TFA in 50% ACN. The supernatants were recovered

and dried in the Speed-Vac. The samples were reconstituted in 0.1% TFA

and concentrated with C18 ZipTipsTM (Millipore, Bedford, U.S.A.). The

purified peptides were eluted with a saturated matrix solution (CHCA in

60% CAN and 0.1% TFA). The monoisotopic masses(M + 1) of the

tryptic fragments were measured in a Perspective Biosystem MALDI-

TOF/MS voyager DE-STR Mass Spectrometer (Perspective Biosystem ,

Framingham, U.S.A.).

Data analysis

The spectra were searched and identified using the MS-Fit system

(http:// prospector.ucsf.edu/prospector/4.0.8/html/msfit.htm) and

MASCOT (http://matrixscience.com) with an E. coli subset of NCBI

database. The known keratin masses and trypsin autodigest products were

excluded from the searches. The parameters were set as either missed

cleavage or acrylamide modification. The protein identities were assigned

if at lease five peptide masses matched within a maximum error of 50

ppm, and the candidate agreed with the estimated pI and molecular

weight from the 2-DE gels. The fold difference changes were analyzed

using the Melanie 7.0 software (ExpaSy, Rosen, Switzerland).

118

Statical analysis

All experiments were conducted at least in triplicate. The effects of each

of the treatment were analyzed by ANOVA, followed by Duncan's test in

SAS software package (Version 9.1; SAS Inc., Cary, U.S.A.). The level

of significance was defined at p<0.05.

119

3. RESULTS

Patterns of proteome in clinical isolate and standard

strain

To examine the expression patterns of proteome between the clinical

isolate and standard strain, these strains were performed 2-DE with each

strain. As a result, about 360 proteome spots were identified from the

each strain, and all of them showed similar patterns. The mass and

thickness proteome spots were mainly related to the general metabolism

of the strains and showed similar expression patterns. The rest of the

different spots were also identified, which showed very similar

expression patterns, although it was the proteome analysis between the

different strains (Fig. III-1 ).

SDS-PAGE and 2-DE analysis of luxS/QS related

strains

Before strains were performed a proteome analysis between the strains,

the expression patterns of the protein were examined by SDS-PAGE. The

result of coomassie brilliant blue staining after SDS-PAGE by extracting

protein from the three strains (CI03J, ML03J, and RL03J) used for the

120

results showed that similar protein patterns existed for the three strains,

but a different protein was not found among them. In the case of cellular

proteins, a number of bands were identified, but relatively few bands

were identified in the result on extracellular proteins. Moreover, while the

band moved stably on the cellular protein gels, the smearing of the band

was noticeable in the case of secreted proteins (Fig. III-2). In the test

using 2-DE, meanwhile, exact identification of the expressed proteome

was possible.

121

Figure III-1. 2-DE images of EDL 933(ATCC43895) EHEC O157:H7

and CI03J(clinical isolate) EHEC O157:H7. Gel were stained with

silver nitrate and analysised with Melanin 2D program.

pH 4-7 pH 4-7

EDL933(ATCC43895) CI03J (clinical isolate)

10 10

250

(kDa)

250

(kDa)

pH 4-7 pH 4-7

EDL933(ATCC43895) CI03J (clinical isolate)

10 10

250

(kDa)

250

(kDa)

122

Figure III-2. SDS-PAGE of proteins in CI03J (wild-type strain),

ML03J (luxS mutant) and RL03J(ML03J complemented with

pEXP5-CT). Lane M, molecular weight marker proteins; lane 1 and 2,

cellular proteins of CI03J; lane 3 and 4, cellular proteins of ML03J; lane

5 and 6, cellular proteins of RL03J; lane 7 and 8, secreted proteins of

CI03J; lane 9 and 10, secreted proteins of ML03J, lane 11 and 12,

secreted proteins of RL03J.

M 1 2 3 4 5 6 7 8 9 10 11 12M 1 2 3 4 5 6 7 8 9 10 11 12

123

Proteome profiling wild-type, luxS mutant and

complement strains

After testing 2DE with the three strains, these were identified about 200

from the entire proteome. Although most proteome was related to

metabolism, these results were drew out the main pathogenic factors. The

identification of the entire proteome and the difference of expression

among the three germ strains are shown in Table III-1, 2. Fig.III-3 and 4

show the comparative analysis of the difference between proteins, and

this is indicated in Table III-1 and 2.

Influence of luxS mutation on protein expression in

EHEC O157:H7

Strains were further analyzed the proteome profiles in CI03J, its

isogenic luxS mutant strain ML03J, and complemented strain RL03J (Fig.

III-4 and 5). As summarized in Table III-3 and 4 , the total 41 proteins

were differentially expressed at least 2-fold by deletion of luxS.

For the entire extracted proteins, including the proteins for which a

difference was identified, the expression difference was examined using

an intensity-based analysis program. After comparing the relative protein

density of CI03J and ML03J, the spot with the biggest difference was

DNA primase, which showed about 150-fold density difference, and the

124

spot with the smallest difference was fliN, which showed about 1.2 times

difference. Most proteins showed up to 2~4 folds expression difference.

Among the proteins extracted, cytolysin A (2.1 folds), the pore forming

toxin, identified as virulence factor, SepD (4 folds), the effector molecule,

related to T3SS, and Shiga toxin II subunit B (3 folds) were found, the

toxin known as the main pathogenic factor of EHEC. Surprisingly, a

dramatic increase in expression of the pO157-encoded hemolysin in the

CI03J as compared to the luxS mutant ML03J were observed. In addition,

we identified some LuxS-dependent proteins, such as cytolysin A and

phospholipase A, which have not been previously reported.

125

Figure III-3. Comparative 2-DE of soluble proteins fraction of CI03J(wild-type), ML03J(luxS mutant) and

RL03J(complemented luxS gene)

pH4-7 pH4-7 pH4-7 pH4-7 pH4-7pH4-7

Area-1 Area-1 Area-1

Area-2Area-2 Area-2

Area-3 Area-3 Area-3

Area-4 Area-4Area-4

Area-5 Area-5 Area-5

Area-6Area-6Area-6

CI03J(cellular proteins)

ML03J(cellular proteins)

RL03J(cellular proteins)

CI03J(secreted proteins)

ML03J(secreted proteins)

RL03J(secreted proteins)

pH4-7 pH4-7 pH4-7 pH4-7 pH4-7pH4-7

Area-1 Area-1 Area-1

Area-2Area-2 Area-2

Area-3 Area-3 Area-3

Area-4 Area-4Area-4

Area-5 Area-5 Area-5

Area-6Area-6Area-6

pH4-7 pH4-7 pH4-7 pH4-7 pH4-7pH4-7pH4-7pH4-7 pH4-7pH4-7 pH4-7pH4-7 pH4-7pH4-7 pH4-7pH4-7pH4-7pH4-7

Area-1 Area-1 Area-1

Area-2Area-2 Area-2

Area-3 Area-3 Area-3

Area-4 Area-4Area-4

Area-5 Area-5 Area-5

Area-6Area-6Area-6

CI03J(cellular proteins)

ML03J(cellular proteins)

RL03J(cellular proteins)

CI03J(secreted proteins)

ML03J(secreted proteins)

RL03J(secreted proteins)

126

Figure III-4. A: Cellular proteomes(CPs) of strains, B: Secreted proteomes (ECPs) of strains.

ECP1ECP2

ECP3

ECP4 ECP5

ECP6ECP7 ECP8 ECP9

ECP10

ECP11

ECP12ECP13

ECP15

ECP14

ECP16

ECP17

ECP18

ECP22

ECP19

ECP20

CI03J(luxS+) ML03J(luxS-) RL03J(luxS+)

CP1

CP2

CP3

CP9CP5

CP8

CP14

CP12

CP13

CP15

CP16

CP6CP7

CP10CP11

CP4

CP19

CP17

CP18

ECP21

A

B

pI4-7 pI4-7 pI4-7

pI4-7 pI4-7

10

250

(Kda)

10

250

(Kda)

ECP1ECP2

ECP3

ECP4 ECP5

ECP6ECP7 ECP8 ECP9

ECP10

ECP11

ECP12ECP13

ECP15

ECP14

ECP16

ECP17

ECP18

ECP22

ECP19

ECP20

CI03J(luxS+) ML03J(luxS-) RL03J(luxS+)

CP1

CP2

CP3

CP9CP5

CP8

CP14

CP12

CP13

CP15

CP16

CP6CP7

CP10CP11

CP4

CP19

CP17

CP18

ECP21

A

B

pI4-7 pI4-7 pI4-7

pI4-7 pI4-7

10

250

(Kda)

10

250

(Kda)

127

Figure III-5. Two dimentional gel electrophoresis(2-DE) images of differntially expressed proteomes in strains.

CI03J(W), ML03J(M) and RL03J(R).

Cellular proteins

FliC

(CP4)

Flagellin

(CP7)

FliC

flagellin

EspG protein(CP10)

Hemolysin(CP14)

WWWW MMMM RRRR

Extracellular proteins

WWWW MMMM RRRR

Cytolysin A(ECP4)

CheA protein(ECP10)

SepD(ECP12)

Shiga toxin II subunit B(ECP17)

Cellular proteins

FliC

(CP4)

Flagellin

(CP7)

FliC

flagellin

EspG protein(CP10)

Hemolysin(CP14)

WWWW MMMM RRRR

Extracellular proteins

WWWW MMMM RRRR

Cytolysin A(ECP4)

CheA protein(ECP10)

SepD(ECP12)

Shiga toxin II subunit B(ECP17)

128

Table III-1. Cellular proteome profiles of CI03J, RL03J and ML03J

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-1 PCFO71 outermembrane usher protein 46369881 97136 5.7 51 - 4 51.0 12.8 4.0

C-2 transcriptional regulator 1789193M 83716 5.6 - 32 40 (32.0) (40.0) 1.3

C-3 type II secretion protein COG0060 3822148M 55930 5.9 188 191 165 (1.0) 1.1 (1.2)

C-4 ATPse involved in DNA repair 75513221M 61397 5.4 43 23 3 1.9 14.3 (7.7)

C-5 translation initiation factor IF2-3 12053635 78984 5.7 - 30 39 (30.0) (39.0) 1.3

C-6 phosphoenolpyruvate protein 18152906 58385 5.1 58 48 77 1.2 (1.3) 1.6

C-7 FliC 30059860M 68134 4.5 48 11 150 4.4 (3.1) 13.6

C-8 unnamed protein product 762929 52649 5.5 87 58 91 1.5 1.0 1.6

C-9 flagellin 6009845 57809 4.7 187 - 148 187.0 1.3 148.0

C-10 signal transduction histidine kinase 75196984M 50282 5.5 105 74 179 1.4 (1.7) 2.4

C-11 unreadable - - - 141 - 103 141.0 1.4 103.0

C-12 unnamed protein product 41563 52095 5.2 140 103 179 1.4 (1.3) 1.7

C-13 GroEL 18028158 57304 4.9 109 62 50 1.8 2.2 (1.3)

C-14 flagellin 33590252 52404 4.9 38 39 92 (1.0) (2.4) 2.4

C-15 LeoA 6653193 64942 5.1 23 17 43 1.4 (1.9) 2.5

C-16 flagellin 33590250 62353 4.5 48 - 83 48.0 (1.7) 83.0

C-17 translocated intimin receptor 63002564M 58009 5 109 94 115 1.2 (1.1) 1.2

C-18 K+ efflux antiporter, glutathione regulated 1786232M 67796 5.7 88 6 112 14.6 (1.3) 18.7

C-19 ManC 56122507 52311 5.7 140 74 134 1.9 1.0 1.8

C-20 alpha-D-fructohydrolase 44829550M 52589 5.2 143 128 161 1.1 (1.1) 1.3

C-21 biosynthesis; flagellin, filament structural protein 1788232M 51295 4.5 153 - 160 153.0 1.0 160.0

C-22 conserved hypothetical protein 85674993M 62803 5.7 74 70 4 1.1 18.5 (17.5)

C-23 unnamed protein product 41617M 57269 4.8 69 65 93 1.1 (1.3) 1.4

C-24 hypothetical protein pO157 p50 10955316M 71658 5.2 - - 63 - 63.0 63.0

C-25 RmlB 63033901 40516 5.5 102 89 109 1.1 (1.1) 1.2

C-26 aspartate aminotarnsferase 78214811 43579 5.5 149 73 157 1.2 (1.1) 2.2

C-27 hypothetical protein 85677000M 69578 5.8 - - 25 - 25.0 25.0

C-28 hypothetical protein pO157 p50 10955316M 39574 5.6 78 84 134 (1.1) (1.7) 1.6

C-29 biotin synthase and related enzymes 75511378M 39648 5.3 70 17 149 4.1 (2.1) 8.8

C-30 orf, hypothetical protein 1788606M 63634 5.7 167 78 162 2.1 1.0 2.1

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-1 PCFO71 outermembrane usher protein 46369881 97136 5.7 51 - 4 51.0 12.8 4.0

C-2 transcriptional regulator 1789193M 83716 5.6 - 32 40 (32.0) (40.0) 1.3

C-3 type II secretion protein COG0060 3822148M 55930 5.9 188 191 165 (1.0) 1.1 (1.2)

C-4 ATPse involved in DNA repair 75513221M 61397 5.4 43 23 3 1.9 14.3 (7.7)

C-5 translation initiation factor IF2-3 12053635 78984 5.7 - 30 39 (30.0) (39.0) 1.3

C-6 phosphoenolpyruvate protein 18152906 58385 5.1 58 48 77 1.2 (1.3) 1.6

C-7 FliC 30059860M 68134 4.5 48 11 150 4.4 (3.1) 13.6

C-8 unnamed protein product 762929 52649 5.5 87 58 91 1.5 1.0 1.6

C-9 flagellin 6009845 57809 4.7 187 - 148 187.0 1.3 148.0

C-10 signal transduction histidine kinase 75196984M 50282 5.5 105 74 179 1.4 (1.7) 2.4

C-11 unreadable - - - 141 - 103 141.0 1.4 103.0

C-12 unnamed protein product 41563 52095 5.2 140 103 179 1.4 (1.3) 1.7

C-13 GroEL 18028158 57304 4.9 109 62 50 1.8 2.2 (1.3)

C-14 flagellin 33590252 52404 4.9 38 39 92 (1.0) (2.4) 2.4

C-15 LeoA 6653193 64942 5.1 23 17 43 1.4 (1.9) 2.5

C-16 flagellin 33590250 62353 4.5 48 - 83 48.0 (1.7) 83.0

C-17 translocated intimin receptor 63002564M 58009 5 109 94 115 1.2 (1.1) 1.2

C-18 K+ efflux antiporter, glutathione regulated 1786232M 67796 5.7 88 6 112 14.6 (1.3) 18.7

C-19 ManC 56122507 52311 5.7 140 74 134 1.9 1.0 1.8

C-20 alpha-D-fructohydrolase 44829550M 52589 5.2 143 128 161 1.1 (1.1) 1.3

C-21 biosynthesis; flagellin, filament structural protein 1788232M 51295 4.5 153 - 160 153.0 1.0 160.0

C-22 conserved hypothetical protein 85674993M 62803 5.7 74 70 4 1.1 18.5 (17.5)

C-23 unnamed protein product 41617M 57269 4.8 69 65 93 1.1 (1.3) 1.4

C-24 hypothetical protein pO157 p50 10955316M 71658 5.2 - - 63 - 63.0 63.0

C-25 RmlB 63033901 40516 5.5 102 89 109 1.1 (1.1) 1.2

C-26 aspartate aminotarnsferase 78214811 43579 5.5 149 73 157 1.2 (1.1) 2.2

C-27 hypothetical protein 85677000M 69578 5.8 - - 25 - 25.0 25.0

C-28 hypothetical protein pO157 p50 10955316M 39574 5.6 78 84 134 (1.1) (1.7) 1.6

C-29 biotin synthase and related enzymes 75511378M 39648 5.3 70 17 149 4.1 (2.1) 8.8

C-30 orf, hypothetical protein 1788606M 63634 5.7 167 78 162 2.1 1.0 2.1

129

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-31 hypothetical protein 10955316M 71658 5.2 98 94 101 1.0 1.0 1.1

C-32 UDP-glucose-6-dehydrogenase 11464509M 43713 5.9 30 191 95 (6.4) (3.2) (2.0)

C-33 orf, hypothetical protein 1786897M 52781 4.8 185 103 135 1.8 1.4 1.3

C-34 EspG protein 54311594 43901 5.2 71 34 114 2.1 (1.6) 3.4

C-35 rOrf2 2865270 43919 5.2 92 - 146 92.0 (1.6) 146.0

C-36 IucA 71274418 65539 5.7 74 62 60 1.2 1.2 1.0

C-37 unnamed protein product 4467402M 58014 5.2 51 30 171 1.7 (3.4) 5.7

C-38 DNA gyrase subunit A 41642 97036 5.1 192 76 170 2.5 1.1 2.2

C-39 protein kinase 606149 87826 5 15 6 51 2.5 (3.4) 8.5

C-40 probable outer membrane porin protein 1786332M 95500 4.9 102 35 61 2.9 1.7 1.7

C-41 putative outer membrane proteinVpr 21307716 90584 4.9 22 20 91 1.1 (4.1) 4.6

C-42 unknown 598469 81571 5.9 - - 41 - (41.0) 41.0

C-43 KfoE hypothetical protein 21326781 60806 6.1 10 25 70 (2.5) (7.0) 2.8

C-44 orf, hypothetical protein 1788981M 62007 5.6 71 62 25 1.2 2.8 (2.5)

C-45 putative membrane protein 48994919M 91793 5.1 199 26 151 7.7 1.3 5.8

C-46 Malata synthase 75515234M 80489 5.8 - - 26 - (26.0) 26.0

C-47 Aconitase B 75511993M 93499 5.2 183 - 173 183.0 1.1 173.0

C-48 Rnase G 1789645M 56065 5.7 65 23 77 2.8 (1.2) 3.3

C-49 putative membrane protein 48994919M 91793 5.1 183 - 173 183.0 1.1 173.0

C-50 TraD 32470007M 81490 5.3 19 17 112 1.1 (5.9) 6.6

C-51 NAD-dependent DNA ligase 75515754M 73607 5.4 39 28 23 1.4 1.7 (1.2)

C-52 ATP-dependent protease binding subunit 147365 95544 5.3 82 - 72 82.0 1.1 72.0

C-53 WbrX 46487632 82231 5.3 25 20 29 1.3 (1.2) 1.5

C-54 HlyD protein 2208952 54466 5.7 154 69 158 2.2 1.0 2.3

C-55 Hemolysin secretion protein D, chromosomal 123194M 54591 5.8 77 70 137 1.1 (1.8) 2.0

C-56 transduction histidine kinase regulating citrate 75514713M 61685 5.8 40 21 39 1.9 1.0 1.9

C-57 endonuclease 45157173M 117088 5.8 8 - 6 8.0 1.3 6.0

C-58 unreadable - - - 100 90 144 1.1 (1.4) 1.6

C-59 Uncharacterized protein conserved in bacteria 75241710M 55656 5.4 95 175 138 (1.8) (1.5) (1.3)

C-60 predicted GTPase 85677092M 35660 4.8 64 - 134 64.0 (2.1) 134.0

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-31 hypothetical protein 10955316M 71658 5.2 98 94 101 1.0 1.0 1.1

C-32 UDP-glucose-6-dehydrogenase 11464509M 43713 5.9 30 191 95 (6.4) (3.2) (2.0)

C-33 orf, hypothetical protein 1786897M 52781 4.8 185 103 135 1.8 1.4 1.3

C-34 EspG protein 54311594 43901 5.2 71 34 114 2.1 (1.6) 3.4

C-35 rOrf2 2865270 43919 5.2 92 - 146 92.0 (1.6) 146.0

C-36 IucA 71274418 65539 5.7 74 62 60 1.2 1.2 1.0

C-37 unnamed protein product 4467402M 58014 5.2 51 30 171 1.7 (3.4) 5.7

C-38 DNA gyrase subunit A 41642 97036 5.1 192 76 170 2.5 1.1 2.2

C-39 protein kinase 606149 87826 5 15 6 51 2.5 (3.4) 8.5

C-40 probable outer membrane porin protein 1786332M 95500 4.9 102 35 61 2.9 1.7 1.7

C-41 putative outer membrane proteinVpr 21307716 90584 4.9 22 20 91 1.1 (4.1) 4.6

C-42 unknown 598469 81571 5.9 - - 41 - (41.0) 41.0

C-43 KfoE hypothetical protein 21326781 60806 6.1 10 25 70 (2.5) (7.0) 2.8

C-44 orf, hypothetical protein 1788981M 62007 5.6 71 62 25 1.2 2.8 (2.5)

C-45 putative membrane protein 48994919M 91793 5.1 199 26 151 7.7 1.3 5.8

C-46 Malata synthase 75515234M 80489 5.8 - - 26 - (26.0) 26.0

C-47 Aconitase B 75511993M 93499 5.2 183 - 173 183.0 1.1 173.0

C-48 Rnase G 1789645M 56065 5.7 65 23 77 2.8 (1.2) 3.3

C-49 putative membrane protein 48994919M 91793 5.1 183 - 173 183.0 1.1 173.0

C-50 TraD 32470007M 81490 5.3 19 17 112 1.1 (5.9) 6.6

C-51 NAD-dependent DNA ligase 75515754M 73607 5.4 39 28 23 1.4 1.7 (1.2)

C-52 ATP-dependent protease binding subunit 147365 95544 5.3 82 - 72 82.0 1.1 72.0

C-53 WbrX 46487632 82231 5.3 25 20 29 1.3 (1.2) 1.5

C-54 HlyD protein 2208952 54466 5.7 154 69 158 2.2 1.0 2.3

C-55 Hemolysin secretion protein D, chromosomal 123194M 54591 5.8 77 70 137 1.1 (1.8) 2.0

C-56 transduction histidine kinase regulating citrate 75514713M 61685 5.8 40 21 39 1.9 1.0 1.9

C-57 endonuclease 45157173M 117088 5.8 8 - 6 8.0 1.3 6.0

C-58 unreadable - - - 100 90 144 1.1 (1.4) 1.6

C-59 Uncharacterized protein conserved in bacteria 75241710M 55656 5.4 95 175 138 (1.8) (1.5) (1.3)

C-60 predicted GTPase 85677092M 35660 4.8 64 - 134 64.0 (2.1) 134.0

130

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-61 COG2186: transcriptional regulators 75258405M 29308 5 112 12 68 9.3 1.6 5.7

C-62 COG1494: transcriptional regulators 75242242M 29260 5.1 75 32 91 2.3 (1.2) 2.8

C-63 orf, hypothetical protein 1790330M 39295 5 136 - 133 136.0 1.0 133.0

C-64 unnamed protein product 40944 35556 5.9 10 99 9 9.9 1.1 (11.0)

C-65 acylneuraminate cytidylyltransferase 128091M 48737 5.9 34 38 155 1.1 (4.6) 4.1

C-66 unreadable - - - 53 52 91 1.0 (1.7) 1.8

C-67 EspB protein 57434443 33234 5.3 44 40 18 1.1 2.4 (2.2)

C-68 Ugd 56123321 43452 5.4 148 72 147 2.1 1.0 2.0

C-69 hypothetical protein 51465236M 32669 5.3 16 24 45 1.5 (2.8) 1.9

C-70 eprH 71388152 45247 4.9 45 40 48 1.1 (1.1) 1.2

C-71 pyruvate/2-oxoglutarate dehydrogenase complex 75511614 44012 5.6 44 42 78 1.1 (1.8) 1.9

C-72 lateral flagellar associates protein 59889774 35284 5.1 95 88 127 1.1 (1.3) 1.4

C-73 predicted tagatose 6-phosphate kinase 75186886M 47109 5.5 50 50 91 1.0 (1.8) 1.8

C-74 orf, hypothetical protein 1790865M 25259 5.6 89 106 63 (1.2) 1.4 (1.7)

C-75 isocitrate dehydrogenase 33383643 42913 5.2 105 191 115 (1.8) (1.1) (1.7)

C-76 mannonate hydrolase 1790778M 44838 5.4 92 91 168 1.0 (1.8) 1.8

C-77 putatuve TerA protein 24266667 32794 5.7 20 135 49 (6.8) (2.5) (2.8)

C-78 hypothetical protein yjiP 19859207 35888 6 67 70 96 (1.0) (1.4) 1.4

C-79 ClyA 18026879 33801 5.1 32 55 106 (1.7) (3.3) 1.9

C-80 fepC 41432 29869 6.2 105 96 122 1.1 (1.2) 1.3

C-81 cobalamin/Fe3+-siderophores transport components 75258674M 29784 6.1 93 83 109 1.1 (1.2) 1.3

C-82 hypothetical protein 75512106M 20589 5.2 40 - 28 40.0 1.4 28.0

C-83 dehydrogenase with different specificities 75512948M 26779 5.2 61 21 29 2.9 2.1 1.4

C-84 restriction of methylated adenine 1790811M 33520 5.7 49 84 73 (1.7) (1.5) (1.2)

C-85 RNA polymerase subunit sigma-38 55274877M 23057 5.3 89 56 42 1.6 2.1 (1.3)

C-86 orf, hypothetical protein 1788788M 22907 5.4 50 19 47 2.6 1.1 2.5

C-87 homoserin kinase 41057990 31689 5.8 16 11 93 1.5 (5.8) 8.5

C-88 O-antigen component of lipopolysaccharide chains 1736706M 36455 5.4 37 26 78 1.4 (2.1) 3.0

C-89 hemolysin 4704412 33555 5.2 166 - 174 166.0 1.0 174.0

C-90 orf, hypothetical protein 1788000M 27046 5.6 166 126 143 1.3 1.2 1.1

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-61 COG2186: transcriptional regulators 75258405M 29308 5 112 12 68 9.3 1.6 5.7

C-62 COG1494: transcriptional regulators 75242242M 29260 5.1 75 32 91 2.3 (1.2) 2.8

C-63 orf, hypothetical protein 1790330M 39295 5 136 - 133 136.0 1.0 133.0

C-64 unnamed protein product 40944 35556 5.9 10 99 9 9.9 1.1 (11.0)

C-65 acylneuraminate cytidylyltransferase 128091M 48737 5.9 34 38 155 1.1 (4.6) 4.1

C-66 unreadable - - - 53 52 91 1.0 (1.7) 1.8

C-67 EspB protein 57434443 33234 5.3 44 40 18 1.1 2.4 (2.2)

C-68 Ugd 56123321 43452 5.4 148 72 147 2.1 1.0 2.0

C-69 hypothetical protein 51465236M 32669 5.3 16 24 45 1.5 (2.8) 1.9

C-70 eprH 71388152 45247 4.9 45 40 48 1.1 (1.1) 1.2

C-71 pyruvate/2-oxoglutarate dehydrogenase complex 75511614 44012 5.6 44 42 78 1.1 (1.8) 1.9

C-72 lateral flagellar associates protein 59889774 35284 5.1 95 88 127 1.1 (1.3) 1.4

C-73 predicted tagatose 6-phosphate kinase 75186886M 47109 5.5 50 50 91 1.0 (1.8) 1.8

C-74 orf, hypothetical protein 1790865M 25259 5.6 89 106 63 (1.2) 1.4 (1.7)

C-75 isocitrate dehydrogenase 33383643 42913 5.2 105 191 115 (1.8) (1.1) (1.7)

C-76 mannonate hydrolase 1790778M 44838 5.4 92 91 168 1.0 (1.8) 1.8

C-77 putatuve TerA protein 24266667 32794 5.7 20 135 49 (6.8) (2.5) (2.8)

C-78 hypothetical protein yjiP 19859207 35888 6 67 70 96 (1.0) (1.4) 1.4

C-79 ClyA 18026879 33801 5.1 32 55 106 (1.7) (3.3) 1.9

C-80 fepC 41432 29869 6.2 105 96 122 1.1 (1.2) 1.3

C-81 cobalamin/Fe3+-siderophores transport components 75258674M 29784 6.1 93 83 109 1.1 (1.2) 1.3

C-82 hypothetical protein 75512106M 20589 5.2 40 - 28 40.0 1.4 28.0

C-83 dehydrogenase with different specificities 75512948M 26779 5.2 61 21 29 2.9 2.1 1.4

C-84 restriction of methylated adenine 1790811M 33520 5.7 49 84 73 (1.7) (1.5) (1.2)

C-85 RNA polymerase subunit sigma-38 55274877M 23057 5.3 89 56 42 1.6 2.1 (1.3)

C-86 orf, hypothetical protein 1788788M 22907 5.4 50 19 47 2.6 1.1 2.5

C-87 homoserin kinase 41057990 31689 5.8 16 11 93 1.5 (5.8) 8.5

C-88 O-antigen component of lipopolysaccharide chains 1736706M 36455 5.4 37 26 78 1.4 (2.1) 3.0

C-89 hemolysin 4704412 33555 5.2 166 - 174 166.0 1.0 174.0

C-90 orf, hypothetical protein 1788000M 27046 5.6 166 126 143 1.3 1.2 1.1

131

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-91 orf, hypothetical protein 1789816M 33268 5.9 78 184 151 (2.4) (1.9) (1.2)

C-92 actin-like ATPase involved in cell 75256620M 36953 5.2 20 10 119 2.0 (6.0) 11.9

C-93 homoserin kinase 51449662M 31114 5.3 127 194 162 (1.5) (1.3) 0.8

C-94 hemolysin coregulated protein 75513636M 19256 5.5 166 56 - 3.0 166.0 (56.0)

C-95 TraF 49868031 42888 4.9 126 - 132 126.0 1.0 132.0

C-96 nitrogen regulator I 455662 48908 5.7 45 42 67 1.1 (1.5) 1.6

C-97 ST04 protein 17384630 44254 5.7 82 77 115 1.1 (1.4) 1.5

C-98 pspA protein 42539 25578 5.5 126 - 146 126.0 (1.2) 146.0

C-99 Uncharacterized conserved protein 75255879M 26423 4.7 59 27 113 2.2 (1.9) 4.2

C-100 orf, hypothetical protein 1788151M 23687 5.3 30 - 52 30.0 (1.7) 52.0

C-101 orf, hypothetical protein 1788643M 34180 5.6 43 63 104 (1.5) (2.4) 1.7

C-102 RpoS 4100834 29636 5 12 6 52 2.0 (4.3) 8.7

C-103 RNA polymerase subunit sigma-48 54401878 27360 5.8 36 60 99 (1.7) (2.8) 1.7

C-104 NTP pyrophosphohydrolases containing a Zn-finger 75514763M 29689 5.5 137 141 138 (1.0) 1.0 1.0

C-105 P35 606106 35044 5.6 66 54 69 1.2 1.0 1.3

C-106 pseudouridine synthase 75513381M 35087 5.7 26 49 76 (1.9) (2.9) 1.6

C-107 orf, hypothetical protein 1788643M 34180 5.6 15 10 98 1.5 (6.5) 9.8

C-108 putative 2-component transcriptional regulator 1789402M 24678 6.5 78 189 150 (2.4) (1.9) (1.3)

C-109 predicted GTPase 85677092M 35660 4.8 121 98 104 1.2 1.2 1.1

C-110 unnamed protein product 42353 27585 5.1 8 165 30 (20.6) (3.8) (5.5)

C-111 orf, hypothetical protein 24051467M 17911 4.9 92 37 119 2.5 (1.3) 3.2

C-112 polymerase III subunit alpha 19548850 24092 5 135 147 142 (1.1) 1.0 1.0

C-113 orf, hypothetical protein 48995000M 34180 5.6 109 84 74 1.3 1.5 (1.1)

C-114 Fcf1 46487620 35595 5.6 70 28 158 2.5 (2.3) 5.6

C-115 malate/lactate dehydrogenase 75511868M 32338 5.6 50 57 106 (1.1) (2.1) 1.9

C-116 fructokinase 32329607 33021 5 189 170 166 1.1 1.1 1.0

C-117 probable fructokinase 1073355 33082 5.2 101 94 145 1.1 (1.4) 1.5

C-118 unnamed protein product 581223 21253 5.2 110 41 89 2.7 1.2 2.2

C-119 leucine/isoleucine/valine transporter subunit 85676589M 26310 5.6 109 44 140 2.5 (1.3) 3.2

C-120 TPA:hypothetical protein 86212233M 23254 5.3 141 35 145 4.0 1.0 4.1

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-91 orf, hypothetical protein 1789816M 33268 5.9 78 184 151 (2.4) (1.9) (1.2)

C-92 actin-like ATPase involved in cell 75256620M 36953 5.2 20 10 119 2.0 (6.0) 11.9

C-93 homoserin kinase 51449662M 31114 5.3 127 194 162 (1.5) (1.3) 0.8

C-94 hemolysin coregulated protein 75513636M 19256 5.5 166 56 - 3.0 166.0 (56.0)

C-95 TraF 49868031 42888 4.9 126 - 132 126.0 1.0 132.0

C-96 nitrogen regulator I 455662 48908 5.7 45 42 67 1.1 (1.5) 1.6

C-97 ST04 protein 17384630 44254 5.7 82 77 115 1.1 (1.4) 1.5

C-98 pspA protein 42539 25578 5.5 126 - 146 126.0 (1.2) 146.0

C-99 Uncharacterized conserved protein 75255879M 26423 4.7 59 27 113 2.2 (1.9) 4.2

C-100 orf, hypothetical protein 1788151M 23687 5.3 30 - 52 30.0 (1.7) 52.0

C-101 orf, hypothetical protein 1788643M 34180 5.6 43 63 104 (1.5) (2.4) 1.7

C-102 RpoS 4100834 29636 5 12 6 52 2.0 (4.3) 8.7

C-103 RNA polymerase subunit sigma-48 54401878 27360 5.8 36 60 99 (1.7) (2.8) 1.7

C-104 NTP pyrophosphohydrolases containing a Zn-finger 75514763M 29689 5.5 137 141 138 (1.0) 1.0 1.0

C-105 P35 606106 35044 5.6 66 54 69 1.2 1.0 1.3

C-106 pseudouridine synthase 75513381M 35087 5.7 26 49 76 (1.9) (2.9) 1.6

C-107 orf, hypothetical protein 1788643M 34180 5.6 15 10 98 1.5 (6.5) 9.8

C-108 putative 2-component transcriptional regulator 1789402M 24678 6.5 78 189 150 (2.4) (1.9) (1.3)

C-109 predicted GTPase 85677092M 35660 4.8 121 98 104 1.2 1.2 1.1

C-110 unnamed protein product 42353 27585 5.1 8 165 30 (20.6) (3.8) (5.5)

C-111 orf, hypothetical protein 24051467M 17911 4.9 92 37 119 2.5 (1.3) 3.2

C-112 polymerase III subunit alpha 19548850 24092 5 135 147 142 (1.1) 1.0 1.0

C-113 orf, hypothetical protein 48995000M 34180 5.6 109 84 74 1.3 1.5 (1.1)

C-114 Fcf1 46487620 35595 5.6 70 28 158 2.5 (2.3) 5.6

C-115 malate/lactate dehydrogenase 75511868M 32338 5.6 50 57 106 (1.1) (2.1) 1.9

C-116 fructokinase 32329607 33021 5 189 170 166 1.1 1.1 1.0

C-117 probable fructokinase 1073355 33082 5.2 101 94 145 1.1 (1.4) 1.5

C-118 unnamed protein product 581223 21253 5.2 110 41 89 2.7 1.2 2.2

C-119 leucine/isoleucine/valine transporter subunit 85676589M 26310 5.6 109 44 140 2.5 (1.3) 3.2

C-120 TPA:hypothetical protein 86212233M 23254 5.3 141 35 145 4.0 1.0 4.1

132

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-121 negative regulatorof sigma E activity 75513182 24322 5.1 82 86 10 (1.1) 8.2 (8.6)

C-122 KfiA 496605M 27332 5.3 12 - 16 12.0 (1.3) 16.0

C-123 typeIII secretion apparatus protein 62085064 22310 6 48 127 59 (2.7) (1.2) (2.2)

C-124 uncharacterized iron regulated protein 75512807M 25529 6 78 182 150 (2.3) (1.9) (1.2)

C-125 periplasmic component/domain 75512869M 26930 5.8 31 10 7 3.1 4.4 (1.4)

C-126 putative major fimbrial subunit 1850975 29302 4.9 66 52 78 1.3 (1.2) 1.5

C-127 uncharacterized stress induced protein 75514294M 33175 5.1 123 58 139 2.1 (1.1) 2.4

C-128 orf, hypothetical protein 1786725 28731 4.9 59 20 31 3.0 1.9 1.6

C-129 COG1309: transcriptional regulator 75514895 22776 4.9 146 37 147 4.0 1.0 4.0

C-130 orf, hypothetical protein 24054813 21931 4.9 123 46 109 2.7 1.1 2.4

C-131 unreadable - - - 64 68 84 (1.1) (1.3) 1.2

C-132 bacterioferritin 75511241M 18495 4.7 92 19 119 4.8 (1.3) 6.3

C-133 F0F1-type ATP synthase delta subunit 75258274M 19332 4.9 91 58 45 1.6 2.0 (1.3)

C-134 tryptophan synthase subunit B 37953704 37886 5.9 13 10 19 1.3 (1.3) 1.9

C-135 dehydrogenase 18266410M 43658 5.7 13 10 18 1.3 (1.4) 1.8

C-136 outer membrane protein 75231159M 38922 4.9 90 91 92 (1.0) 1.0 1.0

C-137 hypothetical protein 1789434 48389 5.7 49 43 63 1.1 (1.3) 1.5

C-138 VgrG protein 2920640 49845 6.1 - 25 40 (25.0) (40.0) 1.6

C-139 oligopeptide transport protein 89108090 57342 6.7 16 19 8 (1.2) 2.0 (2.4)

C-140 TraJ 51038823 42530 5.8 31 101 19 (3.3) 1.6 (5.3)

C-141 Orf_f408 606356 45130 5.3 162 158 168 1.0 1.0 1.1

C-142 TraC_4 4892 50124 5.6 80 48 146 1.7 (1.8) 3.0

C-143 phenylalanine tRNA synthetase 1742793 40142 5.3 163 134 118 1.2 1.4 (1.1)

C-144 hypothetical protein 89109723 46245 5.3 148 1.6 312.5 27.9 0.5 195.3

C-145 acyl-CoA thioesterase I 124530254 23563 4.6 134 4.2 (1.2) 29.1 (1.2) (0.3)

Spot number Protein name NCBI accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

C-121 negative regulatorof sigma E activity 75513182 24322 5.1 82 86 10 (1.1) 8.2 (8.6)

C-122 KfiA 496605M 27332 5.3 12 - 16 12.0 (1.3) 16.0

C-123 typeIII secretion apparatus protein 62085064 22310 6 48 127 59 (2.7) (1.2) (2.2)

C-124 uncharacterized iron regulated protein 75512807M 25529 6 78 182 150 (2.3) (1.9) (1.2)

C-125 periplasmic component/domain 75512869M 26930 5.8 31 10 7 3.1 4.4 (1.4)

C-126 putative major fimbrial subunit 1850975 29302 4.9 66 52 78 1.3 (1.2) 1.5

C-127 uncharacterized stress induced protein 75514294M 33175 5.1 123 58 139 2.1 (1.1) 2.4

C-128 orf, hypothetical protein 1786725 28731 4.9 59 20 31 3.0 1.9 1.6

C-129 COG1309: transcriptional regulator 75514895 22776 4.9 146 37 147 4.0 1.0 4.0

C-130 orf, hypothetical protein 24054813 21931 4.9 123 46 109 2.7 1.1 2.4

C-131 unreadable - - - 64 68 84 (1.1) (1.3) 1.2

C-132 bacterioferritin 75511241M 18495 4.7 92 19 119 4.8 (1.3) 6.3

C-133 F0F1-type ATP synthase delta subunit 75258274M 19332 4.9 91 58 45 1.6 2.0 (1.3)

C-134 tryptophan synthase subunit B 37953704 37886 5.9 13 10 19 1.3 (1.3) 1.9

C-135 dehydrogenase 18266410M 43658 5.7 13 10 18 1.3 (1.4) 1.8

C-136 outer membrane protein 75231159M 38922 4.9 90 91 92 (1.0) 1.0 1.0

C-137 hypothetical protein 1789434 48389 5.7 49 43 63 1.1 (1.3) 1.5

C-138 VgrG protein 2920640 49845 6.1 - 25 40 (25.0) (40.0) 1.6

C-139 oligopeptide transport protein 89108090 57342 6.7 16 19 8 (1.2) 2.0 (2.4)

C-140 TraJ 51038823 42530 5.8 31 101 19 (3.3) 1.6 (5.3)

C-141 Orf_f408 606356 45130 5.3 162 158 168 1.0 1.0 1.1

C-142 TraC_4 4892 50124 5.6 80 48 146 1.7 (1.8) 3.0

C-143 phenylalanine tRNA synthetase 1742793 40142 5.3 163 134 118 1.2 1.4 (1.1)

C-144 hypothetical protein 89109723 46245 5.3 148 1.6 312.5 27.9 0.5 195.3

C-145 acyl-CoA thioesterase I 124530254 23563 4.6 134 4.2 (1.2) 29.1 (1.2) (0.3)

133

Table III-2. Secreted (extracellular) proteome profiles of CI03J, RL03J and ML03J

Spots Protein name Accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

ECP-1 unreadable - - - 75 71 135 1.1 (1.8) 1.9

ECP-2 unreadable - - - 191 174 129 1.1 1.5 (1.4)

ECP-3 (rpoS)RNA polymerase sigma factor P13445 37972 4.9 132 5 150 26.4 (1.1) 30.0

ECP-4 (ybiK)putative L-asparaginase precursor P37595 33394 4.8 128 78 156 1.6 (1.2) 2.0

ECP-5 (traI)Tral protein(DNA helicase I) P22706 45168 5.6 150 106 87 1.4 1.7 (1.2)

ECP-6 (traC)DNA primase TraC P27190 40895 5.4 145 - 150 145.0 1.0 150.0

ECP-7 Lipoprotein 73853215M 42860 5.9 110 32 99 3.4 1.1 3.1

ECP-8 (rhsC)RhsC protein P16918 42777 6.2 166 82 147 2.0 1.1 1.8

ECP-9 unnamed protein product 10955265M 39574 5.6 45 - 63 45.0 (1.4) 63.0

ECP-10 cytolysinA 50953627M 33717 5.1 104 49 37 2.1 2.8 (1.3)

ECP-11 HsdM protein 4210349 36200 5.3 69 14 48 4.9 1.4 3.4

ECP-12 Hypothetical protein yeeJ P76347 24857 4.8 66 95 26 (1.4) 2.5 (3.7)

ECP-13 detergent resistant phospholipase A 148220 33171 5.2 153 41 56 3.7 2.7 1.4

ECP-14 dihydropteroate synthase 40548828 26585 5.3 69 24 54 2.9 1.3 2.3

ECP-15 Hypothetical protein ycjY P76049 34117 5.1 170 180 140 (1.1) 1.2 (1.3)

ECP-16 unnamed protein product 46811 34073 5 82 51 87 1.6 (1.1) 1.7

ECP-17 Hypothetical lipoprotein yfhM precursor P76578 25158 5.2 151 88 92 1.7 1.6 1.0

ECP-18 Probable ATP-dependent helicase Ihr P30015 23938 4.6 84 54 41 1.6 2.0 (1.3)

ECP-19 unreadable - - - 61 25 36 2.4 1.7 1.4

ECP-20 putative regulator 1787221M 24268 5.7 73 39 91 1.9 (1.3) 2.3

ECP-21 MbhA 984586M 23780 6.9 110 33 24 3.3 4.6 (1.4)

ECP-22 Cellulose synthase operon protein C P37650 22581 4.5 86 14 21 6.1 4.1 1.5

ECP-23 unreadable - - - 142 112 119 1.3 1.2 1.1

ECP-24 Nitrate reductase 1 alpha subunit P09152 23035 5.6 102 111 135 (1.1) (1.3) 1.2

ECP-25 Respiratory nitrate reductase 2 alpha chain P19319 23009 5.8 165 175 105 (1.1) 1.6 (1.7)

ECP-26 hypothetical protein P27190 23895 5.4 62 23 51 2.7 1.2 2.2

ECP-27 narZ P16918 24009 6.2 167 89 41 1.9 4.1 (2.2)

ECP-28 cheA protein 145519 23609 6.4 75 9 64 8.3 1.2 7.1

ECP-29 phenylacrylic decarboxylase like protein 4887557 21470 6.9 131 35 75 3.7 1.7 2.1

ECP-30 dnaE P10443 22990 5.1 62 64 103 1.0 (1.7) 1.6

ECP-31 yeaZ P76256 21181 5.1 75 64 32 1.2 2.3 (2.0)

ECP-32 yifB P32128 24177 5.2 112 60 31 1.9 3.6 (1.9)

Spots Protein name Accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

ECP-1 unreadable - - - 75 71 135 1.1 (1.8) 1.9

ECP-2 unreadable - - - 191 174 129 1.1 1.5 (1.4)

ECP-3 (rpoS)RNA polymerase sigma factor P13445 37972 4.9 132 5 150 26.4 (1.1) 30.0

ECP-4 (ybiK)putative L-asparaginase precursor P37595 33394 4.8 128 78 156 1.6 (1.2) 2.0

ECP-5 (traI)Tral protein(DNA helicase I) P22706 45168 5.6 150 106 87 1.4 1.7 (1.2)

ECP-6 (traC)DNA primase TraC P27190 40895 5.4 145 - 150 145.0 1.0 150.0

ECP-7 Lipoprotein 73853215M 42860 5.9 110 32 99 3.4 1.1 3.1

ECP-8 (rhsC)RhsC protein P16918 42777 6.2 166 82 147 2.0 1.1 1.8

ECP-9 unnamed protein product 10955265M 39574 5.6 45 - 63 45.0 (1.4) 63.0

ECP-10 cytolysinA 50953627M 33717 5.1 104 49 37 2.1 2.8 (1.3)

ECP-11 HsdM protein 4210349 36200 5.3 69 14 48 4.9 1.4 3.4

ECP-12 Hypothetical protein yeeJ P76347 24857 4.8 66 95 26 (1.4) 2.5 (3.7)

ECP-13 detergent resistant phospholipase A 148220 33171 5.2 153 41 56 3.7 2.7 1.4

ECP-14 dihydropteroate synthase 40548828 26585 5.3 69 24 54 2.9 1.3 2.3

ECP-15 Hypothetical protein ycjY P76049 34117 5.1 170 180 140 (1.1) 1.2 (1.3)

ECP-16 unnamed protein product 46811 34073 5 82 51 87 1.6 (1.1) 1.7

ECP-17 Hypothetical lipoprotein yfhM precursor P76578 25158 5.2 151 88 92 1.7 1.6 1.0

ECP-18 Probable ATP-dependent helicase Ihr P30015 23938 4.6 84 54 41 1.6 2.0 (1.3)

ECP-19 unreadable - - - 61 25 36 2.4 1.7 1.4

ECP-20 putative regulator 1787221M 24268 5.7 73 39 91 1.9 (1.3) 2.3

ECP-21 MbhA 984586M 23780 6.9 110 33 24 3.3 4.6 (1.4)

ECP-22 Cellulose synthase operon protein C P37650 22581 4.5 86 14 21 6.1 4.1 1.5

ECP-23 unreadable - - - 142 112 119 1.3 1.2 1.1

ECP-24 Nitrate reductase 1 alpha subunit P09152 23035 5.6 102 111 135 (1.1) (1.3) 1.2

ECP-25 Respiratory nitrate reductase 2 alpha chain P19319 23009 5.8 165 175 105 (1.1) 1.6 (1.7)

ECP-26 hypothetical protein P27190 23895 5.4 62 23 51 2.7 1.2 2.2

ECP-27 narZ P16918 24009 6.2 167 89 41 1.9 4.1 (2.2)

ECP-28 cheA protein 145519 23609 6.4 75 9 64 8.3 1.2 7.1

ECP-29 phenylacrylic decarboxylase like protein 4887557 21470 6.9 131 35 75 3.7 1.7 2.1

ECP-30 dnaE P10443 22990 5.1 62 64 103 1.0 (1.7) 1.6

ECP-31 yeaZ P76256 21181 5.1 75 64 32 1.2 2.3 (2.0)

ECP-32 yifB P32128 24177 5.2 112 60 31 1.9 3.6 (1.9)

134

Spots Protein name Accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

ECP-33 yahJ P77554 16854 6 149 58 109 2.6 1.4 1.9

ECP-34 agaS P42903 17192 5.1 127 103 55 1.2 2.3 (1.9)

ECP-35 Glutamine synthetase adenyltransferase P30870 20841 5 127 64 54 2.0 2.4 (1.2)

ECP-36 unreadable - - - 102 54 62 1.9 1.6 1.1

ECP-37 yjeO P39284 15837 6.1 117 62 175 1.9 (1.5) 2.8

ECP-38 acyl-CoA thioesterase I 1786702M 23622 6.9 120 31 114 3.9 1.1 3.7

ECP-39 Uncharacterized conserved protein 77475 17604 6.4 154 107 177 1.4 (1.1) 1.7

ECP-40 SepD 886476M 17563 7 178 45 108 4.0 1.6 2.4

ECP-41 MutS protein 8052216 14222 6.1 118 - 34 118.0 3.5 34.0

ECP-42 DNA polymerase I 18104428M 13024 7 81 138 53 (1.7) 1.5 (2.6)

ECP-43 Uncharacterized conserved protein 39383 8134 5.9 125 59 120 2.1 1.0 2.0

ECP-44 unreadable - - - 142 75 88 1.9 1.6 1.2

ECP-45 Shiga toxin II subunit B 13359153M 9157 6.2 34 102 94.4 (3.0) (2.8) (1.1)

ECP-46 orf, hypothetical protein 1786864M 37276 5 42 21 120 2.0 0.4 5.7

ECP-47 atoD P76458 23526 5.1 35 54 35 (1.5) 1.0 (1.5)

ECP-48 sgbE P37680 21561 5.2 51 80 36 (1.6) 1.4 (2.2)

ECP-49 manB P37755 50423 5.3 154 119 127 1.3 1.2 1.1

ECP-50 TDH P76251 40315 5.2 107 128 144 (1.2) (1.3) 1.1

ECP-51 aminopeptidase B 1799926M 46181 5.6 101 31 61 3.3 1.7 2.0

ECP-52 Uncharacterized conserved protein 75512766M 19536 6.1 82 36 18.3 2.3 4.5 (2.0)

ECP-53 Probable GTP-binding protein engB 67462332M 23561 6.9 63 18 26 3.5 2.4 1.4

ECP-54 fliN P15070 14855 5.3 67 58 42 1.2 1.6 (1.4)

ECP-55 unreadable - - - 63 49 10 1.3 6.3 (4.9)

ECP-56 Uncharacterized conserved protein 42604 14132 4.6 58 48 53 1.2 1.1 1.1

ECP-57 TraM 398515M 14508 5.3 60 29 65 2.1 (1.1) 2.2

ECP-58 Uncharacterized conserved protein 75894 14862 4.8 29 47 23 (1.6) 1.3 (2.0)

ECP-59 Uncharacterized conserved protein 75513951M 12265 5.3 42 17 7 2.5 6.0 (2.4)

ECP-60 hydroxymethylbilane synthase 41186 9816 6.3 9 55 46 (6.1) (5.1) (1.2)

Spots Protein name Accession number MW(Da) pICI03J ML03J RL03J Folds

(intensity) (intensity) (intensity) C vs M C vs R R vs M

ECP-33 yahJ P77554 16854 6 149 58 109 2.6 1.4 1.9

ECP-34 agaS P42903 17192 5.1 127 103 55 1.2 2.3 (1.9)

ECP-35 Glutamine synthetase adenyltransferase P30870 20841 5 127 64 54 2.0 2.4 (1.2)

ECP-36 unreadable - - - 102 54 62 1.9 1.6 1.1

ECP-37 yjeO P39284 15837 6.1 117 62 175 1.9 (1.5) 2.8

ECP-38 acyl-CoA thioesterase I 1786702M 23622 6.9 120 31 114 3.9 1.1 3.7

ECP-39 Uncharacterized conserved protein 77475 17604 6.4 154 107 177 1.4 (1.1) 1.7

ECP-40 SepD 886476M 17563 7 178 45 108 4.0 1.6 2.4

ECP-41 MutS protein 8052216 14222 6.1 118 - 34 118.0 3.5 34.0

ECP-42 DNA polymerase I 18104428M 13024 7 81 138 53 (1.7) 1.5 (2.6)

ECP-43 Uncharacterized conserved protein 39383 8134 5.9 125 59 120 2.1 1.0 2.0

ECP-44 unreadable - - - 142 75 88 1.9 1.6 1.2

ECP-45 Shiga toxin II subunit B 13359153M 9157 6.2 34 102 94.4 (3.0) (2.8) (1.1)

ECP-46 orf, hypothetical protein 1786864M 37276 5 42 21 120 2.0 0.4 5.7

ECP-47 atoD P76458 23526 5.1 35 54 35 (1.5) 1.0 (1.5)

ECP-48 sgbE P37680 21561 5.2 51 80 36 (1.6) 1.4 (2.2)

ECP-49 manB P37755 50423 5.3 154 119 127 1.3 1.2 1.1

ECP-50 TDH P76251 40315 5.2 107 128 144 (1.2) (1.3) 1.1

ECP-51 aminopeptidase B 1799926M 46181 5.6 101 31 61 3.3 1.7 2.0

ECP-52 Uncharacterized conserved protein 75512766M 19536 6.1 82 36 18.3 2.3 4.5 (2.0)

ECP-53 Probable GTP-binding protein engB 67462332M 23561 6.9 63 18 26 3.5 2.4 1.4

ECP-54 fliN P15070 14855 5.3 67 58 42 1.2 1.6 (1.4)

ECP-55 unreadable - - - 63 49 10 1.3 6.3 (4.9)

ECP-56 Uncharacterized conserved protein 42604 14132 4.6 58 48 53 1.2 1.1 1.1

ECP-57 TraM 398515M 14508 5.3 60 29 65 2.1 (1.1) 2.2

ECP-58 Uncharacterized conserved protein 75894 14862 4.8 29 47 23 (1.6) 1.3 (2.0)

ECP-59 Uncharacterized conserved protein 75513951M 12265 5.3 42 17 7 2.5 6.0 (2.4)

ECP-60 hydroxymethylbilane synthase 41186 9816 6.3 9 55 46 (6.1) (5.1) (1.2)

135

Table III-3. Differentially expressed cellular proteins in CI03J, RL03J strain compared to luxS mutant ML03J strain

Category Spot number Protein name NCBI accession number MOWSE score MW(Da) pI Coverage(%)

Fold Changes

C vs M C vs R R vs M

Cellular proteins

CP1 Aconitase B 75511993M 22.4 93499 5.2 22.4 183 1.06 173

CP2 K+ efflux antiporter, glutathione regulated 1786232M 24.4 67796 5.7 19.8 14.6 -1.27 18.7

CP3 ManC 56122507 23.2 52311 5.7 17.6 1.9 1.04 1.81

CP4 FliC 30059860M 74.1 68134 4.5 19 4.4 3.13 13.6

CP5 hypothetical protein 89109723 42 46245 5.3 45.7 1.6 1 1

CP6 biosynthesis; flagellin, filament structural protein 1788232M 20.3 51295 4.5 28.5 153 -1.04 160

CP7 flagellin 6009845 67.8 57809 4.7 26.7 187 1.26 173

CP8 Unreadable - - - - - 1.1 -1.44 1.6

CP9 signal transduction histidine kinase 75196984M 39.3 50282 5.5 24.9 1.42 -1.7 2.42

CP10 EspG protein 54311594 9.25 43901 5.2 8 2.1 -1.6 3.35

CP11 biotin synthase and related enzymes 75511378M 57.6 39648 5.3 10.7 4.12 -2.13 8.76

CP12 Uncharacterized conserved protein 75255879M 3.59 26423 4.7 13.4 2.2 -1.915 4.185

CP13 acyl-CoA thioesterase I 124530254 56.2 23563 4.6 24.6 4.15 -1.2 4.96

CP14 hemolysin 4704412 35.1 33555 5.2 12 166 -1.05 174

CP15 orf, hypothetical protein 24051467M 18.9 17911 4.9 26.8 2.5 -1.3 3.21

CP16 putative 2-component transcriptional regulator 1789402M 24.4 24678 6.5 13.7 -2.42 -1.923 -1.26

CP17 unnamed protein product 4584722 61630 79535 5.8 30 1.7 -3.4 5.7

CP18 Fcf1 46487620 12.9 35595 5.6 16.8 2.5 -2.3 5.64

CP19 hemolysin coregulated protein 75513636M 34.7 19256 5.5 37.2 2.96 166 -56

Category Spot number Protein name NCBI accession number MOWSE score MW(Da) pI Coverage(%)

Fold Changes

C vs M C vs R R vs M

Cellular proteins

CP1 Aconitase B 75511993M 22.4 93499 5.2 22.4 183 1.06 173

CP2 K+ efflux antiporter, glutathione regulated 1786232M 24.4 67796 5.7 19.8 14.6 -1.27 18.7

CP3 ManC 56122507 23.2 52311 5.7 17.6 1.9 1.04 1.81

CP4 FliC 30059860M 74.1 68134 4.5 19 4.4 3.13 13.6

CP5 hypothetical protein 89109723 42 46245 5.3 45.7 1.6 1 1

CP6 biosynthesis; flagellin, filament structural protein 1788232M 20.3 51295 4.5 28.5 153 -1.04 160

CP7 flagellin 6009845 67.8 57809 4.7 26.7 187 1.26 173

CP8 Unreadable - - - - - 1.1 -1.44 1.6

CP9 signal transduction histidine kinase 75196984M 39.3 50282 5.5 24.9 1.42 -1.7 2.42

CP10 EspG protein 54311594 9.25 43901 5.2 8 2.1 -1.6 3.35

CP11 biotin synthase and related enzymes 75511378M 57.6 39648 5.3 10.7 4.12 -2.13 8.76

CP12 Uncharacterized conserved protein 75255879M 3.59 26423 4.7 13.4 2.2 -1.915 4.185

CP13 acyl-CoA thioesterase I 124530254 56.2 23563 4.6 24.6 4.15 -1.2 4.96

CP14 hemolysin 4704412 35.1 33555 5.2 12 166 -1.05 174

CP15 orf, hypothetical protein 24051467M 18.9 17911 4.9 26.8 2.5 -1.3 3.21

CP16 putative 2-component transcriptional regulator 1789402M 24.4 24678 6.5 13.7 -2.42 -1.923 -1.26

CP17 unnamed protein product 4584722 61630 79535 5.8 30 1.7 -3.4 5.7

CP18 Fcf1 46487620 12.9 35595 5.6 16.8 2.5 -2.3 5.64

CP19 hemolysin coregulated protein 75513636M 34.7 19256 5.5 37.2 2.96 166 -56

136

Table III-4. Differentially expressed secreted proteins in CI03J, RL03J strain compared to luxS mutant ML03J strain

Category Spot number Protein name NCBI accession number MOWSE score MW(Da) pI Coverage(%)

Fold Changes

C vs M C vs R R vs M

Extracellular proteins

ECP1 Lipoprotein 73853215M 2.70E+14 42860 5.9 77.1 3.44 1.11 3.09

ECP2 aminopeptidase B 1799926M 2.59E+19 46181 5.6 70.7 45 -1.4 63

ECP3 unnamed protein product 10955265M 1.26 39574 5.6 25.4 2.12 2.81 -1.32

ECP4 cytolysin A 50953627M 1.10E+07 33717 5.1 62 4.93 1.44 3.43

ECP5 HsdM protein 4210349 690 36200 5.3 39.1 3.73 2.73 1.37

ECP6 detergent resistant phospholipase A 148220 4.84E+09 33171 5.2 67.8 2.88 1.3 2.25

ECP7 dihydropteroate synthase 40548828 5.35 26585 5.3 18.6 1.87 -1.25 2.33

ECP8 putative regulator 1787221M 4.50E+05 24268 5.7 21 3.33 4.58 -1.38

ECP9 MbhA 984586M 147034 23780 6.9 65.4 8.3 1.17 7.1

ECP10 cheA protein 145519 8.23E+06 23609 6.3 68.4 3.74 1.75 2.14

ECP11 Probable GTP-binding protein engB 67462332M 1.56E+09 23561 6.9 92.4 3.87 1.05 3.68

ECP12 SepD 886476M 2.66E+09 17563 7 85.4 3.96 1.65 2.4

ECP13 DNA polymerase I 18104428M 9.99E+06 13024 7 96.5 118 3.47 34

ECP14 TraM 398515M 4.73E+09 14508 5.3 98.4 -1.7 1.53 -2.6

ECP15 Uncharacterized conserved protein 75513951M 1.19E+08 12265 5.3 96.2 -3 -2.41 -1.24

ECP16 hydroxymethylbilane synthase 41186 2.69E+06 9816 6.3 78.7 2 -2.86 5.7

ECP17 Shiga toxin II subunit B 13359153M 2.89E+05 9157 6.2 53 3.3 1.66 1.97

ECP18 phenylacrylic acid decarboxylase like protein 4887557 1.90E+08 21470 6.4 87.8 2.28 -1.8 4.1

ECP19 MutS protein 8052216 2.06E+08 14222 6.1 83.8 3.5 2.42 1.44

ECP20 Uncharacterized conserved protein 75512766M 1.41E+07 19536 6.1 78.7 2.1 -1.1 2.24

ECP21 acyl-CoA thioesterase I 1786702M 1.45E+10 23622 6.9 76.4 2.47 6 -2.43

ECP22 orf, hypothetical protein 1786864M 1.20E+12 37276 5 94.2 -6.1 -5.1 -1.2

Category Spot number Protein name NCBI accession number MOWSE score MW(Da) pI Coverage(%)

Fold Changes

C vs M C vs R R vs M

Extracellular proteins

ECP1 Lipoprotein 73853215M 2.70E+14 42860 5.9 77.1 3.44 1.11 3.09

ECP2 aminopeptidase B 1799926M 2.59E+19 46181 5.6 70.7 45 -1.4 63

ECP3 unnamed protein product 10955265M 1.26 39574 5.6 25.4 2.12 2.81 -1.32

ECP4 cytolysin A 50953627M 1.10E+07 33717 5.1 62 4.93 1.44 3.43

ECP5 HsdM protein 4210349 690 36200 5.3 39.1 3.73 2.73 1.37

ECP6 detergent resistant phospholipase A 148220 4.84E+09 33171 5.2 67.8 2.88 1.3 2.25

ECP7 dihydropteroate synthase 40548828 5.35 26585 5.3 18.6 1.87 -1.25 2.33

ECP8 putative regulator 1787221M 4.50E+05 24268 5.7 21 3.33 4.58 -1.38

ECP9 MbhA 984586M 147034 23780 6.9 65.4 8.3 1.17 7.1

ECP10 cheA protein 145519 8.23E+06 23609 6.3 68.4 3.74 1.75 2.14

ECP11 Probable GTP-binding protein engB 67462332M 1.56E+09 23561 6.9 92.4 3.87 1.05 3.68

ECP12 SepD 886476M 2.66E+09 17563 7 85.4 3.96 1.65 2.4

ECP13 DNA polymerase I 18104428M 9.99E+06 13024 7 96.5 118 3.47 34

ECP14 TraM 398515M 4.73E+09 14508 5.3 98.4 -1.7 1.53 -2.6

ECP15 Uncharacterized conserved protein 75513951M 1.19E+08 12265 5.3 96.2 -3 -2.41 -1.24

ECP16 hydroxymethylbilane synthase 41186 2.69E+06 9816 6.3 78.7 2 -2.86 5.7

ECP17 Shiga toxin II subunit B 13359153M 2.89E+05 9157 6.2 53 3.3 1.66 1.97

ECP18 phenylacrylic acid decarboxylase like protein 4887557 1.90E+08 21470 6.4 87.8 2.28 -1.8 4.1

ECP19 MutS protein 8052216 2.06E+08 14222 6.1 83.8 3.5 2.42 1.44

ECP20 Uncharacterized conserved protein 75512766M 1.41E+07 19536 6.1 78.7 2.1 -1.1 2.24

ECP21 acyl-CoA thioesterase I 1786702M 1.45E+10 23622 6.9 76.4 2.47 6 -2.43

ECP22 orf, hypothetical protein 1786864M 1.20E+12 37276 5 94.2 -6.1 -5.1 -1.2

137

4. DISCUSSION

In this study results were demonstrated that positive association

between regulatory mechanism known as quorum sensing and expression

of virulence proteins in EHEC. Strain was constructed an isogenic luxS

mutant and restoration strain in wild-type EHEC, clinical isolate. Also

strains were investigated that proteins involved in virulence factors were

regulated by quorum sensing through autoinducer-2, which is synthesis

by the product of luxS gene. In an attempt to understand the role of the

luxS gene, two-dimensional gel electrophoresis to compare the expression

profiles of soluble proteins of three different EHEC strains (luxS, luxS-

and luxS+) was used.

To obtain an overview of the protein distribution, pH 3-10 IPG

strips (180 mm) were used first. The results shows that almost all proteins

isoelectric point (pI) are located between 4 and 7. A comparison of the

proteomic profiles of E. coli O157:H7 clinical isolate, isogenic luxS

mutant strain and luxS restoration strain is shown in Fig. III-4. Total of

205 spots were detected and analysis. Among the proteins identified,

there are 145 spots of cellular proteins and 60 spots of extracellular

proteins. Many previous pathogenic bacterial studies were analyzed by

proteomics for extracellular proteins such as secreted proteins (Cortest et

al., 2005; Lelong et al., 2007; Mosterts et al., 2004). The experiment was

138

performed three times with two sets of independently grown cultures. The

gels of the wild-type crude extracts were used as standards and each spot

observed on mutant extracts and restoration strain extracts were

compared to the standard. Figure III-4A show that 19 intracellular protein

spots satisfying the following intensity increased, decreased, or even

disappeared, in comparison to the among the strains. Also, 22 differential

spots of extracellular protein are given in Figure III-4B. An enlargement

of portion of the gel illustrates this result (Fig. III-5).

Analysis of the proteomes obtained for these variants revealed that

forty-one proteins were expressed by the luxS mediated quorum sensing.

The proteomic profiles of strains with intracellular 11 proteins were

involved in enzymes, regulated proteins, metabolic proteins and three

proteins were structural proteins, such as FliC and Flagellin protein. The

most interesting outcome of our study is the identification of a virulent

protein involved in EspG and hemolysin (Fig. III-5, Table III-3 and 4 ).

As a result of the three extracellullar proteins, it contains SepD, cytolysin

A (SheA) and Stx2 protein and these were known to virulence factors of

EHEC. These results indicated that several proteins regulated by luxS

gene. These results were also observed that up-regulated proteins (CP16

and ECP22) in luxS mutant strain. Most of proteins were up-regulated in

restoration strain compared to mutant and wild-type strains.

In the test comparing the proteins of RL03J and CI03J, most

139

proteins showed similar expression patterns or sometimes RL03J showed

higher expression level. As the result proves in Chapter 2, interestingly,

the difference was also noticeable in the proteins related to motility,

chemotaxis, and flagella. Among the proteins inside the cell, which

showed distinctive difference among the three strains, EspG, FliC,

Flagellin, and hemolysin showed 2.1, 4.4, 1.6, and 166 folds difference

respectively. The case of hemolysin showed as same result as these

another test results, and this could be the evidence to prove that luxS/QS

system is also involved in the hemolysin expression. In case of hemolysin,

however, unlike our expectation that it would be detected mostly from the

protein outside the cell, it was identified to be detected from the protein

inside the cell, from which it was assumed that a great deal of protein in

the condition before it was being produced outside the cell was detected.

More detailed research on hemolysin and luxS/QS is needed. In case of

identified Shiga toxin II subunit B, it showed as same result as our cell

toxin test, and the expression difference of Shiga toxin II in the toxin

creation test using RPLA also were found.

Incurrent practice, proteomics encompasses four principal

application: protein mining (Pyndiah et al., 2007), protein expression

profiling (Phillip, 2000), protein network mapping (Plebani et al., 2005)

and protein modification mapping (Sarah et al., 2006; Schauder et al.,

2005). Using proteomics technology, it was demonstrated that quorum

140

sensing regulation in EHEC is far more regulates a number of basic

physiological functions, including enzymetic metabolisms and motility.

In their research on comparing the protein expression between clinical

isolate and standard strain, Kim et al. (1999) have reported to find about

360 protein spots. Although their research was not using DNA mutation,

similar proteins arrangement was identified when comparing their test

result and ours. Recent studies have found that E. coli O157:H7 uses AI-2

to control the expression of virulence factors, type III secretion,

chemotaxis, flagellar synthesis and motility (Kaper et al., 2002; Kaper et

al., 2003; Jordan et al., 2005). In addition, E. coli RP37 uses AI-2 to

control cell aggregation (Delisa et al., 2001). Several lines of evidence

suggest the existence of additional E. coli quorum-sensing signals besides

AI-2. Sperandio et al. (2001) reported that the luxS mutant grows faster

than the wild-type strains, previously studies. However, the growth rates

of both wild-type strain and mutant strain were similar under changes of

cellular proteins and extracellular proteins found in our study. While both

strains show a similar trend, restoration strain gives over-expressive

trends.

Constant patterns of motility, flagella synthesis and bacterial

metabolism were almost identical in phenotypical observations. As luxS

has only recently been discovered, there has not been sufficient time to

identify many of genes that are regulated by quorum sensing in luxS-

141

containing bacteria. A few pieces of information are currently available.

AI-2 has been reported to induce the expression of the LEE (locus of

enterocyte effacement) pathogenicity island in E. coli O157. This

pathogenicity island encodes a type III secretory apparatus that is

required for virulence. Previously, Sperandio et al. (2001) reported that

404 genes were regulated by luxS/QS at least five-fold. They confirmed

169 of these genes were down-regulated and 235 were up-regulated in the

wild-type strain compared to in the luxS mutant. Among the genes, down-

regulated genes included several in cell division. Up-regulated genes

included several involved in the expression and assembly of flagella,

motility, and chemotaxis. These results were also found that similar to

other results. Several proteins involved in expression and assembly of

flagella, as well as motility and chemotaxis, were up-regulated by

quorum sensing. The array data were able to confirm them. The luxS

mutant produces fewer flagella and motility related proteins (FliC,

flagellin and CheA) than wild-type and restoration strain (Fig. III-5,

cellular proteins). Aslo, increased expression of Stx2 and T3SS related

proteins that SepD and EspG in luxS mutant compared to that in wild-

type and restoration strain were observed (Fig. III-5, extracellular

proteins). The previous studies reported the proteins comprising the T3SS

are homologus to the flagella basal-body proteins, and since quorum

sensing regulates T3SS in EHEC, it was perhaps not too surprising that it

142

also regulates flagellar expression and motility (Sperandio et al., 2001).

In Salmonella, coupled regulation of type III secretion and flagella genes

has been described (Bassler et al., 1999; Sekiya et al., 2001; Sircili et al.,

2004).

Also, an increase in the production of hemolysin due to quorum

sensing in wild-type and restoration strain were observed. A previous

study noted that quorum sensing mechanisms have been demonstrated to

regulate production of hemolysins in Stapylococcus (Balaban and Novick,

1995). However, a Vibrio vulificus luxS mutant shows increased

hemolysin production and delayed protease production. Furthermore, the

LD50 for the V. vulificus luxS mutant is 20-fold higher than that of wild-

type V. vulificus (Roh et al., 2006).

The ability of pathogenic bacteria to cause disease in a susceptible

host is determined by multiple factors acting individually or together at

different stages of infection. Proteomics can provide an integrated view

of the gene products of certain bacteria for global analyses. Using

proteomics technology, the several proteins in EHEC strain and verified

its luxS related quorum sensing mechanisms were discovered. Combining

these studies were conclude that AI-2/AI-3 product by luxS gene may

play an important role in EHEC infection. These results do not represent

a definitive analysis of gene regulation by quorum sensing in EHEC

strain. Futher studies are neede to clarify whether this mechanism is

143

likely to be candidate protein changes of growth stages.

In summary, this 2-DE profile reveales that 41 proteins of STEC

O157:H7 were differentially regulated in the presence of luxS gene. To

the best of our knowledge, the first mutational study to show the

contribution of luxS gene products to the formation of an STEC O157:H7

quorum sensing. Significant changes in expression of the proteins had not

been reported in previous transcriptome-based studies (Sperandio et al.,

1999; Sperandio et al., 2001). This was probably due to the differences of

detection methods. In addition, due to limited techniques, these methods

were unable to observe on the regulations of high hydrophobic proteins

from membrane and extracellular proteins by luxS/QS system. Many of

the previously identified genes encode for memebrane bounded and

secreted proteins that often represent important virulence factors(Arevalo

et al., 2003; Nandakumar et al., 2005). Therefore, for novel targets of

antibacterial treatment, futher study is currently underway to determine

specific regulation on memebrane bounded and secreted STEC O157:H7

proteins controlled by luxS/QS system and compare to transcriptome-

based identification data.

In conclusion, proteomic analysis of the protein profiles of two

clones and wild-type strain, as well as the analysis of the proteomes of

these clones revealed distinct changes in the expression levels of multiple

proteins. These results support the use of proteomics to monitor and

144

investigate more understanding of functional luxS gene. Once the proteins

of interest are identified, a more precise description of the specific

mechanisms invoked in response to genetic inactivation can be developed

and optimization of the homologous recombination approach can be

pursued. These results suggest that quorum-sensing regulation in EHEC

strain, showing that quorum sensing is a global regulatory system that

controls not only proteins involved in pathogenesis but also proteins

involved in bacterial metabolism, biosynthesis, among other functions. In

this study, results were suggested that a definite understanding of the

difference between the strains by 2-DE, and the establishment of the

database through this proteome research is applicable to development of

the protein marker for diagnosis and can be used for effective protection

of a infectious disease. These results indicated that luxS/QS system was

closely involved in not only EHEC metabolism but also adjustment of the

virulence factor.

145

CONCLUSIONS

The purpose of this study was to determine epidemiological and

molecular charateristics the shiga toxin producing Escherichia coli

(STEC); enterohemorrhagic E. coli (EHEC) infection in Korean patients

with diarrhea, and to investigate the relationship between global

regulatory mechanism known as quorum sensing and expression of

virulence factors in STEC.

1. Current investigation is the first large study in Korea on the prevalence

of STEC in patients with diarrhea. These investigations show the

distribution of virulence genes and serotypes of STEC isolated from

patients in Korea.

2. In order to determine whether EHEC has a luxS-dependent QS system,

luxS in EHEC O157:H7 was knocked out.

3. The observation of the growth curves showed that CI03J and RL03J

had a similar growth pattern whether or not they had glucose. ML03J,

however, showed a remarkably reduced growth kinetics under the

condition without glucose, while it showed an almost similar growth to

146

the other two strains under the condition with glucose.

3. Genes potentially regulated by luxS/QS in other species have been

identified by constructing a luxS mutant of comparing gene expression in

the wild type and luxS mutant. Among the phenotypes and functions

affected by luxS mutations are type III secretion system (T3SS),

hemolysis phenotypes and flagellum expression in EHEC O157:H7.

4. By proteomic analysis, various proteins as known virulence factors in

EHEC were detected . Among the changed proteins, cytolysin A (2.1

folds), the pore forming toxin, identified as virulence factor, SepD (4

folds), the effector molecule, related to T3SS, and Shiga toxin II subunit

B (3 folds), the toxin were observed. Surprisingly, a dramatic increased in

expression of the pO157-encoded hemolysin in the CI03J as compared to

the luxS mutant ML03J.

In conclusion, these results suggest that useful information about the

trend of STEC infections in the general population. Molecular

characterization of STEC in this study will help prepare the data and to

understand the etiological mechanism of STEC. Global regulatory

mechanism known as quorum sensing associated EHEC pathogenesis

may influence in the development of acute disease. Quorum sensing in

147

EHEC may potentially play a direct or indirect role in the pathogenesis of

human infection.

148

REFERENCES

Adu-Bobie, J., Frankel, G., Bain, C., Goncalves, A. G., Trabulsi, L. R.,

Douce, G., Knutton, S. and Dougan, G. (1998) Detection of intimins

alpha, beta, gamma, and delta, four intimin derivatives expressed by

attaching and effacing microbial pathogens. J. Clin. Microbiol. 36, 662-

668.

Agin, T. S. and Wolf, M. K. (1997) Identification of a family of intimins

common to Escherichia coli causing attaching-effacing lesions in rabbits,

humans, and swine. Infect. Immun. 65, 320-326.

Albihn, A., Ericsson, E., Wallen, C. and Aspan, A. (2003)

Verotoxinogenic Escherichia coli (VTEC) O157:H7-A Natoinwide

Swedish Survey of Bovine Faeces. Acta vet. scand. 44, 43-52.

Almirante, B., Roudriguez, D., Park, B. J., Estrella, M. C., Planes, A. M.,

Almela, M., Mensa, J., Sanchez, F., Ayats, J., Gimenez, M., Saballs, P.,

Fridkin, S. K., Morgan, J., Tudela, J. L. R., Warnock, D. W. and Pahissa,

A. (2005) Epidermiology and Predictors of Mortality in Cases of

Canadida Bloodstream Infection: Result from Population-Based

149

Surveillance, Barcelona, Spain, from 2002 to 2003. J. Clin. Microbiol. 43,

1829-1835.

Anand, S. K. and Griffiths, M. W. (2003) Quorum sensing and expression

of virulence in Escherichia coli O157:H7. Int. J. Food Microbiol. 85, 1-9.

Andreoli, S. P., Trachtman, H., Acheson, D. W., Siegler, R. L. and Obrig,

T. G. (2002) Hemolytic uremic syndrome: epidemiology,

pathophysiology, and therapy. Pediatr. Nephrol. 17, 293-298.

Arevalo-Frerro, C., Hentzer, M., Reil, G., Gorg, A., Kielleberg, S.,

Givskov, M., Riedel, K. and Eberl, L. (2003) Identification of quorum-

sensing regulated proteins in the opportunistic pathogen Pseudomonas

aeruginosa by proteomics. Environ. Microbiol. 5, 1350-1356.

Armitage, J. P., Holland, I. B., Jenal, U. and Kenny, B. (2005) "Neural

Networks" in bacteria: Making Connections. J. Bacteriol. 187, 26-36.

Balaban, N. and Novick, R. P. (1995) Autocrine regulation of toxin

synthesis by Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 92,

1619-1623.

150

Banatvala, N., Griffin, P. M., Greene, K. D., Barrett, T. J., Bibb, W. F.,

Green, J. H. and Wells, J. G. (2001) The United States National

Prospective Hemolytic Uremic Syndrome Study: microbiologic, clinical,

and epidemiologic findings. J. Infect. Dis. 183, 1063-1070.

Barrios, A. F. G., Zuo, R., Hashimoto, Y., Yang, L, Bently, W. E. and

Wood, T. K. (2006) Autoinducer 2 controls Biofilm Formation in

Escherichia coli through a Novel Motility Quorum-Sensing Regulator

(MqsR, B3022). J. Bacteriol. 188, 305-316.

Bassler, B. L., Surette, M. G. and Miller, M. B. (1999) Quorum sensing

in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: A new

family of genes responsible for autoinducer production. Proc. Natl. Acad.

Sci. USA 96, 1639-1644

Berg, H. C. (2003) The rotary motor of bacterial flagella. Annu. Rev.

Biochem. 72, 19-54

Besser, R. E., Lett, S. M., Weber, J. T., Doyle, M. P., Barrett, T. J., Wells,

J. G. and Griffin, P. M. (1993) An outbreak of diarrhea and hemolytic

uremic syndrome from Escherichia coli O157:H7 in fresh-pressed apple

cider. JAMA 269, 2217-2220.

151

Bettelheim, K. A. (1986) Commemoration of the publication 100 years

ago of the papers by Dr. Th. Escherich in which are described for the first

time the organisms that bear his name. Zentralbl Bakteriol Mikrobiol

Hyg[A] 261, 255-265.

Beutin, L., Geier, D., Zimmermann, S. and Karch, H. (1995) Virulence

markers of Shiga-like toxin-producing Escherichia coli strains originating

from healty domestic animals of different species. J. Clin. Microbiol. 33,

631-635.

Beutin, L., Kaulfuss, S., Herold, S., Oswald, E. and Schmidt, H. (2005)

Genetix Analysis of Enteropathogenic and Enterohemorrhagic

Escherichia coli Serogroup O103 Strain by Molecular Typing of

Virulence and Housekeeping Genes and Pulsed-Field Fel Electrophoresis.

J. Clin. Microbiol. 43, 1552-1563.

Beutin, L., Krause, G., Zimmermann, S., Kaulfuss, S. and Gleier, D.

(2004) Characterization of Shiga Toxin-Producing Escherichia coli

Strains Isolated from Humans Patients in Germany over a 3-Year Period.

J. Clin. Microbiol. 42, 1099-1108.

152

Beutin, L., Zimmermann, S. and Gleier, K. (1996) Rapid detection and

isolation of shiga-like toxin(verocytotoxin)-producing Escherichia coli

by direct testing of individual enterohemolytic colonies from washed

sheep blood agar plates in the VTEC-RPLA assay. J. Clin. Microbiol. 34,

2812-2814.

Bielaszewska, M., Zhang, W., Mellmann, A. and Karch, H. (2007)

Enerohaemorrhagic Escherichia coli O26:H11/H-: a human pathogen in

emergence. Beri. Munch. Tierarztl. Wochenschr. 120, 279-287.

Blanco, J. E., Blanco, M., Blanco, J., Mora, A., Balaguer, L., Mourino,

M., Juarez, A. and Jansen, W. H. (1996) O serogroups, biotypes, and eae

genes in Escherichia coli strains isolated from diarrheic and healthy

rabbits. J. Clin. Microbiol. 34, 3101-3107.

Blanco, J. E., Blanco, M., Alonso, M. P., Mora, A., Dahbi, G., Coira, M.

A. and Blanco J. (1999) Serotypes, Virulance Genes, and Intimin Types

of Shiga Toxin(Verotoxin)-Producing Escherichia coli Isolates from

Human Patients:Prevalence in Lugo, Spain, from 1992 through 1999. J.

Clin. Microbiol. 42, 311-319.

Blattner, F. R., Plunkett, G. 3rd, and Bloch, C. A. (1997) The complete

genome sequence of Escherichia coli K-12. Science 277, 1453-1474.

153

Boerlin, P., Chen, S., Colbourne, F. K., Johnson, R., Grandis, S. and

Gyles, C. (1998) Evolution of Enterohemorrhagix Escherichia coli

Hemolysin Plasmids and the Locus for Enterocyte Effanement in Shiga

Toxin-Priducing E. coli. Infect. Immun. 66, 2553-2561.

Boerlin, P., McEwen, S. A., Boerlin-Petzold, F., Wilson, J. B., Johnson,

R. P. and Gyles, C. L. (1999) Associations between virulence factors of

Shiga toxin-producing Escherichia coli and disease in humans. J. Clin.

Microbiol. 37, 497-503.

Boerlin, P., Schmid, H., Burnens, A. P., Bille, J., Liassine, N., Friderich,

P. and Breer, C. (2002) Verocytotoxin-producing Escherichia coli in

patients with diarrhoea in Switzerland. Eur. J. Clin. Microbiol. Infect. Dis.

21, 810-813.

Bradford, M. M. (1976) A rapid and sensitive method for the quantitation

of microgram quantities of protein utilizing the principle of protein-dye

binding. Anal. Biochem. 72, 248-254.

Bult, C. J., White, O. and Olsen, G. J. (1996) Complete genome sequence

of the methanogenic archaeon, Methanococcus jannaschii. Science 273,

154

1058-1073.

Chen, X., Schauder, S., Potier, N., Dorsselaer, A. V., Pelczer, I., Bassler,

B. L. and Hughson, F. M. (2002) Structural identification of a bacterial

quorum-sensing signal containing boron. Nature 415, 545-549.

Cho, S. H., Kim, J. H., Kim, J. C., Shin, H. H., Kang, Y. H. and Lee, B. K.

(2006) Surveillance of bacterial pathogens associated with acute diarrheal

disease in the republic of Korea during one year, 2003. J. Microbiol. 44,

327-335.

Cimolai, N., Basalyga, S., Mah, D. G., Morrison, B. J. and Carter, J. E.

(1994) A continuing assessment of risk fctors for the development of

Escherichia coli O157:H7-associated hemolytic uremic syndrome. Clin.

Nephrol. 42, 85-89.

Cizek, A., Literak, I. and Scheer, P. (2000) Survival of Escherichia coli

O157 in faces of experimentally infected rats and domestic pigeons. Lett.

Appl. Microbiol. 31, 349-352.

Clarke, S. C., Haigh, R. D., Freestone, P. P. E. and Williams, P. H. (2003)

Virulence of enteropathogenic Escherichia coli, a global pathogen. Clin.

155

Microbiol. Rev. 16, 365-378.

Clinical and Laboratory Standards Instityte, (2006) CLSI document

M100-S16, Performance standards for antimicrobial susceptibility testing,

6th ed., Information supplement, CLSI, Wayne, Pa. 32-37.

Cloak, O. M., Solow, B. T., Briggs, C. E., Chen, C.Y. and Fratamico, P.

M. (2002) Quorum Sensing and Production of Autoinducer-2 in

Campylobacter spp., Escherichia coli O157:H7, and Salmonella enterica

Serovar Typhimurium in Foods. Appl. Environ. Microbiol. 68, 4666-4671.

Cobeljic, M., Dimic, B., Opacic, D., Lepsanovic, Z. and Stojanovic, V.

(2005) The prevalence of shiga toxin-producing Escherichia coli in

domestic animals and food in Serbia. Epidemiol. infect. 133, 359-366.

Cortest, J. X., Lyons, S., Chaparro, A. P., Hernandez, D. R., Saldana, Z.,

Ledesma, M. A., Rendon, M. A., Gewirtz, A. T., Klose, K. E. and Giron,

J. A. (2005) Identification of Proinflammatory Flagellin Proteins in

Supernatants of Vibrio cholerae 01 by Proteomics Analysis. Mol. Cell.

Proteomics. 5, 2374-2383.

Cravioto, A., Tello, A., Villafan, H., Ruiz, J., del Vedovo, S. and Neeser J.

156

R. (1991) Inhibition of localized adhesion of enteropathogenic

Escherichia coli to Hep-2 cells by immunoglobulin and oligosaccharide

fractions of human colostrum and breast milk. J. Infect. Dis. 163, 1247-

1255.

Crepin, V. F., Garmendia, J. and Frankel, G. (2005) Enteropathogenic

and enterohemorrhagic Escherichia coli infections: translocation,

translocation, translocation. Infect. Immun. 73, 2573-2585.

Datsenko, K. A. and Wanner, B. L. (2000) One-step inactivation of

chromosomal genes in Escherichia coli K-12 using PCR products. Proc.

Natl. Acad. Sci. USA 97, 6640-6645.

Day, W. A. and Maurelli, A. T. (2001) Shigella flexneri Quorum-sensing

System Modulates virB Expression but Is Not Essential for Virulence.

Infect. Immun. 69, 15-23.

Delancey, R. R. B., South, M. M. T., Ding, X. and Rather, P. N. (1999)

Escherichia coli genes regulated by cell-to-cell singaling. Proc. Natl.

Acad. Sci. USA 96, 4610-4614.

Delisa, M. P., Wu, C. F., Wang, L., Valdes, J. J. and Bently, W. E. (2001)

157

DNA Microarray-Based Identification of Genes Controlled by

Autoinducer 2-Stimulated Quorum Sensing in Escherichia coli. J.

Bacteriol. 183, 5239-5247.

Dell’Omo, G., Morabito, S., Quondam, R., Agrimi, U., Ciuchini, F.,

Macri, A. and Caprioli, A. (1998) Feral pigeons as a source of

verocytotoxin-producing Escherichia coli. Vet. Rec. 142, 309-310.

Donnenberg, S. M., Luther, P. W., O'connell, C. B. and Taylor, K. A.

(1998) The EspB protein of enteropathogenic Escherichia coli is targeted

to the cytoplasm of infected HeLa cells. Infect. Immun. 66, 5501-5507.

Donnenberg, S. M., Yu, J. and Kaper, J. B. (1993) A second

chromosomal gene necessary for intimate attachment of enteropathogenic

Escherichia coli to epithelial cells. J. Bacteriol. 175, 4670-4680.

Doublet, B., Douard, G., Targant, H., Meunier, D., Madec, J. Y. and

Cloeckaert, A. (2008) Antibiotic marker modifications of λ Red and FLP

helper plasmids, pkD46 and pCP20, for inactivation of chromosomal

genes using PCR product in multidrug-resistant strains. J. Microbiol.

Metho. 75, 359-361.

158

Doyle, M. P., Beuchat, L. R. and Montville, T. J. (2001)

Enterohemorrhagic Escherichia coli. In Food Microbiology:

Fundamentals and Frontiers.2nd ed. ASM Press, Washington DC.

Dundas, S., Todd, W. T., Stewart, A. I., Murdoch, P. S., Chaudhuri, A. K.

and Hutchinson, S. J. (2001) The central Scotland Escherichia coli

O157:H7 outbreak: risk factors for the hemolytic uremic syndrome and

death among hospitalized patients. Clin. Infect. Dis. 33, 923-931.

Eisen, A., Sattah, M., Gazitt, T., Neal, K., Szauter, P. and Lucchesi, J.

(1998) A novel DEAD-box RNA helicase exhibits high sequence

conservation from yeast to humans. Biochim. Biophys. Acta. 1379, 131-

136.

Eklund, M., Scheutz, F. and Siitonen, A. (2001) Clinical Isolates of Non-

O157 Shiga toxin-producing Escherichia coli: Serotypes, virulence

characteristics, and Molecular profiles of strains of the same serotype. J.

Clin. Microbiol. 39, 2829-2834.

Elliot, S., Hutcheson, S. W., Dubois, M. S., Mellies, J. L., Wainwright, L.

A., Batchelor, M., Frankel, G., Knutton, S. and Kaper, J. B. (1999)

Identification of CesT, a chaperone for the type III secretion of Tir in

159

enteropathogenic Escherichia coli. Mol. Microbiol. 33, 1176-1189.

Elliot, S., Wainwright, L. A., McDaniel, T. K., MacNamara, B.,

Donnenberg, M. and Kaper, J. B. (1998) The complete sequence of the

locus of enterocyte effacement (LEE) from enteropathogenic Escherichia

coli E234/69. Mol. Microbiol. 28, 1-4.

Espie, E., Grimont, F., Kurkdjian, P. M., Bouvet, P., Haeghebert, S.,

Filliol, I., Lirat, C., Decludt, B., Minh, N. N. T., Vaillant, V. and Valk, H.

(2008) Surveillance of Hemolytic Uremic Syndrome in Children Less

Than 15 years of Age, a System to Monitor O157 and Non-O157 Shiga

Toxin-Producing Escherichia coli Infections in France, 1996-2006.

Pediatr. Infect. Dis. J. 27, 595-601.

Evans, J., Wilson, A., Willshaw, G. A., Cheasty, T., Tompkins, D. S.,

Wheeler, J. G. and Smith, H. R. (2002) Vero cytotoxin-producing

Eschrichia coli in a study of infectious intestinal disease in England. Clin.

Microbiol. Infect. 8, 183-186.

Federle, M. J. and Bassler, B. L. (2003) Interspecies communication in

bacteria. J. Clin. Invest. 112, 1291-1299.

160

Fleischmann, R. D., Adams, M. D. and White, O. (1995) Whole-genome

random sequencing and assembly of Haemophilus influenzae Rd. Science

269, 496-512.

Fraser, C. M., Gocayne, J. D. and White, O. (1995) The minimal gene

complement of Mycoplasma genitalium. Science 270, 397-403.

Friedrich, A.W., Borell, J., Bielaszewska, M., Fruth, A., Tschape, H. and

Karch, H. (2003) Shiga Toxin 1c-Producing Escherichia coli Strains:

Phenotypic and Genetic Characterization and Association with Human

Disease. J. Clinical Microbiol. 41, 2448-2453.

Fuchs, R. P., Fujii, S. and Wagner, J. (2004) Properties and functions of

Escherichia coli: Pol IV and Pol V. Adv. Protein Chem. 69, 229-264.

Fuqua, C. and Greenberg, E. P. (1998) Cell-to-cell communication in

Escherichia coli and Salmonella typhimurium: They may be talking, but

who's listening ? Proc. Natl. Acad. Sci. USA 95, 6571-6572.

Galane, P. M. and Roux, M. (2001) Molecular Epidemiology of

Escherichia coli Isolated from Young south African Chidren with

Diarrheal Disease. J. Health Popul. Nutr. 19, 31-38.

161

Gally, D. L., Hoey, D. E. E. and Roe, A. J. (2003) Regulation,secretion

and activity of type III-secreted proteins of enterohaemorrhagic

Escherichia coli O157. Biochem. Soci. Trans. 31, 98-103.

Gannon, V. P. and Gyles, C. L. (1990) Characteristics of the Shiga-like

toxin produced by Escherichia coli associated with porcine edema

disease. Vet. Microbiol. 24, 89-100.

Giron, J. A., Torres, A. G., Freer, E. and Kaper, J. B. (2002) The flagella

of enteropathogenic Escherichia coli mediate adherence to epithelial cells.

Mol. Microbiol. 44, 361-379.

Gonzalez, J. E. and Keshavan, N. D. (2006) Messing with Bacterial

Quorum Sensing. Microbiol. Mol. Biol. Rev. 70, 859-875.

Grandi, G. (2001) Antibacterial vaccine design using genomics and

proteomics. Trends Biotechnol. 19, 181-188.

Griffin, P. M. and Tauxe, R. V. (1991) The epidemiology of infectious

caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli,

and the associated hemolytic uremic syndrome. Epidemiol. Rev. 13, 60-

98.

162

Griffiths, M. W. and Anand, S. K. (2003) Quorum sensing and expression

of virulence in Escherichia coli O157:H7. Int. J. Food Microbiol. 85, 1-9.

Guinee, P. A. M., Agterberg, C. M. and Jansen, W. H. (1972) Escherichia

coli O antigen typing by means of a mechanized microtechnique. Appl.

Microbiol. 24, 127-131.

Han, M. J. and Lee, S. Y. (2006) The Escherichia coli Proteome: Past,

Present, and Future Prospects. Microbiol. Mol. Biol. Rev. 70, 362-439.

Hancock, D. D., Besser, T. E., Kinsel, M. L., Tarr, P. I., Rice, D. H. and

Paros, M.G. (1994) The prevalence of Escherichia coli O157:H7 in dairy

and beef cattle in Washington State, Epidemiol. Infect. 113, 199-207.

Hardie, K. R., Cooksley, C., Green, A. D. and Winzer, K. (2003)

Autoinducer 2 activity in Escherichia coli culture supernatants can be

activity reduced despite maintenance of an active synthase, LuxS.

Microbiol.149, 715-728.

Henke, J. M. and Bassler, B. L. (2004) Quorum Sensing Regulates Type

III Secretion in Vibrio harveyi and Vibrio parahaemolyticus, J. Bacteriol.

163

186, 379-3805.

Hensel, M. and Schmidt, H. (2004) Pathogenicity islands in bacterial

pathogenesis. Clin. Microbiol. Rev. 17, 14-56.

Holden, M. T. G., Winzer, K., Hardie, K. R., Burgess, N., Doherty, N.,

Kirke, D., Linforth, R., Cornell, K. A., Taylor, A. J. and Hill, P. J. (2002)

LuxS:its role in central metabolism and the in vitro synthesis of 4-

hydroxy-5-methyl-3(2H)-furanone. Microbiol. 148, 909-922.

Iglewski, B. H. and Kievit, T. R. (2000) Bacterial quorum sensing in

pathogenic relationships. Infect. Immun. 68, 4839-4849.

Islam, M. A., Heuvelink, A. E., Boer, E., Sturm, P. D., Beumer, R. R.,

Zwietering, M. H., Faruque, A. S. G., Haque, R., Sack, D. A. and

Talukder, K. A. (2007) Shiga toxin-producing Escherichia coli isolated

from patients with diarrhea in Bangladesh. J. Med. Microbiol. 56, 380-

385.

James, D., Shao, H., Lammont, R. J. and Demuth, D. R. (2006) The

Actinobacillus actinomycentemcomitans Ribose Binding Protein RbsB

interacts with Cognate and Heterologous Autoinducer 2 Signals. Infect.

164

Immun. 74, 4021-4029.

Jarvis, K. G., Giron, J. A., Jerse, A. E., McDaniel, T. K., Donnenberg, M.

S. and Kaper, J. B. (1995) Enteropathogenic Escherichia coli contains a

specialized secretion system necessary for the export of proteins involved

in attaching and effacing lesion formation. Proc. Natl. Acad. Sci. USA 92,

7996-8000.

Jenkins, C. and Chart, H. (1999) Serodiagnosis of infection with

verocytotoxin-producing Escherichia coli.. J. Appl. Microbiol. 86, 569-

575.

Jerse, A. E. and Kaper, J. B. (1991) The eae gene of enteropathogenic

Escherichia coli encodes a 94-kilodalton membrane protein, the

expression of which is influenced by the EFA plasmid. Infect. Immun. 59,

4302-4309.

Jordan, D. M., Sperandio, V., Kaper, J. B., Nystrome, E. A. D. and Moon,

H. W. (2005) Colonization of Gnotobiotic Piglets by a luxS Mutant Strain

of Escherichia coli O157:H7. Infect. Immun. 73, 1214-1216.

Jones, M. B. and Blaser, M. J. (2003) Detection of a luxS-singnaling

165

Molecule in Bacillus anthracis. Infect. Immun. 71, 3914-3919.

Kaper, J. B. (1998) Enterohemorrhagic Escherichia coli. Curr. Opin.

Microbiol. 1, 103-108.

Kaper, J. B., Nataro, J. P. and Mobley, H. L. (2004) Pathogenic

Escherichia coli. Nat. Rev. Microbiol. 2, 123-140.

Kaper, J. B. and Sperandio, V. (2005) Bacterial Cell-to-cell singnaling in

the Gastrointestinal Track. Infect Immun. 73, 3197-3209.

Kaper, J. B., Sperandio, V., Torres, A. G., Nataro, J. P. and Jarvis, B.

(2003) Bacteria-host communication: The language of hormones. Proc.

Natl. Acad. Sci. USA 100, 8951-8956.

Kaper, J. B., Torres, A. G. and Sperandio, V. (2002) Quorum sensing

Escherichia coli regulators B and C(QseBC): a novel two-component

regulatory system involved in the regulation of flagella and motility by

quorum sensing in E. coli. Mol. Microbiol. 43, 809-821.

Karch, H., Tarr, P. I. and Bielaszewska, M. (2005) Enterohaemorrhagic

Escherichia coli in human medicine. Int. J. Med. Microbiol. 295, 405-418.

166

Karmail, M. A., Steele, B. T., Petric, M. and Lim, C. (1983) Sporadic

cases of hemolytic uremic syndrome associated with fecal cytotoxin and

cytotoxin producing Escherichia coli. Lancet I, 619-629

Karmali, M. A. (1989) Infections by verocytotoxin-producing

Escherichia coli. Clin. Microbiol. Rev. 2, 15-38.

Kawano, K., Okada, M., Haga, T., Maeda, K. and Goto, Y. (2008)

Relationship between pathogenicity for humans and stx genotype in

Shiga toxin-producing Escherichia coli serotype O157. Eur. J. Clin.

Microbiol. Infect. Dis. 27, 227-232.

Keersmaecker, S. C. J., Sonck, K., Sonnct, K. and Vanderleyden, J.

(2006) Let LuxS speak up in AI-2 signaling. Trends Microbiol. 10, 1-6.

Kendall, M. M., Rasko, D. A. and Sperandio, V. (2007) Global Effects of

the Cell-to-cell Signaling Molecules Autoinducer-2, Autoinducer-3, and

Epinephrine in a LuxS Mutant of Enterohemorrhagic Escherichia coli.

Infect. Immun.75, 4875-4884.

Kenny, B., Lai, L., Finlay, B. B. and Donnenberg, M. S. (1996) EspA, a

protein secreted by enteropathogenic Escherichia coli (EPEC) is required

167

to induce signals in epithelial cells. Mol. Microbiol. 20, 313-324.

Kenny, B., DeVinney, R., Stein, M., Reinscheid, D. J., Frey, E. A. and

Finlay, B. B. (1997) Enteropathogenic E. coli (EPEC) transfers its

receptor for intimate adherence into mammalian cells. Cell 91, 511-520.

Kerenyi, M., Allison, H. E., Batai, I., Sonnevend, A., Emody, L.,

Plaveczky, N. and Pal, T. (2005) Occurrence of hlyA and sheA genes in

extraintestinal Escherichia coli strains. J. Clin. Microbiol. 43, 2965-2968.

Kievit, T. R., and Iglewski, B. H. (2000) Bacterial Quorum Sensing in

Pathogenic Relationships. Infect. Immun. 68, 4839-4849.

Kim, K. H., Suh, I. S., Kim, J. M., Kim, C. W. and Cho, Y. J. (1989)

Etiology of Childhood Diarrhea in Korea. J. Clin. Microbiol. 27, 1192-

1196.

Kim, S. Y., Lee, S. E., Kim, Y. R., Kim, C. M., Rye, P. Y., Choy, H. E.,

Chung, S. S. and Rhee, J. H. (2003) Regulation of Vibrio vulnificus

virulence by the LuxS quorum-sensing system. Mol. Microbiol. 48, 1647-

1664.

168

Kim, Y. B., Okuda, J., Matsumoto, C., Morigaki, T., Asai, N., Watanabe,

H. and Nishibuchi, M. (1998) Isolation of an Escherichia coli O157:H7

strain producing Shiga toxin 1 but not Shiga toxin 2 from a patient with

hemolytic uremic syndrome in Korea. FEMS Microbiol. Lett. 166, 43-48.

Kim, Y. H., Han, K. Y., Lee, K. B. and Lee, J. W. (2005) Proteome

response of Escherichia coli fed-batch culture to temperature downshift.

Appl. Microbiol. Biotechnol. 68, 786-793.

Kimmitt, P. T., Harwood, C. R. and Barer, M. R. (2000) Toxin gene

expression by shiga toxin-producing Escherichia coli: the role of

antibiotics and the bacterial SOS response. Emerg. Infect. Dis. 6, 458-465.

Knutton, S., Rosenshine, I., Pallen, M. J., Nisan, I., Neves, B. C., Bain, C.,

Wolf, C., Dougan, G. and Frankel, G. (1998) A novel EspA-associated

surface organelle of enteropathogenic Escherichia coli involved in

protein translocation into epithelial cells. EMBO J. 17, 2166-2176.

Kojima, S. and Blair, D. F. (2004) The bacterial flagellar motor: structure

and function of a complex molecular machine. Int. Rev. Cytol. 233, 93-

134.

169

Krumperman, P. H. (1983) Mutiple antibiotics resistance indexing of

Escherichia coli to identify high-risk source of fecal contamination of

foods. Appl. Eviron. Microbiol. 46, 165-170.

Kudva, I. T., Hatfield, P. G. and Hovde, C. J. (1996) Escherichia coli

O157 in microbial flora of sheep. J. Clin. Microbiol. 34, 431-433.

Laemmli, U. K. (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227, 680-685.

Lai, L. C., Wainwright, L. A., Stone, K. D. and Donnenberg, M. S.

(1997) A third secreted protein that is encoded by the enteropathogenic

Escherichia coli pathogenicity island is required for transduction of

signals and for attaching and effacing activities in host cells. Infect.

Immun. 65, 2211-2217.

Lelong, C., Rolland, M., Louwagie, M., Garin, J. and Geiselmann, J.

(2007) Mutual Regulation of Crl and Fur in Escherichia coli W3110.

Mol. Cell. Proteomics. 6, 660-668.

Leotta, G., Miliwebsky, E., Chinen, I., Espinosa, E., Azzopardi, K.,

Tennant, S., Browne, R. R. and Rovas, M. (2008) Characterisation of

170

Shiga toxin-producing Escherichia coli O157 strains isolated from

humans in Argentina, Australia and NewZealand. BMC Microbiol. 8, 1-8.

Leung, P. H., Peris, J. S., Robins-Browne, R. M., Bettelheim, K. A. and

Yam, W. C. (2003) A newly discovered verotoxin variant, VT2g,

produced by bovine verocytotoxigenic Escherichia coli. Appl. Environ.

Microbiol. 69, 7549-7553.

Li, J., Hashimoto, Y., Tsao, C. Y., Wood, T. K., Valdes, J. J. and Zafiriou,

E. (2006) A Stochastic model of Escherichia coli AI-2 quorum singal

circuit reveals alternative systhesis pathways. Mol. Sys. Biol. 2, 1-16.

Liu, X., N. G. C. and Ferenci, T. (2000) Global Adaptations Resulting

from High Population Densities in Escherichia coli Cultures. J. Bacteriol.

182, 4158-4164.

Lombardia, E., Rovetto, A. J., Arabolaza, A. L. and Grau, R. R. (2006) A

LuxS-Dependent Cell-to-Cell Language Regulates Social Behavior and

Development in Bacillus subtilis. J. Bacteriol. 188, 4442-4452.

Lupp, C. and Ruby, E., G. (2004) Vibrio fischri LuxS and AinS:

Comparative Study of Two Signal Synthases. J. Bacteriol. 186, 3873-

171

3881.

Lux, R. and Shi, W. (2004) Chemotaxis-guided Movement in Bacteria.

Crit Rev. Oral Biol. Med. 15, 207-220.

Lu, Y., Iyoda, S., Satou, H., Itoh, K., Saitoh, T. and Watanabe, H. (2006)

A New Immunoglobulin-Binding Protein, EibG, Is Responsible for the

Chain-Like Adhesion Phenotype of Locus of Enterocyte Effacement-

Negative, Shiga Toxin-Producing Escherichia coli. Infect. Immun. 74,

5747-5755.

Lyte, M., Arulanandan, B., Nguyen, K., Frank, C., Erickson, A. and

Francis, D. (1997) Norepinephrine induced growth and expresion of

virulence associated factors in enterotoxigenic and enterohemorrhagic

strains of Escherichia coli. Adv. Exp. Med. Biol. 412, 331-339.

Lyte, M., Frank, C. D. and Green, B. T. (1996) Production of an

autoinducer of growth by norepinephrine cultured Escherichia coli

O157:H7. FEMS Microbiol. Lett. 139, 155-159.

Macnab, R. M. (1999) The bacterial flagellum: reversible rotary propellor

and type III export apparatus. J. Bacteriol. 181, 7149-7153.

172

Macnab, R. M. (2003) How bacteria assemble flagella. Annu. Rev.

Microbiol. 57, 77-100.

Manning, S. D., Motiwala, A. S., Springman, A. C., Qi, W., Lacher, D.

W., Quellette, L. M., Mladonicky, J. M., Somsel, P., Rudrinl, J. T.,

Dietrich, S. E., Zhang, W., Swaminathan, B., Alland, D. and Whittam, T.

S. (2008) Variation in virulence among clades of Escherichia coli

O157:H7 associated with disease outbreaks. Proc. Natl. Acad. Sci. USA

105, 4868-4873.

McDaniel, T. K., Jarvis, K. G., Donnenberg, M. S. and Kaper, J. B.

(1995) A genetic locus of enterocyte effacement conserved among

diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92, 1664-

1668.

Medellin, M. J., Wang, H., Johnson, R., Anand, S. and Griffiths, M.

(2007) Probiotics Affects Virulence-Related Gene Expression in

Escherichia coli O157:H7. Appl. Environ. Microbiol. 73, 4259-4267.

Mellies, J. L., Elliot, S. J., Sperandio, V., Donnenberg, M. S. and Kaper, J.

B. (1999) The Per regulon of enteropathogenic Escherichia coli :

identification of regulatory cascade and a novel transcriptional activator,

173

the locus of enterocyte effacement (LEE) encoded regulator (Ler). Mol.

Microbiol. 33, 1176-1189.

Melton, C. A., Darnell, S. C. and O’Brien, A. D. (1996) Activation of

Shiga-like toxins by mouse and human intestinal mucus correlates with

virulence of enterohemorrhagic Escherichia coli O91:H21 isolates in

orally infected, streptomycin-treated mice. Infect. Immun. 64, 1569-1576.

Merritt, J., Kreth, J., Shi, W. and Qi, F. (2005) LuxS controls bacteriocin

production in Streptococcus mutans through a novel regulatory

component. Mol. Microbiol. 57, 960-969.

Miller, M. B. and Bassler, B. L. (2001) Quorum Sensing in Bacteria.

Annu. Rev. Microbiol. 55, 168-199.

Miyake, M., Hanajima, M., Matsuzawa, T., Kobayashi, C., Minami, M.,

Abe, A. and Horiguchi, Y. (2005) Binding of intimin with Tir on

bacterial surface is prerquisite for the barrier disruption induced by

enterophathogenic Escherichia coli. Biochem. Biophy. Res. Commun. 337,

922-927.

Mok, K. C., Wingreen, N. S. and Bassler, B. L. (2003) Vibrio harveyi

174

quorum sensing: a coincidence detector for two autoinducers controls

gene expression. EMBO J. 22, 870-881.

Mora, A., Blanco, M., Blanco, J. E., Dahbi, G., Lopez, C., Justel, P.,

Alonso, M. P., Echeita, A., Bernardez, M. I., Gonzalez, E. and Blanco, J.

(2007) Serotypes, virulence genes and intimin types of Shiga

toxin(verocytotoxin)-producing Escherichia coli isolates from minced

beef in Lugo (Spain) from 1995 through 2003. BMC Microbiol. 7, 1-9.

Morabito, S., Tozzoli, R., Oswald, E. and Caprioli, A. (2003) A Mosaic

Pathogenicity Island of Escherichia coli O157:H7 Is Frequently Presentin

Attaching and Effacing E. coli. Infect. Immun. 71, 3343-3348.

Mosterts, J., Scharf, C., Hecker, M. and Homuth, G. (2004)

Transcriptome and proteome analysis of Bacillus subtilis gene expression

in respones to superoxide and peroxide stress. Microbiol. 150, 497-512.

Nandakumar, R., Nandakumar, M. P., Marten, M. R. and Ross, J. M.

(2005) Proteome analysis of membrane and cell wall associated proteins

from Staphylococcus aureus. J. Proteome. Res. 4, 250-257.

Nataro, J. P. and Kaper, J. B. (1998) Diarrheagenic Escherichia coli. Clin.

175

Microbiol. Rev. 11, 142-201.

Nataro, J. P., Cohen, P. S. and Mobley, H. L. T.( 2005) Colonization of

mucosal surfaces. ASM Press 195-196.

Nealson, K. H., Platt, T. and Hastings, W. (1970) Cellular Control of the

Synthesis and Activity of the Bacterial Luminescent System. J. Bacteriol.

104, 313-322.

Nicholls, L., Grant, T. H. and Robins-Browne, R. M. (2000)

Identification of a novel genetic locus that is required for in vitro

adhesion of a clinical isolate of enterohaemorrhagic Escherichia coli to

epithelial cells. Mol. Microbiol. 35, 275-288.

O’brien, A. D. and Holmes, R. K. (1987) Shiga and Shiga-like toxins.

Microbiol. Rev. 51, 206-220.

O'brien, A. D., Scott, M. E. and Melton, C. M. R. (2003) Mutations in

hns reduce the adherence of shiga toxin-producing E. coli O91:H21 strain

B2F1 to human colonic epithelial cells and increase the production of

hemolysin. Microbial Pathog. 34, 155-159.

176

O’brien, A. D., Tesh, V. L., Donohue, R. A., Jackson, M. P., Olsnes, S.,

Sandvig, K., Lindberg, A. A. and Keusch, G. T. (1992) Shiga toxin:

biochemistry, genetics, mode of action, and role in pathogenesis. Curr.

Top. Microbiol. Immunol. 180, 65-94.

Ogino, T., Ohno, R., Sekiya, K., Kuwae, A., Matsuzawa, T., Nonaka, T.,

Fukuda, H., Imajoh-Ohmi, S. and Abe, A. (2006) Assembly of the type

III secretion apparatus of enteropathogenic Escherichia coli. J. Bacteriol.

188, 2801-2811.

O’Loughlin, E. V. and Robins-Browne, R. M. (2001) Effect of Shiga

toxin and Shiga-like toxins on eukaryotic cells. Microb. Infect. 3, 493-

507.

Olsson, C. W., Badefors, M., Cheasty, T., Kjellin, E. and Kaijser, B.

(2002) Genetic Profiling of Enterohemorrhagic Escherichia coli Strains

in Relation to Clonalty and Clonical Signs of Infection. J. Clin. Microbiol.

40, 959-964.

Paine, K. and Flower, D. R. (2002) Bacterial bioinformatics;

pathogenesis and the genome. J. Mol. Microbiol. Biotechnol. 4, 357-365.

177

Parsek, M. R. and Greenberg, E. P. (2005) Sociomicrobiology: the

connections between quorum sensing and biofilms. Trends Microbiol. 13,

27-33.

Paton, A.W., Srimanote, P., Woodrow, M. C. and Paton, J. C. (2001)

Characterization of Saa, a Novel Autoagglutinating Adhesin Produced by

Locus of Enterocyte Effacement-Negative Shiga-Toxigenic Escherichia

coli Strains That Are Virulent for Humans. Infect. Immun. 69, 6999-7009.

Paton, J. C. and Paton, A. W. (1998) Pathogenesis and Diagnosis of shiga

toxin-producing Escherichia coli infections. Clin. Microbiol. Rev. 11,

450-479.

Perna, N. T., Mayhew, G. F., Posfai, G., Elliot, S. J., Donnenberg, M. S.,

Kaper, J. B. and Blattner, F. R. (1998) Molecular evolution of a

pathogenicity island from enterohaemorrhagic Escherichia coli O157:H7.

Infect. Immun. 66, 3810-3817.

Phillip, C. (2000) Proteomics in medical microbiology. Electrophoresis

21, 1187-1201.

Pierard, D., Muyldermans, G., Moriau, L., Stevens, D. and Lauwers, S.

178

(1998) Identification of new verocytotoxin type 2 variant B-subunit genes

in human and animal Escherichia coli isolates. J. Clin. Microbiol. 36,

3317-3322.

Plebani, M. (2005) Proteomics: The next revolution in laboratory

medicine? Clin. Chem. Acta. 357, 113-122.

Pradel, N., Livrelli, V., Champ, C. C., Palcoux, J. B., Reynaud, A.,

Scheutz, F., Sirot, J., Joly, B. and Forestier, C. (2000) Prevalence and

Characterization of Shiga Toxin-Producing Escherichia coli Isolated

from Cattle, Food and Children during a one-year Prostective Study in

France. J. Clin. Microbiol. 38, 1023-1031.

Pyndiah, S., Lasserre, J. P., Menard, A., Clacerol, S., Mauleon, V. P.,

Megraud, F., Zerbib, F. and Bonneu, M. (2007) Two-dimensional Blue

Native/SDS Gel Electrophoresis of Multiprotein Complexes from

Helicobacter pylori. Mol. Cell. Proteomics. 6, 193-206.

Qin, N., Callahan, S. M., Dunlap, P. V. and Stevens, A. M. (2007)

Analysis of LuxR Regulon Gene Expression during Quorum Sensing in

Vibrio fischeri. J. Bacteriol. 189, 417-4134.

179

Reid, S. D., Betting, D. J. and Whittam, T. S. (1999) Molecular detection

and identification of intimin alleles in pathogenic Escherichia coli by

multiplex PCR. J. Clin. Microbiol. 37, 2719-2722.

Ren, D., Bedzyk, L. A., Ye, R. W., Thomas, S. M. and Wood, T. K.

(2004) Stationary-Phase Quorum-Sensing Signals Affect Autoinducer-2

and Gene Expression in Escherichia coli. Appl. Environ. Microbiol. 70,

2038-2043.

Roh, J. B., Lee, M. A., Lee, H. J., Kim, S. M., Cho, Y., Kim, Y. J., Seok,

Y. J., Park ,S. J. and Lee, K. H. (2006) Transcriptional Regulatory

Cascade for Elastase Production in Vibrio vulnificus. J. Biol. Chem.281,

34775-34784.

Sandvig, K. and van Deurs, B. (2002) Transport of protein toxins into

cells: pathways used by ricin, cholera toxin and Shiga toxin. FEBS Lett.

529, 49-53.

Sarah, J., Coulthurst, K., Lilley, S., George, P. and Salmond, C. (2006)

Genetic and proteomic analysis of the role of luxs in the enteric

phytopathogen, Erwina arotovora. Mol. Plant Pathol. 7, 31-45.

180

Scaletsky, I. C. A., Michalski, J., Torres, A. G., Dulguer, M. V. and

Kaper, J. B. (2005) Identification and Characterization of the Locus for

Diffuse Adherence, Which Encodes a Novel Afimbrial Adhesin Found in

Atypical Endteropathogenic Escherichia coli. Infect. Immun. 73, 4753-

4765.

Schauder, S. and Bassler, B. L. (2001) The languages of bacteria. Gen.

develop. 15, 1468-1480.

Schauder, S., Shokat, K., Surette, M. G. and Bassler, B. L. (2001) The

LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-

sensing singal molecule. Mol. Microbiol. 41, 463-476.

Schauder, S., Penna, L., Ritton, A., Manin, C., Parker, F. and Mongenie,

G. R. (2005) Proteomics Analysis by Two-Dimensional Differential Gel

Electrophoresis Reveals the Lack of a Board Response of Neisseria

meningitidis to In Vitro-Produced AI-2. J. Bacteriol. 187:392-395.

Schmidt, H. (2001) Shiga toxin-coverting bacteriophages. Res. Microbiol.

152, 687-695.

Schmidt, H., Beutin, L., Kaulfuss, S., Herold, S. and Oswald, E. (2005)

181

Genetic analysis of enteropathogenic and enterohemorrrrhagic

Escherichia coli serogroup O103 strains by molecular typing of virulence

and housekeeping genes and pulsed-field gel eletrophoresis. J. Clin.

Microbiol. 43, 1552-1563.

Schmidt, H. and Hensel, M. (2004) Pathogenicity islands in bacterial

pathogenesis. Clin. Microbiol. Rev. 17, 14-56.

Schmidt, H., Scheef, J., Morabito, S., Caprioli, A., Wieler, L. and Karch,

H. (2000) A new Shiga toxin 2 variant (Stx2f) from Escherichia coli

isolated from pigeons. Appl. Environ. Microbiol. 66, 1205-1208.

Schmidt, H., Zhang, W. L., Hemmrich, U., Jelacic, S., Brunder, W., Tarr,

P. I., Dobrindt, U. and Hacker, J. (2001) Identification and

characterization of a novel genomic island integrated at selC in locus of

enterocyte effacement-nagative, shiga toxin-producing Escherichia coli.

Infect. Immun. 69, 6863-6873.

Sekiya, K., Ohishi, M., Ogino, T., Tamano, K., Sasakawa, K. and Abe, A.

(2001) Supermolecular structure of the enteropathogenic Escherichia coli

type III secretion system and its direct interaction with the EspA-sheath-

like structure. Proc. Natl. Acad. Sci. USA 98, 11638-11643.

182

Sircili, M. P., Walters, M., Trabulsi, L. R. and Sperandio, V. (2004)

Mdulation of Enteropathogenic Escherichia coli Virulence by Quorum

Sensing. Infect. Immun. 72, 2329-2337.

Soni, K., Jesudhasan, P., Cepeda, M., Willians, B., Hume, M., Russel, W.

K., Jayaraman, A. and Pillai, S. D. (2007) Proteomic Analysis to Identity

the Role of Luxs/AI-2 Mediated Protein Expression in Escherichia coli

O157:H7. Food. Pathog. Dis. 4, 463-471.

Sperandio, V., Li, C. C. and Kaper, J. B. (2002) Quorum-Sensing

Eschrichia coli Regulator A: a Regulator of the LysR Familly involved in

the Regulationof the Locus of Enterocyte Effacement Pathogenicity

Island in Enterohemorrhagic E. coli. Infect. Immun.70, 3085-3093.

Sperandio, V., Mellies, J. L., Nguyen, W., Shin, S. and Kaper, J. B.

(1999) Quorum sensing controls expression of the type III secretion gene

transcription and protein secretion in enterohemorrhagic and

enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci.USA 96, 15196-

15201.

Sperandio, V., Sircili, M. P., Walters, M. and Trabulsi, L. R. (2004)

Modulation of enteropathogenic Escherichia coli virulence by quorum

183

sensing. Infect. Immun. 72, 2329-2337.

Sperandio, V., Torres, A. G., Jarvis, B., Nataro, J. P. and Kaper, J. B.

(2003) Bacteria-host communication: The language of hormones. Proc.

Natl. Acad. Sci.USA 100, 8951-8956.

Sperandio, V., Torres, A. G. and Kaper, J. B. (2002) Quorum sensing

Escherichia coli regulators B and C(QseBC):a novel two-component

regulatory system involved in the regulation of flagella and motility by

quorum sensing in E. coli. Mol. Microbiol. 43, 809-821.

Sperandio, V., Torress, A. G., Giron, J. A. and Kaper, J. B. (2001)

Quorum Sensing Is a Global Regulatory Mechanism in

Enterohemorrhagic Escherichia coli O157:H7. J. Bacteriol. 38, 5187-

5197.

Stevenson, B. and Babb, K. (2002) LuxS-mediated quorum sensing in

Borrelia burgdorferi, the lyme disease spirochete. Infect. Immun. 70,

4099-4105.

Stevens, M. P., Roe, A. J., Vlisidou, I., Diemen, P. M., Ragione, R. M.,

Best, A., Woodward, M. J., Gally, D. L. and Wallis, T. S. (2004)

184

Mutation of ToxB and a Truncated version of the efa-1 Gene in

Escherichia coli O157:H7 Influences the Expression and Secretion of

Enterocyte Effacement-Encoded Proteins but not Intestinal Colonization

in Calves or Sheep. Infect. Immun. 72, 5402-5411.

Sun, J., Daniel, R., Doble, I. W. and Zeng, A. P. (2004) Is autoinducer-2

a universal signal for interspecies communication: a comparative

genomic and phylogenetic analysis of the synthesis and signal

transduction pathways. BMC Evol. Biol. 4, 1-11.

Surette, M. G., Miller, M. B. and Bassler, B. L. (1999) Quorum sensing

in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: A new

familly of genes responsible for autoinducer production. Proc. Natl. Acad.

Sci.USA 96, 1639-1644.

Sztajer, H., Lemme, A., Volchez, R., Schulz, S., Geffers, R., Yip, C. Y.

Y., Lecesque, C. M., Cvitkovitch, D. G. and Dobler, I. R. (2008)

Autoinduer-2-Regulated Genes in Streptococcus mutans UA159 and

Global Metabolic Effect of the luxS Mutation. J. Bacteriol. 190, 401-415.

Taneike, I., Zhang, H. M., Wakisaka-Saito, N. and Yamamoto, T. (2002)

Enterohemolysin operon of Shiga toxin-producing Escherichia coli: a

185

virulence fuction of inflammatory cytokine production from human

monocytes. FEBS Lett. 524, 219-224.

Tarr, C. L., Large, T.M., Moeller, C.L., Lacher, D. W., Tarr, P. I.,

Acheson, D. W. and Whittam T.S. (2002) Molecular characterization of a

serotype O121:H19 clone, a distinct Shiga toxin-producing clone of

pathogenic Escherichia coli. Infect.Immun.70, 6853-6859.

Tarr, P. I., Bilge, S. S., Vary, J. C., Jelacic, S., Habeeb, R. L.,Ward, T. R.,

Baylor, M. R. and Besser, T. E. (2000) Iha: a Novel Escherichia coli

O157:H7 Adherence-Conferring Molecule Encoded on a tecently

Acquired Chromosomal Island of Conserved Structure. Infect. Immun. 68,

1400-1407.

Tarr, P. I., Gordon, C. A. and Handler, C. W. L. (2005) Shiga toxin-

producing Escherichia coli and haemolytic uraemic syndrome. Lancet.

365, 1073-1086.

Tatsuno, I., Horie, M., Abe, H., Miki, T., Makino, K., Shinagawa, H.,

Taguchi, H., Kamiya, S., Hayashi, T. and Sasakawa, C. (2001) toxB Gene

on pO157 of Enterohemorrhagic Escherichia coli O157:H7 Is Requried

for Full Epithelial Cell Adherence Phenotype. Infect. Immun. 69, 6660-

186

6669.

Tavender, T., Halliday, N. M., Hardie, K. R. and Winzer, K. (2008)

LuxS-independent formation of AI-2 from ribulose-5-phosphate. BMC

Microbiol. 10, 1-8.

Tenover, F. C., Arbeit, R. D., Goering, R. V., Mickelsen, P. A., Murray,

B. E., Persing, D. H. and Swaminathan, B. (1995) Interpreting

chromosomal DNA restriction patterns produced by pulsed-field gel

electrophoresis:criteria for bacterial strain typing. J. Clin. Microbiol. 33,

2233-2239.

Thorpe, C. M. (2004) Shiga toxin-producing Escherichia coli infection.

Clin. Infect. Dis. 38, 1298-1303.

Tomb, J. F., White, O. and Kerlavage, A. R. (1997) The complete

genome sequence of the gastric pathogen Helicobacter pylori. Nature 388,

539-547.

Turovskiy, Y. and Chikindas, M. L. (2006) Autoinducer-2 bioassay is a

qualitative, not quantitative method influenced by glucose. J. Microbiol.

Metho. 66, 497-503.

187

Turovskiy, Y., Kashtanov, D., Paskhover, B. and Chikindas, M. L. (2007)

Quorum Sensing: Fact, Fictions and Everything in Between. Adv. Appl.

Microbiol. 62, 191-234.

Torres, A. G., Juarez, R. C. V., Tutt, C. B. and Gallegos, J. G. G. (2005)

Pathodative Mutation That Mediates Adherence of Shiga Toxin-Producig

Escherichia coli O111, Infect. Immun., 73, 4766-4776.

Tozzoli, R., Caprioli, A. and Morabito, S. (2005) Detection of toxB, a

Plasmid Virulence Gene of Escherichia coli O157, in Enterohemorrhagic

and Enteropathogenic E. col., J. Clinical Microbiol. 43, 4052-4056.

Vaz, T. M. I., Irino, K., Kato, M. A. M. F., Dias, A. M. G., Gomes, T. A.

T., Medeiros, M. I. C., Rocha, M. M. M. and Guth, B. E. C. (2004)

Virulence Properties and Characteristics of Shiga Toxin-Producing

Escherichia coli in Sao Paulo, Brazil, from 1976 through 1999. J. Clin.

Microbiol. 42, 903-905.

Villaruz, M. L. A., Vadyvaloo, V., Sturdevant, D. E. and Otto, M. (2008)

AI-2-dependent gene regulation in Staphylococcus epidermidis. BMC

Microbiol. 10, 1-9.

188

Vogel, L., van Oorshot, E., Maas, H. M., Minderhoud, B. and Dijkshoorn,

L.(2000) Epidemiologic typing of Escherichia coli using RAPD analysis,

ribotyping and serotyping. Clin. Microbiol. Infect. 6, 82-87.

Walters, M. and Sperandio, V. (2006) Autoinducer 3 and Epinephrine

Singnaling in the Kinetics of Locus of Enterocyte Effacement Gene

Expression in Enterohemorrhagic Escherichia coli. Infect. Immun. 74,

5445-5455.

Walters, M., Sircili, M. P. and Sperandio, V. (2006) AI-3 Synthesis Is not

Dependent on luxS in Escherichia coli. J. Bacteriol.188, 5668-5681.

Wang, J. L. L., Hashimoto, Y., Tsao, C.Y., Wood, T. K., Valdes, J. J. and

Zafiriou, E. (2006) A Stochastic Model of Escherichia coli AI-2 quorum

signal circuit reveal alternative synthesis pathways. Mol. Sys. Biol., 10, 1-

16.

Wang, L., Li, J., March, J. C., Valdes, J. J. and Bently, W. E. (2005) luxS-

Dependent Gene Regulation in Escherichia coli K-12 Revealed by

Genomic Expression Profiling. J. Bacteriol. 187, 8350-8360.

Watanabe, H., Terajima, J., Izumiya, H., Wada, A. and Tamura, K.

189

(1999) Molecular analysis of enterohemorrhagic Escherichia coli isolates

in Japan and its application to epidemiological investigation. Pediatr. Int.

41, 202-208.

Westermark, M., Oscatsson, J., Mizunoe, Y., Urbonaviciene, J. and Uhlin,

B. E. (2000) Silencing and Actibation of ClyA Cytotoxin Expression in

Escherichia coli, J. Bacteriol.182, 6347-6357.

Wong, C. S., Jelacic, S., Hebeeb, R. L., Watkins, S. L. and Tarr, P. I.

(2000) The risk of the hemolytic-uremic syndrome after antibiotic

treatment of Escherichia coli O157:H7 infections. N. Engl . J. Med. 342,

1930-1936.

Xavier, K. B. and Bassler, B. L. (2003) Luxs quorum sensing: more than

numbers game, Curr.Opin. Microbiol. 6, 191-197.

Xavier, K. B. and Bassler, B. L. (2006) Interference with AI-2-Mediated

Bacterial Cell-Cell Communication. Nature 437, 750-753.

Xavier, K. B. and Bassler, B. L. (2005) Regulation of uptake and

processing of the quorum-sensing autoinducer AI-2 in Escherichia coli. J.

Bacteriol. 187, 238-248.

190

Xu, L., Vuong, C., Vadyvaloo, V., Wang, J., Yao, Y., Otto, M. and Gao,

Q. (2006) Role of the luxS Quorum-Sensing System in Biofilm Formation

and virulence of Staphylococus epidermidis. Infect. Immun. 74, 488-496.

Yang, S., Lopez, C. R. and Zechiedrich, E. L. (2006) Quorum sensing

and multidrug transporters in Escherichia coli. Proc. Natl. Acad. Sci. 103,

2386-2391.

Zavilgelsky, G. B. and Manukhov, I. V. (2001) Quorum Sensing, or How

Bacteria "Talk" to Each Other. Mol. Biol. 35, 224-232.

Zhu, C., Feng, S., Sperandio, V., Yang, Z., Thate, T. E., Kaper, J. B. and

Boedeker, E. C. (2007) The possible influence of LuxS in the in vivo

virulence of rabbit enteropathogenic Escherichia coli. Vet. Microbiol. 125,

313-322.

191

국문요약국문요약국문요약국문요약

장출혈성장출혈성장출혈성장출혈성 대장균의대장균의대장균의대장균의 특성특성특성특성 분석분석분석분석 및및및및 Global Global Global Global

Regulator SystemRegulator SystemRegulator SystemRegulator System 에에에에 의한의한의한의한

병원성병원성병원성병원성 인자인자인자인자 조절에조절에조절에조절에 관한관한관한관한 연구연구연구연구

쉬가 독소 생성 대장균(shiga toxin-producing Escherichia coli,

STEC), 또는 장출혈성 대장균(enterohemorrhagic Escherichia coli,

EHEC)은 혈액이 섞인 설사, 단순 설사, 용혈성 요독 증후군

(HUS) 등을 일으키는 위중한 병원체로 알려져 있다. STEC 감염

이 공중보건에 미치는 영향은 감염시 나타나는 전신성 질환인

용혈성 요독 증후군을 일으키고 특히, 영아와 노인에게서 급성

신부전을 유발하여, 이들을 통한 대규모의 집단 식중독 발생 위

험성이 높기 때문에 매우 중요하다.

본 연구는 우리 나라의 STEC 감염증 환자에서 분리한 STEC

223주의 유전적 특성과 표현형 특성 분석을 우선적으로 실시하

192

였다. 다음으로, 세균 세포 간의 의사소통 기작으로 알려져 있는

정족수 감지 체계(quorum sensing)가 위중한 인체 병원체로 알려

진 E. coli O157:H7 의 표현형의 변화와 병원성 요소의 조절에 미

치는 영향을 규명하고자 하였다. 본 연구에서는 국내에서 분리

한 장출혈성 대장균 O157:H7(CI03J)을 이용하여 비극성 luxS 유

전자 돌연변이 주를 제작하여 luxS 의존성 정족수 감지 체계와

장출혈성 대장균의 병원성 기작과의 상호 작용을 살펴보았다.

세포 독성 실험에서는, luxS 유전자를 결손시킨 균주가 동물 세

포와 사람의 적혈구에 대한 독성이 낮게 나타난 다는 사실을 확

인하였다. 병원성 요소들 중 세균의 동물 세포에 대한 부착능,

편모을 이용한 운동성, 주화성 인자, 그리고 type III secretion

system (T3SS) 등이 luxS 의존성 정족수 감지 체계에 의해 활성화

된다는 사실을 알 수 있었다. 또한 마이크로 어레이법과 RT-real

time PCR법을 이용한 실험에서의 결과들도 이러한 사실을 뒷받

침하고 있다.

LuxS 의존성 정족수 감지 체계에 의한 병원성 단백질 변화 양

상을 살펴보기 위하여 이차원 단백질 전기영동법(2-DE)을 실시

하였다. 총 205 단백질 점상(spot)을 검출하였으며, 그 중 세포

내 단백질 145개와 세포외 단백질 60개를 동정하고 분석하였다.

193

분석 결과, 유전자 돌연변이로 발현도의 차이가 나타난 세포내

담백질 19개와 세포 외 단백질 22개를 검출하였다. 이들 중

FliC, Flagellin, EspG와 hemolysin, SepD, Cytolysin A, 그리고 Stx2와

같은 장출혈성 대장균의 병원성 요소로 알려져 있는 단백질들이

확인되었다. 이 결과들로 볼 때, LuxS에 의해 세균의 다양한 단

백질들이 조절되고 있다는 사실을 알 수 있었다.

결론적으로, 이와 같은 결과들은 luxS 의존성 정족수 감지 체계

가 장출혈성 대장균의 병원성 유전자들과 병원성 단백질 발현

뿐 아니라, 세균의 생합성 등과 같은 여러가지 대사작용에 관여

하여 조절인자로써의 기능을 수행한다는 사실을 알 수 있었다.

핵심어: shiga toxin producing Escherichia coli (STEC),

enterohemorrhagic E. coli (EHEC), hemolytic yremic syndrome (HUS),

quorum sensing, luxS, microarray, reverse transcriptase real time

polymerase chain reaction (RT-real time PCR), two dimensional

electrophoresis( 2-DE)