Modified NK Nature

7/28/2019 Modified NK Nature

1/9

Human natural killer cell line modified with achimeric immunoglobulin T-cell receptor gene leads

to tumor growth inhibition in vivo

Thomas Schirrmann and Gabriele PecherDepartment of Internal Medicine, Medical Oncology and Hematology, AG Molecular Gene and Immunotherapy,Humboldt- University Berlin, Charite Campus Mitte, 10115 Berlin, Germany.

The gene transfer of tumor- specific chimeric immunoglobulin T - cell receptors ( cIgTCRs) combining antibody- like specificity with

the effector cell function could be an attractive tool in immunotherapy. In this study, we directed the human natural killer (NK) cell

line YT to tumor cells by gene transfer of a cIgTCR with specificity against the human carcinoembryonic antigen (CEA). The cIgTCR

was constructed of a CEA-specific humanized single-chain Fv antibody fragment fused to the IgG1 Fc domain and the CD3 chain.

YT cells were transfected with the cIgTCR gene by electroporation and cIgTCR-expressing cells were enriched by immunoaffinity

purification. cIgTCR-expressing YT cells specifically lysed CEA + colon carcinoma cell lines, which were resistant to the parental YT

cell line. The lysis was not inhibited in the presence of soluble CEA. Receptor gene modified YT cells retained their CEA- specific

cytolytic activity after -irradiation in vitroand inhibited the tumor growth in vivoafter adoptive transfer into NOD/SCID mice. This

gene- modified NK cell line available in unlimited source might be useful in clinical immunotherapy of CEA+ cancer.Cancer Gene Therapy (2002) 9, 390398 DOI: 10.1038/sj/cgt/7700453

Keywords: NK cells; tumor targeting; chimeric receptor; carcinoembryonic antigen

The failure of the immune system to generate sufficienttumor- directed immune cells in tumor patients could beovercome by the adoptive transfer of tumor- specificcytotoxic lymphocytes. An adoptive immunotherapy is de-

pendent on the availability, the specificity and the antitumor

properties of the transferred effector cells.Recently, strategies based on the genetic modification of Tcells using recombinant T-cell receptor (TCR) genes1 have

been developed. Immunoglobulin - based chimeric T- cellreceptors ( cIgTCRs ), also called T bodies,2 are from

particular interest. They consist of a single - chain Fv ( scFv )fragment derived from the variable (V) domains of the light( VL ) and heavy chain (VH ) of monoclonal antibodies(mAb) joined by a flexible peptide linker3,4 fused to asignal- transducing chain like the chain of the Fc"RIreceptor or the CD3 chain; thus, they combine thespecificity of an antibody-based MHC-unrestricted recog-nition with the T-cell function.2,5 The development ofefficient retroviral gene delivery systems for activated

primary T cells and tumor - infiltrating lymphocytes(TILs)6,7permitted the possibility to generate large numbersof virus- 8 or tumor-specific T cells.9 1 3

Another strategy could be the use of natural killer (NK)cells, which do not express individual antigen specificreceptors unlike T cells. Their cytolytic activity is regulated

by activatory and inhibitory NK cell receptors.14,15 Theusage of NK cells has been tested for adoptive immunother-apy.16,17 According to shared signal mechanisms with Tcells, NK cells could be directed to tumor cells by genetransfer with chimeric receptor genes containing the

chain.

18,19

The transfection of primary NK cells has not beendescribed but some groups introduced the interleukin- 2(IL-2) gene into human NK cell lines.20,21 Other groupsdemonstrated the CD18 gene transfer into mutant YT-1cells22 or the retroviral transduction of a chimeric chaingene into the NK3.3 clone.19

In this report, we describe the targeting of the humanNK cell line YT23 by gene transfer of a tumor - specificcIgTCR. The YT cell line comprises the advantage ofcytokine - independent growth23 and is transfectable byelectroporation.22 We constructed a cIgTCR specific forthe carcinoembryonic antigen ( CEA). CEA is expressed in anumber of tumors of epithelial origin such as colorectal,gastric and pancreatic carcinomas, lung and endometrial

adenocarcinoma, and mucious ovarian carcinoma.24

ThescFv fragment was constructed of the V regions of the CEA-specific humanized mAb BW431/26, 25,26 which has

been successfully used for radioimmunodiagnostics inpatients.27-29 The human IgG1 Fc domain served as spacerbetween the scFv fragment and the CD3 signal chain,which can be necessary for an efficient receptor func-tion.10,12,30 The Fc part also promotes the homodimerizationof the cIgTCR chains11 and their plasma membraneexpression.7 Furthermore, we examined the cytotoxic

properties of the cIgTCR gene transfected YT cell lineagainst CEA+ tumor cell lines. To discuss its use for an

Received January 29, 2002.

Address correspondence and reprint requests to: Dr Gabriele Pecher,

Humboldt- University Berlin, Charite Campus Mitte, AG Molecular

Gene and Immunotherapy, Hessische Strase 3 4, 10115 Berlin,

Germany. E - mail: [email protected]

Cancer Gene Therapy (2002) 9, 390 398D 2002 Nature Publishing Group All rights reserved 0929-1903/ 02 $25.00

www.nature.com/ cgt


2/9

adoptive immunotherapy, we also investigated the cytotox-icity of -irradiated cIgTCR-expressing YT cells in vitroand in vivo.

Materials and methods

Cell linesThe human NK cell line YT was kindly provided by J Yodoi(Institute for Virus Research, Kyoto, Japan).23 YT cells werecultured with RPMI- 1640 supplemented with 10% (vol/ vol)heat- inactivated fetal calf serum (FCS) and 50 g/mLgentamicin ( all from Gibco BRL , Karlsruhe, Germany) witha maximum concentration of 2.5105 cells/mL. The humancolon carcinoma cell lines SW480 (kindly provided by WKemmner, Max- Delbrueck- Center [ MDC], Berlin, Ger-many ), SW948 ( American Type Culture Collection [ATCC],Rockville, MD, No. CCL- 237), SW1222, LoVo (ATCCCCL-229) and LS174T (ATCC CL-188), the transformedrenal cell line 293T (kindly provided by M Seidensticker,MDC) and the murine colon carcinoma cell line MC3831 and

its CEA transgenic derivative MC32A32 ( kindly provided byJ Schlom, National Cancer Institute, NIH, Bethesda, MD)were cultured in DMEM (Gibco BRL) supplemented with10% (vol/ vol) FCS and 50 g / mL gentamicin. The MC32Acell line was cloned by limited dilution.

Construction of the scFv fragments

The CEA-specific scFv antibody fragment was constructedof the humanized mAb BW431/26.25 The plasmids con-taining the cDNA of the BW431/26 V regions were kindly

provided by K Bosslet ( Behringwerke, Marburg, Ger-many). The VL region was amplified from pUC19-LC431

by polymerase chain reaction ( PCR ) using primer

BW431-VL - 1A ( 50

- CGAGTCTAGA ACCATGGACATCCAGATGACC-3

0) and BW431- VL - 2 ( 5

0-CACCAC-

TCCC GGGCTTTCCT GAACCGGAAG TGGATCC-TTT GATTTC CACC TTGGTCCCTT G- 30 ) and the VHregion was amplified from pAB-431/26-VH -hum3

25,26

using primer BW431-VH - 1 ( 50 - AAGCCCGGGA GTG-

GTGAAGG TAGCACTAAA GGCCAGGTCC AGCTG-CAGGA GAGC-30 ) and BW431-VH-2 (5

0-TTGGATCCGGCCGCACCTGA GGAGACGGTG ACCGT-30). The VLfragment digested with NcoI and SmaI and the VH fragmentdigested with SmaI and NotI ( restriction enzymes from

New England Biolabs, Frankfurt am Main, Germany) werecloned into the NcoI and NotI sites of the E. coli

periplasmatic expression vector pOPE5133 ( kindly provi-

ded by S Dubel, Molecular Genetics, University Hei-delberg, Germany) to obtain the scFv scBW431/ 26consisting of the N terminal VL region followed by theLinker- 218 ( GSTSGSGKPGSGEGSTKG )4 and theVH region (pOPE51-scBW431/26).

An scFv antibody fragment specific for the hapten 2-phenyloxazoline - 5- one ( phOx ), which was isolated from ahuman phage antibody library and improved by chainshuffling34 was redesigned with the Linker-218 connectingthe VL and VH domains analogously to scBW431 / 26.Briefly, plasmids pOPE51- scBW431/ 26 and pOPE51-

phOx were digested with Eco81I ( Fermentas, St. Leon-

Rot, Germany) and PvuII. The VH domain of scBW431/26 was substituted by the VH domain of the phOx-specificscFv. Finally, the BW431/26-VL domain was substitutedusing the restriction sites NcoI and NotI with the VLdomain of the phOx-specific scFv obtained by PCR from

pOPE51 - phOx using primer phOx - VL - 1 ( 50-AGAAC-

CATGG ACATCCAGAT GACGCAGCCG CCCTCA - 30)

and phOx-VL - 2 ( 50

- AGAAGGATCC TAGGACGGTGACCTTGGTC-30 ) (pOPE51-scPhOx).

Construction of the scFv-hFc fusion proteins

The hFc fragment consisting of the IgG1 heavy -chainhingeCH2 CH3 domains ( according to swissprot P01-857)35 was obtained from the plasmid pCMX -sFGFR4 -hFc36 (kindly provided by M Seidensticker, MDC) using

primer hFc - 1 ( 50-CAAGAAGCTT AGCAAGATCT GCG-GCCGCCG AGCCCAAATC TTGTGACA- 30) and hFc- 2( 5

0- CAACTCTAGA CTCGAGACGC TCATTTACCC GG-

AGACA-30). The hFc fragment was cloned into the HindIIIand XbaI sites of pCMX (pCMX-hFc). The secretory leader

of the human IgG1 light-chain gene

37

was constructed byPCR using the oligonucleotides Leader-1 (5 0-GATGA-AGCTT AGCAGATCTC CATGGGATGG AGCTGTATCATCCTCTTCCT GGTAGC- 30 ) and Leader-2 (50-GTAGA-GTACT GTGCACGCCT GTAGCTGTTG CTACCAGGAAGAGGATGATA C - 30) as template and primer. The obtainedleader fragment was digested with HindIII and ScaI. The

plasmids pOPE51 - scBW431/ 26 and pOPE51 - scPhOx weredigested withNcoI followed by a removal of the 50 overhangs

by incubation with S1 - nuclease ( Roche Diagnostics, Man-nheim, Germany). Finally, the scFv fragment cDNAs wereobtained by digestion with NotI and cloned with the leaderfragment into the HindIII and NotI sites of pCMX-hFc. Theobtained plasmids were designated as pCMX- scBW431 /

26-hFc and pCMX-scPhOx-hFc.

Calcium phosphate transfection of 293T cells

One day before transfection 2105 293T cells/well wereseeded into six-well plates (TPP, Trasadingen, Switzerland).Two micrograms of the plasmids pCMX-scBW431/26-hFcor pCMX-scPhOx-hFc were diluted in 125 L 250 mMCaCl2. The same volume of 2xHeBSP (10 g/L HEPES [N-2-hydroxyethylpiperazine-N0 -2-ethanesulfonic acid], 0.31g/L Na2HPO42H2O, 16 g/L NaCl, 0.74 g/L KCl [all fromServa, Heidelberg, Germany], 2 g /L D - glucose [Sigma,Deisenhofen, Germany ] adjusted to pH 6.95) was addeddropwise to the DNA solution and mixed several times. After

15 minutes incubation at room temperature the precipitatewas added to the cells. The cells were incubated with theDNA calcium phosphate precipitate overnight at 378C and5% (vol/vol) CO2 before the medium was exchanged. Thesupernatants containing the scFv-hFc fusion proteins wereharvested after 3 days.

ELISA

CEA ( 2 g/ mL; Calbiochem, Bad Soden, Germany),phOx - labeled bovine serum albumin ( phOx - BSA ) kindlyprovided by J Schenk ( MDC ) or BSA ( Sigma ) were coatedin 50 L 50 mM bicarbonate buffer (pH 9.6) per well onto

Cancer Gene Therapy

Tumor targeting of a human NK cell lineT Schirrmann and G Pecher

3


3/9

96- well Maxisorb2 microtiter plates ( Nunc, Wiesbaden,Germany) overnight at room temperature. The wells were

blocked using 2.5% ( wt / vol ) hydrolyzed caseinate ( Serva )in PBS. Supernatant of 293 T cells (100 L/well) expressingscBW431/ 26- hFc or scPhOx- hFc were incubated for 1 hourat room temperature. Horseradish peroxidase conjugatedgoat anti human- IgG- Fc F(ab0 )2 ( 50 L/well; Dianova,

Hamburg, Germany) was used diluted 1:1000 in blockingbuffer as secondary antibody and incubated for 1 hour atroom temperature. The enzyme reaction was performedusing 100 L/ well 2 mg/ mL o -phenyldiamine ( Sigma) incitrate phosphate buffer (10 g/ L citric acid, 14 g/ L

Na2HPO4 [Serva], pH5.0; add 20 L 30% H2O2 [Sigma]per 100 mL before use ). The reaction was stopped by adding50 L/well 3 N NaOH (Roth, Karlsruhe, Germany). Theextinction was measured at 492 nm.

Isolation of the CD3 chain cDNA

The cDNA of the CD3 chain was isolated from activatedperipheral blood lymphocytes ( PBLs ). PBLs were prepared

from freshly drawn heparinized blood of healthy donors.Briefly, peripheral mononuclear cells ( PBMCs) were iso-lated by density gradient centrifugation using Lymphoprep2

( 1,077 g/ mL, Nycomed, Roskilde, Denmark) for 30 minutesat 600g and 208C. Thrombocytes were depleted from thePBMC fraction by density gradient centrifugation usingOptiprep2 ( Nycomed ) adjusted to 1.063 g / mL with Ultra-saline A (Biowhittaker, Verviers, Belgium) for 15 minutes at350g and 208C and by two to three additional washingsteps using plain RPMI- 1640. PBLs were obtained byadherence of the monocytes to plastic in Iscoves modi-fied Dulbeccos medium (IMDM, Gibco BRL, Karlsruhe,Germany) supplemented with 10% (vol/vol) pooled heat-inactivated human AB serum ( Biowhittaker) overnight. The

nonadherent PBLs were washed and 106 cells/ mL wereactivated 1 week in RPMI-1640 containing 10% (vol/vol)human AB serum, 50 g/mL gentamicin, and 1 g/mL

phytohemagglutinin ( Sigma ).Total RNAwas prepared from the activated PBL using the

TRIzol Reagent2 ( Gibco BRL, Karlsruhe, Germany) accor-ding to the suppliers description. The poly-(A + )-mRNAwas isolated from total RNA using oligo- ( dT) - cellulose(Sigma) and transcribed into cDNA using the UniversalRiboClone1 cDNA-Synthese system (Promega, Man-nheim, Germany ). The cDNA of the CD3 chain wasisolated from the cDNA of activated PBL by PCR using the

primer - 1A ( 50- GGACAAGATG AAGTGGAAGG - 30)and -2A (50 -CGTGAGAAGA GTGAACCGGG-30) andthe T/A-cloning system (Invitrogen, Karlsruhe, Germany).The fragment containing the transmembrane and thecytoplasmic domain of the chain was amplified from the cDNA using the primer - 1B ( 50 -CCTAGGATCCCAAACTCTGC TACCTGCTGG ATGGAATCC - 3

0) and

- 2B ( 50 - CCAGAAGCTT TGAGTGGAGA AATCCCC-TGG CAGTTAGCGA CC-30 ).

Construction of the cIgTCRs

A BamHI site was inserted into the C terminus of the hFcfragment by PCR using the plasmid pCMX-sFGFR4-hFc

and the primers hFc-1 (see above) and hFc-2B (50 -TAACCTCGAG TCTAGATCAT GGATCCTTAC CCGG-AGACAG GGAGA-3

0). The obtained hFcB PCR fragment

was cloned into the HindIII and XhoI sites of the mammalianexpression vector pCDNA3 (Invitrogen ). The transmem-

brane and cytoplasmatic fragment of the chain was fused tothe BamHI site of the hFcB fragment to obtain the plasmid

pCDNA3- hFc. The fragments consisting of the leadersequence and the scFv fragments from pCMX-scBW431/26-hFc or pCMX-scPhOx-hFc were cloned into the HindIIIand NotI sites of pCDNA3-hFc. The plasmids containingthe CEA- specific cIgTCR scBW431 /26 -hFc and the

phOx - specific cIgTCR scPhOx - hFc were designated aspCDNA3- scBW431/ 26 - hFc and pCDNA3-scPhOx-hFc, respectively.

Gene transfer of the cIgTCR constructs into the human NKcell line YT

The plasmids pCDNA3-scBW431/26-hFc or pCDNA3-scPhOx-hFc were transfected by electroporation into the

YT cell line. Briefly, 10

7

YT cell were washed andresuspended with plain RPMI-1640. The cells were trans-ferred into 0.4- cm electroporation cuvettes ( Eurogentec,Cologne, Germany) and 20 g of the plasmid DNA wasadded. The cells were pulsed with 250 V and 975 F usingthe GenePulser2 II with Capacitance Extender2 II (BioRad,Munich, Germany). The selection of the transfected YT cellswas started 48 hours after electroporation by adding 250 g /mL G418 (Calbiochem) to the culture medium. After1 week selection dead YT cells were removed by densitygradient centrifugation using Lymphoprep2 for 15 minutesat 600g and 208C.

Immunoaffinity purification of cIgTCR-expressing YT cells

The cIgTCR- expressing YT cells were sorted after selectionwith G418 using a FACSCalibur

2high performance cell

sorter ( Becton Dickinson, Bedford, MA). Briefly, 107 of thetransfected YT cells were stained with 500 L FITC-conjugated goat anti human- IgG- Fc F(ab0)2 fragment(Dianova) 1:100 diluted in sterile PBS supplemented with0.5% (wt/vol) BSA (Sigma) and 2 mM EDTA (Serva). Theenrichment of cIgTCR- expressing YT cells was repeatedafter 1 2 weeks. Alternatively, cIgTCR- expressing cellscould be additionally stained with anti-FITC MicroBeadsand sorted using the magnetic cell-sorting system MACS2

following the suppliers description (Miltenyi Biotec,Bergisch Gladbach, Germany).

FACS analysis

The expression of the cIgTCR was detected using 1:100diluted FITC-conjugated goat antihuman-IgG-FcF(ab0)2 fragment (Dianova). A total of 510

5 cells werestained in PBS, 0.5% (wt/vol) BSA, and 0.1% (wt/vol)

NaN3 ( Sigma) for 15 minutes at 48C. Propidium iodide (PI,Sigma) was added with a final concentration of 1 g/ mL tothe stained cells. The FACS measurement was performedusing a FACSort2 (Becton Dickinson). Mock (pCDNA3)transfected YT cells were used as negative control. The CEAexpression of the target cell lines was analyzed using the

Cancer Gene Therapy


392


4/9

scBW431/26-hFc protein containing supernatant followedby an FITC - conjugated goat anti human - IgG - FcF(ab0)2fragment. The scPhOx- hFc protein was used as control.Additionally, the colon carcinoma cell lines were analyzedusing the anti- CEA mAb CEJ065 (Beckman Coulter,Unterschleissheim- Lohhof, Germany ) and an appropriateisotype control mAb followed by an FITC-conjugated goatantimouse-IgG(H+ L) F(ab

0)

2

fragment (Dianova).CEJ065 cross-reacts with NCA (nonspecific cross-reactingantigen) according to the suppliers description.

Cytotoxicity assay

The cytotoxicity was examined with standard 6-hour 51Cr-release assays. Briefly, target cell lines MC38, MC32A,SW480, SW948, SW1222, LoVo, and LS174T were labeledusing [ 51Cr]sodium chromate ( Dupont NEN, Bad Hom-

burg, Germany). The labeled target cells were washed atleast thrice with RPMI-1640 supplemented with 10% (vol/vol) FCS. cIgTCR and mock transfected YT cells wereused as effector cells in this assay. A total of 1.5105

effector cells and 3103 51Cr-labeled target cells per well

were plated into V-bottom 96-well plates (Greiner,Frickenhausen, Germany) using IMDM supplemented with10% (vol/vol) FCS corresponding to an effector to target(E:T) ratio of 25:1. Further E:T ratios were performed byhalf dilution of the effector cells. Spontaneous andmaximum 51Cr release were determined by incubatingtarget cells in medium or in 1% (vol/ vol) Triton- X100(Sigma), respectively. All samples were performed at leastin triplicate. Plates were centrifuged for 5 minutes at 200gand incubated for 6 hours at 378C and 5% CO2. Afterincubation the plates were carefully shaken for 5 minutesand centrifuged for 5 minutes at 300g. Fifty microliters

supernatant per well were transferred to 96- well Luma-plates.2 Dried and sealed plates were measured using the- scintillation counter Topcount2 ( Packard Bioscience,Dreieich, Germany). The percent lysis was calculated withfollowing formula:

lysis % lysis counts per minute; cpmspontaneous lysis cpm100% lysis cpmspontaneous lysis cpm

100%

Soluble CEA inhibition assay

The cytotoxicity of scBW431/26 -hFcexpressing YTcells was examined against MC32A cells performing a51Cr- release assay after addition of soluble CEA proteinwith a final concentration of 0, 100 ng/mL, 1 g/ mL, or 10g/mL to the medium.

-Irradiation of YT cells

The (14)107 scBW431/26-hFc expressing YT cellsfor each attempt were centrifuged at 200g and 48C. Thecell pellets were placed on ice and irradiated with 0, 2000,5000, 7500, or 15000 rad using a 137Cs - radiation source.The irradiated cells were cultured for 16 hours in culturemedium without G418. The cytotoxicity of the irradiatedscBW431/26-hFc YT cells were tested against CEA +

MC32A tumor cells performing 51Cr- release assays.scBW431/26-hFc YT cells treated with 5000 rad werealso analyzed 3 and 5 days after - irradiation. The viabilityof YT cells after irradiation was examined by trypan blue(Sigma) exclusion.

NOD/SCID mouse tumor model

Male NOD/ SCID mice were held under standardizedpathogen - free conditions at EPO, Berlin, Germany. Allanimal experiments were performed under the auspices ofthe German Animal Protection Law. Three groups with sixmice per group were subcutaneously injected with 106

MC32A cells together with 107 -irradiated (5000 rad) YT-

pCDNA3- scBW431/ 26 - hFc, 107 -irradiated ( 5000 rad)YT-pCDNA3-scPhOx-hFc, or PBS. Tumor diameterswere measured twice per week with a caliper and tumorvolumes were calculated according to the formula:( ab )0.5 cm (where a represents the largest and b thesmallest diameter). Mice were sacrificed when the tumorvolume exceeded 10% of the body weight ( >1 cm3 ). Curves

were compared using the MannWhitney U test.

Results

scBW431/26-hFc protein binds specifically to CEA

To analyze the antigen specificity of the cIgTCRs, theextracellular part was expressed as scFv-hFc protein (Fig1a) in 293 T cells. The secretory leader sequence enabled theextracellular expression and the analysis of the scFv-hFc

protein directly from the supernatant of pCMX - scBW431 /26- hFc or pCMX- scPhOx- hFctransfected 293T cells.

Figure 1 Schematic diagram of the scFv- hFc and the cIgTCR

constructs. a: The scFv-hFc proteins representing the extracellular

part of the cIgTCRs are constructed of the N terminal secretory IgG1

signal peptide ( Leader ) followed by the scFv antibody fragment,

consisting of the humanized VL and VH domains of the CEA-specific

mAb BW431/26 or a phOx- specific scFv joined by an artificially

designed peptide (Linker-218), and the Fc part (hingeCH2 CH3domains) of the human IgG1 (hFc). b: The transmembrane (TM)

and cytoplasmatic domains of human CD3 are fused to the C

terminus of scFv- hFc cDNA to obtain the cIgTCR constructs. cIgTCRand scFv-hFc constructs are expressed under control of a human

CMV (hCMV ) promoter and a bovine growth hormone ( bGH poly- A )

or a simian virus 40 poly- A signal ( SV40 poly- A).

Cancer Gene Therapy


3


5/9

The scBW431/26-hFc protein bound specifically to CEAbut not to BSA - coated wells as determined using ELISA(Fig 2a). The scPhOx -hFc protein bound specifically to

phOx - BSA ( Fig 2b ).

cIgTCR gene transfer into the YT cell line

The plasmids pCDNA3-scBW431/26-hFc or pCDNA3-scPhOx-hFc containing cIgTCR constructs (Fig 1b) were

successfully transfected into the YT cell line by electro-poration with a mean transfection efficiency of 2% asdetermined by flow cytometry. After selection with G418cIgTCR-expressing YT cells were successfully enriched byimmunoaffinity purification against the human Fc domain ofthe receptor using FACS or MACS.2 After two timesenrichment 90% of the transfected YT cells expressed thecIgTCR on their surface (Fig 3). It should be noted that

biotinylated goat anti human- IgG - Fc antibody andMicroBead-conjugated streptavidin could not be used forthe enrichment of the cIgTCR-expressing YT cells. Strongcross-linking probably leads to mutual lysis of the enrichedreceptor expressing YT cells.

scBW431/26-hFc protein binds to CEA + colon carcinomacell lines

The expression of the cIgTCR antigens on colon carcinomacell lines was evaluated by flow cytometry using thescBW431/ 26- hFc and scPhOx- hFc proteins, respectively(Fig 4). The whole population of CEA transgenic MC32Acells was stained with scBW431/26-hFc protein similar tothe mAb CEJ065 whereas CEA MC38 cells were notstained, neither with scBW431/ 26- hFc protein nor withCEJ065. The human colon carcinoma cell lines LoVo,LS174T, SW948, and SW1222 were stained with scBW431/

26-hFc protein but to a lower percentage than with the mAbCEJ065. SW480 cells were negative for the staining with thescBW431/ 26- hFc protein and the mAb CEJ065. The phOx-specific scPhOx- hFc protein did not bind to any of theanalyzed tumor cell lines and was used as negative controlfor the scBW431/ 26- hFc protein.

CEA-directed cytotoxicity of scBW431/26-hFcexpressing YT cells

The cytolytic activity of the cIgTCR- expressing YTcells wasexamined using 6-hour 51Cr-release assays against CEA +

and CEA colon carcinoma cell lines. YT cells expressingthe CEA- specific cIgTCR scBW431/26 -hFc lysed theCEA + transgenic MC32A cells up to 50% (Fig 5a). The lysiswas also efficient at low E:T ratios. The CEA MC38 cellswere not lysed by the scBW431/26-hFc gene-transfectedYT cells (Fig 5b). scBW431/26-hFcexpressing YT cellslysed human colon carcinoma cell lines LoVo, LS174T,SW948,and SW1222 up to 15% (Fig 5c, d,f, g). The cell lineSW480 was not lysed by scBW431/ 26- hFc-transfected YT

cells (Fig 5e). Mock transfected YT cells or YT cellstransfected with the phOx-specific cIgTCR used as controleffector cellsdid not lyse any of theused colon carcinoma celllines.

Soluble CEA did not inhibit scBW431/26-hFc-mediatedlysis

Receptors with antibody- based recognition might beblocked by their soluble antigens. To analyze whethersoluble CEA interfere with the cytotoxicity of scBW431/26-hFc expressing YT cells against CEA + target cellswe performed 51Cr- release assays with different concen-trations of soluble CEA protein. The lysis of CEA +

MC32A cells by scBW431/26-hFc expressing YT cellswas not inhibited in the presence of up to 10 g/mLsoluble CEA protein compared to the attempt withoutsoluble CEA (Fig 5h).

scBW431/26-hFcexpressing YT cells retain theirspecificity and cytotoxicity after-irradiation

Growth inhibition of allogeneic effector cell lines arerequisite for clinical applications. We used -irradiation to

prevent the unlimited growth of the YT cell line. Thecomplete growth inhibition of YT cells was reached at2000 rad. No viable cells were detectable 12 days afterirradiation. The percentage of viable cIgTCR transgenic

Figure 3 Expression of the cIgTCRs scBW431/26-hFc ( a ) and

scPhOx-hFc ( b ) on stabile transfected YT cells after 2- fold

enrichment against the human Fc part of the cIgTCR determined

with FITC-labeled goat anti human- IgG- Fc F(ab0 )2 fragment

(filled). Mock transfected YT cells were used as control (gray line).

Figure 2 Antigen binding of the scFv - hFc proteins. Supernatants of

transfected 293 T cells containing ( a ) scBW431 /26 -hFc or ( b )

scPhOx-hFc protein were tested for their antigen binding against ( a )

CEA or ( b ) phOx- BSA using ELISA. These supernatants were also

analyzed against BSA. Supernatant of mock transfected 293 T cells

was used as control.

Cancer Gene Therapy


394


6/9

Figure 4 FACS analysis of the CEA expression on colon carcinoma cell lines. The cell line MC38 (a, b) and its CEA transgenic derivative MC32A

(c, d) and the human colon carcinoma cell lines LoVo (e, f), LS174T (g, h), SW480 (i, j), SW948 (k, l) and SW1222 (m, n) were tested using

scBW431/ 26- hFc protein ( filled) ( a, c, e, g, i, k, m ). scPhOx- hFc protein was used as negative control for the scBW431/ 26 - hFc protein ( gray

line). For comparison, the FACS analysis using the mAb CEJ065 (filled) and an isotype control mAb ( gray line) is shown (b, d, f, h, j, l, n).

Cancer Gene Therapy


3


7/9

YT cells was 94% 1 day after irradiation with 5000 rad,37% 2 days after irradiation, 9% 4 days after irradiation, and


8/9

potent cytotoxic activity against various NK sensitive celllines, and can be transfected by electroporation without needof retroviral vector systems. In this study, we examinedwhether this NK cell line could be specifically targeted bygene transfer of a CEA-specific cIgTCR to CEA + coloncarcinoma cell lines. The receptor construct scBW431/26-hFc consists of an scFv fragment derived from the

humanized mAb BW431/ 26, the hingeCH2CH3domains of human IgG1 heavy chain, and the transmem-

brane and cytoplasmatic part of the human CD3 signalchain. The extracellular part of the cIgTCR was expressed asscFv-hFc protein in 293T to analyze the specificity of thereceptor and its antigen expression on colon carcinoma celllines. This secretory mammalian expression system circum-vents problems occurring with bacterial scFv expressionsystems and simplifies the analysis of the cIgTCRspecificity. The scBW431/ 26- hFc protein binds specificallyto surface- attached CEA protein and to certain coloncarcinoma cell lines.

The scBW431/26-hFc receptor gene was successfullytransfected into the YT cell line by electroporation and the

receptor-expressing cells could be enriched by immunoaf-finity purification against the hFc part. The scBW431/26-hFc expressing YT cells lyse specifically CEA + coloncarcinoma cell lines, which were resistant against the

parental YT cell line. The lysis correlates with the positivestaining of the target cell lines using the scBW431/ 26- hFc

protein.Because soluble antigen could interfere with the cIgTCR-

mediated lysis,2,40 we examined the cytotoxicity ofscBW431/26-hFc expressing YT cells in the presence ofsoluble CEA protein. We did not find any inhibition of thetumor cell lysis by soluble CEA protein in concentrations upto 10 g/mL. This effect has been also demonstrated for Tcells transduced with CEA- 11,13 and TAG72 -specificcIgTCRs.10 The mAb BW431/26 has been shown torecognize specifically membrane- bound CEA and cannot

be blocked by soluble CEA protein.27,41 Furthermore, thepolyvalent interaction between cIgTCR - expressing effectorcells and target cells should overrule the inhibitory effect ofmonomeric soluble antigens.13

The clinical use of an allogeneic effector cell line wouldassume a strategy that employs a cell line not growingunlimited itself in patients. A method fulfilling thisassumption would be - irradiation, which has been usedfor the MHC- nonrestricted T-cell line TALL- 104 in

patients with metastatic breast cancer in a phase I clinicaltrial.42 Therefore, we tested whether irradiated cIgTCR

gene transfected YT cells would lyse CEA+

tumor cell linesat the same range as nonirradiated cells. We found that evenirradiated scBW431/26-hFcgene- modified YT cells lysedCEA + MC32A cells in vitro similarly compared to non-irradiated YT cells. The number of viable effector cells andtheir cytolytic activity decrease 3 days after irradiation.Furthermore, we investigated the in vivo efficacy of -irradiated scBW431/ 26- hFc YT cells in a NOD/ SCIDmouse model. The adoptive transfer of the lethally irradiatedscBW431/26-hFc expressing YT cells led to a growthinhibition of CEA+ MC32A tumor cells if administeredsimultaneously. Our data demonstrate that irradiated

scBW431/26-hFc YT cells effectively lyse CEA + tumorcells within the first days after - irradiation, possiblyrequiring repeated applications. Other approaches to avoidunlimited growth of the YT cells as suicide gene strategies43

could be considered.Taken together, we specifically targeted the human NK

cell line YT available in unlimited source by nonviral gene

transfer of the scBW431 /26 -hFc receptor construct toCEA + colon carcinoma cells. Even lethally irradiated cellsled to tumor growth inhibition in mice. This gene-modified

NK cell line could be a useful tool for clinical adoptiveimmunotherapy.

Acknowledgments

This work was supported by a fellowship from the MedicalFaculty of the Charite, Humboldt - University Berlin to TSand by a fellowship Rahel Hirsch from the Medical Facultyof the Charite, Humboldt -University Berlin to GP. We

especially thank J Yodoi (Institute for Virus Research) forproviding the cell line YT and K Bosslet ( Behringwerke ) forproviding the cDNA of the V regions of the humanized mAbBW431/26. We thank I Fichtner (EPO) for help with themice experiments and JA Schenk ( MDC) for critical readingof the manuscript.

References

1. Calogero A, de Leij LF, Mulder NH, Hospers GA. Recombi-nant T-cell receptors: an immunologic link to cancer therapy.J Immunother. 2000;23:393 400.

2. Eshhar Z. Tumor- specific T- bodies: towards clinical applica-

tion. Cancer Immunol Immunother. 1997;45:131136.3.Bird RE, Hardman KD, Jacobson JW, et al. Single- chain

antigen - binding proteins. Science. 1988;242:423 426.4. Whitlow M, Bell BA, Feng SL, et al. An improved linker for

single-chain Fv with reduced aggregation and enhancedproteolytic stability. Protein Eng. 1993;6:989995.

5. Eshhar Z, Waks T, Gross G, Schindler DG. Specific activationand targeting of cytotoxic lymphocytes through chimeric singlechains consisting of antibody-binding domains and the gammaor zeta subunits of the immunoglobulin and T-cell receptors.Proc Natl Acad Sci USA. 1993;90:720724.

6. Finer MH, Dull TJ, Qin L, Farson D, Roberts MR. kat: a high-efficiency retroviral transduction system for primary human Tlymphocytes. Blood. 1994;83:4350.

7. Weijtens ME, Willemsen RA, Hart EH, Bolhuis RL. Aretrovir-

al vector system STITCH in combination with an optimizedsingle chain antibody chimeric receptor gene structure allowsefficient gene transduction and expression in human T lym-phocytes. Gene Ther. 1998;5:1195 1203.

8. Riddell SR, Elliott M, Lewinsohn DA, et al. T- cell mediatedrejection of gene -modified HIV-specific cytotoxic T lym-phocytes in HIV- infected patients. Nat Med. 1996;2:216223.

9. Hwu P, Shafer GE, Treisman J, et al. Lysis of ovarian cancercells by human lymphocytes redirected with a chimeric genecomposed of an antibody variable region and the Fc receptorgamma chain. J Exp Med. 1993;178:361366.

10. McGuinness RP, Ge Y, Patel SD, et al. Anti-tumor activity of

Cancer Gene Therapy


3


9/9

human T cells expressing the CC49- zeta chimeric immunereceptor. Hum Gene Ther. 1999;10:165173.

11. Hombach A, Koch D, Sircar R, et al. A chimeric receptor thatselectively targets membrane-bound carcinoembryonic antigen(mCEA) in the presence of soluble CEA. Gene Ther. 1999;6:300304.

12. Ren Heidenreich L, Hayman GT, Trevor KT. Specifictargeting of EGP- 2+ tumor cells by primary lymphocytes

modified with chimeric T cell receptors. Hum Gene Ther.2000;11:919.

13. Beecham EJ, Ortiz Pujols S, Junghans RP. Dynamics of tumorcell killing by human T lymphocytes armed with an anti -carcinoembryonic antigen chimeric immunoglobulin T- cellreceptor. J Immunother. 2000;23:332343.

14. Bakker AB, Wu J, Phillips JH, Lanier LL. NK cell activation:distinct stimulatory pathways counterbalancing inhibitorysignals. Hum Immunol. 2000;61:1827.

15. Moretta A, Biassoni R, Bottino C, Mingari MC, Moretta L.Natural cytotoxicity receptors that trigger human NK - cell mediated cytolysis. Immunol Today. 2000;21:228234.

16. Yasumura S, Lin WC, Hirabayashi H, et al. Immunotherapy ofliver metastases of human gastric carcinoma with interleukin2 activated natural killer cells. Cancer Res. 1994;54:3808

3816.17. Whiteside TL, Sung MW, Nagashima S, et al. Human tumor

antigen- specific T lymphocytes and interleukin- 2 activatednatural killer cells: comparisons of antitumor effects in vitroand in vivo. Clin Cancer Res. 1998;4:11351145.

18. Roberts MR, Qin L, Zhang D, et al. Targeting of humanimmunodeficiency virus infected cells by CD8 + T lympho-cytes armed with universal T-cell receptors. Blood. 1994;84:28782889.

19. Tran AC, Zhang D, Byrn R, Roberts MR. Chimeric zeta-receptors direct human natural killer (NK) effector function topermit killing of NK - resistant tumor cells and HIV- infected Tlymphocytes. J Immunol. 1995;155:10001009.

20. Nagashima S, Mailliard R, Kashii Y, et al. Stable transductionof the interleukin-2 gene into human natural killer cell lines

and their phenotypic and functional characterization in vitroand in vivo. Blood. 1998;91:38503861.

21. Tam YK, Maki G, Miyagawa B, et al. Characterization ofgenetically altered, interleukin 2 independent natural killercell lines suitable for adoptive cellular immunotherapy. HumGene Ther. 1999;10:13591373.

22. Liu JH, Wei S, Blanchard DK, Djeu JY. Restoration of lyticfunction in a human natural killer cell line by gene transfection.Cell Immunol. 1994;156:24 35.

23. Yodoi J, Teshigawara K, Nikaido T, et al. TCGF (IL 2) -receptor inducing factor(s ): I. Regulation of IL 2 receptor on anatural killerlike cell line (YT cells). J Immunol. 1985;134:16231630.

24. Hammarstrom S. The carcinoembryonic antigen (CEA ) family:structures, suggested functions and expression in normal and

malignant tissues. Semin Cancer Biol. 1999;9:6781.25. Gussow D, Seemann G. Humanization of monoclonal

antibodies. Methods Enzymol. 1991;203:99121.26. Bruynck A, Seemann G, Bosslet K. Characterisation of a

humanised bispecific monoclonal antibody for cancer therapy.Br J Cancer. 1993;67:436440.

27. Bosslet K, Steinstrasser A, Schwarz A, et al. Quantitative

considerations supporting the irrelevance of circulating serumCEA for the immunoscintigraphic visualization of CEAexpressing carcinomas. Eur J Nucl Med. 1988;14:523 528.

28. Baum RP, Hertel A, Lorenz M, et al. 99Tcm-labelledanti -CEA monoclonal antibody for tumour immunoscinti-graphy: first clinical results. Nucl Med Commun. 1989;10:345352.

29. Boeckmann W, Baum RP, Schuldes H, et al. Tumour imaging

of bladder carcinomas and their metastases with 111indium-labelled monoclonal anti -CEA antibody BW 431/ 26. Br JCancer Suppl. 1990;4:10811084.

30. Moritz D, Groner B. A spacer region between the single chainantibody- and the CD3 zeta- chain domain of chimeric T cellreceptor components is required for efficient ligand bindingand signaling activity. Gene Ther. 1995;2:539546.

31. Fox BA, Spiess PJ, Kasid A, et al. In vitro and in vivoantitumor properties of a T-cell clone generated from murinetumor- infiltrating lymphocytes. J Biol Response Modif. 1990;9:499511.

32. Robbins PF, Kantor JA, Salgaller M, et al. Transduction andexpression of the human carcinoembryonic antigen gene in amurine colon carcinoma cell line. Cancer Res. 1991;51:36573662.

33. Kontermann RE, Liu Z, Schulze RA, et al. Characterization ofthe epitope recognized by a monoclonal antibody directedagainst the largest subunit of Drosophila RNA polymerase II.Biol Chem Hoppe- Seyler. 1995;376:473481.

34. Marks JD, Griffiths AD, Malmqvist M, et al. By- passingimmunization: building high affinity human antibodies bychain shuffling. Biotechnology. 1992;10:779783.

35. Ellison JW, Berson BJ, Hood LE. The nucleotide sequence of ahuman immunoglobulin C gamma1 gene. Nucleic Acids Res.1982;10:4071 4079.

36. Gao G, Goldfarb M. Heparin can activate a receptor tyrosinekinase. EMBO J. 1995;14:21832190.

37. Persic L, Righi M, Roberts A, et al. Targeting vectors forintracellular immunisation. Gene. 1997;187:18.

38. Yannelli JR, Hyatt C, McConnell S, et al. Growth of tumor-

infiltrating lymphocytes from human solid cancers: summaryof a 5- year experience. Int J Cancer. 1996;65:413 421.

39. Bordignon C, Carlo- Stella C, Colombo MP, et al. Cell the-rapy: achievements and perspectives. Haematologica. 1999;84:11101149.

40. Hombach A, Heuser C, Gerken M, et al. T cell activation byrecombinant Fc epsilon RI gamma - chain immune receptors:an extracellular spacer domain impairs antigen- dependent Tcell activation but not antigen recognition. Gene Ther. 2000;7:10671075.

41. Murakami M, Kuroki M, Arakawa F, et al. Binding reactivityof monoclonal anti -carcinoembryonic antigen (CEA) anti-bodies with cell membrane bound CEA and with free CEA insolution. Immunol Invest. 1996;25:2335.

42. Visonneau S, Cesano A, Porter DL, et al. Phase I trial of

TALL- 104 cells in patients with refractory metastatic breastcancer. Clin Cancer Res. 2000;6:17441754.

43. Uckert W, Kammertons T, Haack K, et al. Double suicidegene (cytosine deaminase and herpes simplex virus thymi-dine kinase) but not single gene transfer allows reliableelimination of tumor cells in vivo. Hum Gene Ther. 1998;9:855865.

Cancer Gene Therapy


398

Modified NK Nature

Documents

Transcript of Modified NK Nature