MLPA ( Multiplex ligation – dependent probe amplification )

39
MLPA (Multiplex ligation – dependent probe amplification) Peter Böhm Nielsen

description

MLPA ( Multiplex ligation – dependent probe amplification ). Peter Böhm Nielsen. Generelt analyseflow. MLPA. Anvendte metoder. HRM & Sanger sekventering. Allel 1. Allel 2. Allel 1. MLPA (Multiplex Ligation-dependent Probe Amplification). Allel 2. - PowerPoint PPT Presentation

Transcript of MLPA ( Multiplex ligation – dependent probe amplification )

Page 1: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA(Multiplex ligation – dependent probe amplification)

Peter Böhm Nielsen

Page 2: MLPA ( Multiplex ligation  – dependent  probe amplification )

S eqscape

A na ly se ring 3730

S ekven s p roduk t op rensn ing

S ekvensreak tion

P C R p roduk t op rensn ing

G eldokum en ta tion

S m elteku rve va lide ring

L igh tscanner an a ly se

P C R o psæ tn ing

D N A op rensn ing

Generelt analyseflow

MLPA

Page 3: MLPA ( Multiplex ligation  – dependent  probe amplification )

Anvendte metoder

Allel 1

Allel 2

Allel 1

Allel 2

MLPA (Multiplex Ligation-dependent Probe Amplification)

HRM & Sanger sekventering

Page 4: MLPA ( Multiplex ligation  – dependent  probe amplification )

Multiplex Ligation-Dependent Probe Amplification (MLPA)

• MLPA er en teknik til kopitalsbestemmelse af specifikke sekvenser. Dette sker ved simultan binding af op til 45 prober, hvorefter det relative antal af bundne prober bestemmes.

• Til udførelsen benyttes PCR amplifikation.

Page 5: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA Probe hybridisering

Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3

Promoter Exon 1 Intron 1 Intron 2 Exon 3

1

2

Page 6: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA (1) Multiplex Ligation depending Probe Amplification

1. Denaturering2. Hybridisering3. Ligering4. Amplifikation5. Fragment-

analyse

Page 7: MLPA ( Multiplex ligation  – dependent  probe amplification )

SALSA MLPA prober

Page 8: MLPA ( Multiplex ligation  – dependent  probe amplification )

Hybridisering

1. MLPA probemix blandes med denatureret genomisk DNA.

2. De to sammenhørende prober hybridiseres til tilstødende target sekvenser

Page 9: MLPA ( Multiplex ligation  – dependent  probe amplification )

Ligering

3. Prober ligeres sammen af en thermostabil ligase.

Page 10: MLPA ( Multiplex ligation  – dependent  probe amplification )

Amplifikation

4. Et universelt primer par benyttes til amplifikation af alle ligerede prober.Hvert amplifikat fra hver probe har en unik længde (130 - 480 bp).

Page 11: MLPA ( Multiplex ligation  – dependent  probe amplification )

Separation og kvantitering ved kapillær elektroforese

Hver top er et amplifikat fra en specifik probe .

Prøverne sammanlignes med en kontrolprøve.

En forskel i relativ tophøjde/areal indikerer en ændring i kopital af den gældende probes target sekvens.

Page 12: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA

Page 13: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA

Page 14: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA

Page 15: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA

Page 16: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA

Page 17: MLPA ( Multiplex ligation  – dependent  probe amplification )

Normal MLPA

Page 18: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA Deletion af exon 5-7

Page 19: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA Deletion af exon 3-16

Page 20: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA Duplikation af exon 13

Page 21: MLPA ( Multiplex ligation  – dependent  probe amplification )

Hvad kan dette være ?

Page 22: MLPA ( Multiplex ligation  – dependent  probe amplification )

Kan dette være rigtigt ?

Det er ikke sandsynligt at ovenstående er deletioner, da proberne mellem de 2 exons har korrekt amplifikationsstatus.

Page 23: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPAProbe hybridisering (2)

AGTTGGAACTAAACCTGTGCATGCGTGGATTTCCCTTGATTTGGACACGTACGCACCT

OHP

Stuffer sekvens

Gen specifikke prober

Kontroller

Prober forsøges designet udenfor SNP’s

Page 24: MLPA ( Multiplex ligation  – dependent  probe amplification )

MLPA prober - eksempler

5´-GGGTTCCCTAAGGGTTGGACTGCCGTGCTCACCTGGGCTCTGGCTCTTC-3´

5´-P-TTTCAGGTGGGTCTCCGACCCTGACTTCAACGTGGGGGTGTTCTAGATTGGATCTTGCTGGCAC-3´

5´-GGGTTCCCTAAGGGTTGGACATCAGCAGAAGATGGCTCGCGAGCCCGCGTGAGT-3´

5´-P- GCCCAGGGGAAGGGGTGTAGGCGAAGGGAGGAGACAGCTGTCTAGATTGGATCTTGCTGGCAC-3´

Page 25: MLPA ( Multiplex ligation  – dependent  probe amplification )

Anvendte metoder

Allel 1

Allel 2

Allel 1

Allel 2

MLPA (Multiplex Ligation-dependent Probe Amplification)

HRM & Sanger sekventering

Page 26: MLPA ( Multiplex ligation  – dependent  probe amplification )
Page 27: MLPA ( Multiplex ligation  – dependent  probe amplification )

Materialer og metoder CISH og FISH for HER-2 amplifikation (1)

Page 28: MLPA ( Multiplex ligation  – dependent  probe amplification )

Materialer og metoder CISH og FISH for HER-2 amplifikation (2)

Farshid.

Page 29: MLPA ( Multiplex ligation  – dependent  probe amplification )

Materialer og metoder (Prøvemateriale (1))

Page 30: MLPA ( Multiplex ligation  – dependent  probe amplification )

Materialer og metoder (Prøvemateriale (2))

Hematoxylin og eosin-farvning (HE)

Cancerceller kan ”fortyndes” i normale celler

Hvad har det af betydning ?

Page 31: MLPA ( Multiplex ligation  – dependent  probe amplification )

ResultaterNormal

Page 32: MLPA ( Multiplex ligation  – dependent  probe amplification )

Resultater Amplificeret

Page 33: MLPA ( Multiplex ligation  – dependent  probe amplification )

ResultaterMLPA vs. ISH

Page 34: MLPA ( Multiplex ligation  – dependent  probe amplification )
Page 35: MLPA ( Multiplex ligation  – dependent  probe amplification )

Kvalitetssikring af resultatet Quantity-peaks

Q-peaks: 64, 72, 76 & 82 – indikerer DNA mængde

Uafhængig af ligering

Page 36: MLPA ( Multiplex ligation  – dependent  probe amplification )

Kvalitetssikring af resultatet Denaturing-peaks

D-peaks: 88, 92 & 96 – indikerer DNA kvalitet og ligerings-reaktion

Afhængig af DNA &ligering

D-prober er placeret tæt på CpG-island – kræver meget energi ved denatureringen

TE TE+50mM NaCl TE+75mM NaCl

Page 37: MLPA ( Multiplex ligation  – dependent  probe amplification )

Raw-data vurdering (sloping)

God amplifikation Uensartet amplifikation

Resultater med samme signal-niveau er bedst at sammenligne.

Sloping er OK til et vist punkt, hvis normalisering kan udføres.

Kan skyldes fordampning – test med 8µl vand.

Page 38: MLPA ( Multiplex ligation  – dependent  probe amplification )

Rawdata vurdering

Page 39: MLPA ( Multiplex ligation  – dependent  probe amplification )

”Skuldre”

Degradering af ligerede prober: Kør MLPA-analysen direkte efter fortynding i formamid