Mitochondrial DNAMitochondrial DNA

… … and its’ use in Forensicsand its’ use in Forensics

Biology RecapBiology Recap

What is the Mitochondria?What is the Mitochondria?

The Mitochondria are often The Mitochondria are often considered the Cell Power houseconsidered the Cell Power house

They generate much of the They generate much of the Eukaryotic Cell’s ATP --- (remember Eukaryotic Cell’s ATP --- (remember ATP is the cell’s energy molecule)ATP is the cell’s energy molecule)

Mitochondria are Mitochondria are responsible for…responsible for…

Cell Energy ProductionCell Energy Production Cell GrowthCell Growth Cell Signaling ( sending cell Cell Signaling ( sending cell

messages)messages) Cell Death or ApoptosisCell Death or Apoptosis

Some Human cells have 1 Some Human cells have 1 mitochondriamitochondria

Others have MANYOthers have MANY

Can you think of a human cell that Can you think of a human cell that might have hundreds of might have hundreds of Mitochondria?Mitochondria?

A Muscle Cell!A Muscle Cell!

This is a close up of This is a close up of Cardiac Muscle fibersCardiac Muscle fibers

There are hundreds of There are hundreds of Fibers in a single cellFibers in a single cell

Each M stands forEach M stands forMitochondriaMitochondria

Endosymbiotic TheoryEndosymbiotic Theory

The theory that mitochondria and The theory that mitochondria and chloroplasts at some point in time chloroplasts at some point in time were separate organisms from a were separate organisms from a human cell. human cell.

They were engulfed by a cell and They were engulfed by a cell and became a became a symbiontsymbiont

Biologists believe this is Biologists believe this is how mitochondria and how mitochondria and

chloroplasts came to bechloroplasts came to be

What is the evidence for What is the evidence for this theory?this theory?

Well mitochondria and chloroplasts Well mitochondria and chloroplasts both are separately bound both are separately bound organelles. organelles.

More Importantly both chloroplasts More Importantly both chloroplasts and mitochondria have their own and mitochondria have their own DNADNA

Mitochondria resemble Mitochondria resemble certain kinds of bacteriacertain kinds of bacteria

They even have a circular DNA They even have a circular DNA molecule or molecule or plasmidplasmid

Mitochondrial DNA Mitochondrial DNA Molecule is 15,000 – 17,000 Molecule is 15,000 – 17,000

base pairs longbase pairs long

In mammals all mitDNA In mammals all mitDNA consists of the same 37 consists of the same 37

genesgenes 13 genes for proteins13 genes for proteins 22 genes for transfer DNA (tDNA)22 genes for transfer DNA (tDNA) 1 for the small subunit of the 1 for the small subunit of the

ribosomeribosome 1 for the Large subunit of the 1 for the Large subunit of the

ribosomeribosome

In humans all the In humans all the Mitochondrial DNA comes Mitochondrial DNA comes

from 1 parentfrom 1 parent The MotherThe Mother

Why is this?Why is this?

The egg cell has between 100,000 and The egg cell has between 100,000 and 1,000,000 copies of mitDNA1,000,000 copies of mitDNA

The sperm cell only has 10 The sperm cell only has 10

(when the sperm cell fertilizes the (when the sperm cell fertilizes the egg, the 10 copies of mitDNA from the egg, the 10 copies of mitDNA from the sperm are left behind, erasing the sperm are left behind, erasing the mitDNA from his side of the family)mitDNA from his side of the family)

Mitochondrial DNA allows Mitochondrial DNA allows scientists to do a maternal scientists to do a maternal

lineagelineage ……or trace a person’s ancestors or trace a person’s ancestors

based on mitDNAbased on mitDNA

In order to run a paternal lineage In order to run a paternal lineage scientists would have to trace the Y scientists would have to trace the Y chromosome… this is a much larger chromosome… this is a much larger task--- the Y Chromosome is 58 task--- the Y Chromosome is 58 million base pairs long!million base pairs long!

Who were the Romanovs?Who were the Romanovs?

What happened to the family and their What happened to the family and their remains?remains?

How did they discover the bodies?How did they discover the bodies? How did they prove the remains in the How did they prove the remains in the

bog belonged to the Romanovs?bog belonged to the Romanovs? Which Romanovs matched the MitDNA Which Romanovs matched the MitDNA

from Prince Philip? Which were missing?from Prince Philip? Which were missing? Who was Anna Anderson?Who was Anna Anderson? Was Anna Anderson princess Anastasia?Was Anna Anderson princess Anastasia?

Southern BlotSouthern Blot

This is the combination of Gel This is the combination of Gel Electrophoresis and a specific way of Electrophoresis and a specific way of probing for a specific DNA sequenceprobing for a specific DNA sequence

So you separated your sample by So you separated your sample by size, How can you find Gene X?size, How can you find Gene X?

Method Part 1Method Part 1

Perform a RFLP and run your Perform a RFLP and run your samples on a Gel Electrophoresis to samples on a Gel Electrophoresis to separate your sample by sizeseparate your sample by size

Part 2: Blot your sample Part 2: Blot your sample onto a nitrocellulose onto a nitrocellulose

membranemembrane Once your DNA samples are on the Once your DNA samples are on the

membrane, denature it membrane, denature it

You can do this by adding a base You can do this by adding a base such as NaOHsuch as NaOH

Your double stranded Your double stranded DNA will become Single DNA will become Single

stranded DNAstranded DNA

Step 3: Once this is done Step 3: Once this is done you can add your you can add your

detecting probe to bind detecting probe to bind with your DNAwith your DNA A Probe is a specific sequence of A Probe is a specific sequence of

DNA DNA

For ExampleFor Example

ATTACGATCCCCATCCACCATTACGATCCCCATCCACC

If we add a probe that has the If we add a probe that has the sequencesequence

AGGGG….where will this AGGGG….where will this bind? bind?

If we add a flourescent marker to If we add a flourescent marker to our AGGGG tag, then wherever the our AGGGG tag, then wherever the marker binds there will be a glowing marker binds there will be a glowing band… like thisband… like this

Step 4: Wash away excess Step 4: Wash away excess ProbeProbe

Step 5: DetectionStep 5: Detection

Usually this is a visualization of your Usually this is a visualization of your specific DNA sequencespecific DNA sequence

Audioradiography ( if you used a Audioradiography ( if you used a radio active probe)radio active probe)

Or Luminence if you used a Or Luminence if you used a flourescent probeflourescent probe

The main purpose of the Southern The main purpose of the Southern Blot is to take a bunch of unknown Blot is to take a bunch of unknown DNA sequences, and find a specific DNA sequences, and find a specific gene or sequencegene or sequence

Left is Gel Left is Gel Electrophoresis, Right is Electrophoresis, Right is

a Southern Blot…a a Southern Blot…a specific DNA sequence specific DNA sequence

was foundwas found

Southern Blot would be Southern Blot would be usedused

In cases where a suspect is known to In cases where a suspect is known to have a known genetic defect, such have a known genetic defect, such as Cystic Fibrosisas Cystic Fibrosis

Any specific DNA sequence that Any specific DNA sequence that would provide evidencewould provide evidence

The Polymerase The Polymerase Chain Reaction Chain Reaction

(PCR)(PCR) Or DNA photo copyingOr DNA photo copying

Why would anyone want to Why would anyone want to make more copies of DNA?make more copies of DNA?

PCR allows us to take a very tiny PCR allows us to take a very tiny amount of DNA and multiply this amount of DNA and multiply this into millions of copiesinto millions of copies

It lets us decode tiny, trace amounts It lets us decode tiny, trace amounts of DNA – Like in the Amanda Knox of DNA – Like in the Amanda Knox case.case.

Once we have billions of copies, we Once we have billions of copies, we can sequence the DNA strand and can sequence the DNA strand and determine who that DNA came fromdetermine who that DNA came from

PCR has allowed us to map segments of PCR has allowed us to map segments of the Human Genome that code for rare the Human Genome that code for rare diseases…diseases…

this allows us to do genetic testing – on this allows us to do genetic testing – on infants and on you!infants and on you!

this also allows you to be able to find this also allows you to be able to find out if you have the gene for Alzheimer's out if you have the gene for Alzheimer's Disease, or Parkinson’s Disease or Cystic Disease, or Parkinson’s Disease or Cystic Fibrosis or many other genetic diseasesFibrosis or many other genetic diseases

PCR is also a test used to determine PCR is also a test used to determine if you have the HIV virus in your if you have the HIV virus in your blood cells. blood cells.

Kary MullisKary Mullis

The American Molecular Biologist The American Molecular Biologist who invented PCRwho invented PCR

19851985 Won the Nobel Prize in Chemistry in Won the Nobel Prize in Chemistry in

19931993

How does PCR work?How does PCR work?

4 Steps4 Steps DenaturingDenaturing AnnealingAnnealing ExtensionExtension Exponential Extension Exponential Extension

Thermus aquaticus - a Thermus aquaticus - a very tiny bacteria!!very tiny bacteria!!

Thermus aquaticus lives in the nice Thermus aquaticus lives in the nice warm hot springs and thermal vents warm hot springs and thermal vents in Southwestern USAin Southwestern USA

These hot springs are between 75 These hot springs are between 75 and 80 degrees Cand 80 degrees C

Taq has enzymes that function well Taq has enzymes that function well at these high temperaturesat these high temperatures

Looks like this!!--->Looks like this!!--->

Taq Polymerase Taq Polymerase Poly = manyPoly = many Ase = to makeAse = to make

This enzyme copies DNA This enzyme copies DNA

PCR Step 1: Denature PCR Step 1: Denature your DNA sample your DNA sample

Heat your DNA sample up to about Heat your DNA sample up to about 98 degrees C, almost boiling for 20-98 degrees C, almost boiling for 20-30 seconds30 seconds

This will make your two DNA This will make your two DNA strands come apart strands come apart

How else can you denature DNA?How else can you denature DNA?

Double stranded Double stranded molecule pulls apart at molecule pulls apart at

high temperatureshigh temperatures

Step 2 Annealing of Step 2 Annealing of Primers Primers

““Anneal” means “to bind”Anneal” means “to bind” Primers: regions of DNA that are the Primers: regions of DNA that are the

message to begin DNA replicationmessage to begin DNA replication

Add these DNA segments to our Add these DNA segments to our Denatured DNA and let them bind.Denatured DNA and let them bind.

*This step also only takes 20-30 seconds**This step also only takes 20-30 seconds*

Step 3: ElongationStep 3: Elongation

Add the Taq polymerase Add the Taq polymerase Add Extra nucleotides (A,T,C,and G)Add Extra nucleotides (A,T,C,and G) Set heat for 75-80 degrees C Set heat for 75-80 degrees C

Time it takes to elongate depends - Time it takes to elongate depends - usually 5-15 minutesusually 5-15 minutes

DNA polymerase can elongate DNA at a DNA polymerase can elongate DNA at a rate of 1,000 bases/minute!!!rate of 1,000 bases/minute!!!

Step 4: Repeat!!! Step 4: Repeat!!!

We repeat these steps, 30-40 times We repeat these steps, 30-40 times to EXPONENTIALLY CLONE our to EXPONENTIALLY CLONE our DNA sample!!!DNA sample!!!

How many copies can How many copies can you make?you make?

So why is this useful?So why is this useful?

>It takes billions of copies to >It takes billions of copies to sequence a gene segmentsequence a gene segment

STR - Short Tandem STR - Short Tandem RepeatsRepeats

This is the method currently used in This is the method currently used in the U.S. for a “DNA Fingerprint”the U.S. for a “DNA Fingerprint”

ShortShort Tandem (or code)Tandem (or code) RepeatRepeat

Tandem RepeatsTandem Repeats

A term used to explain a coded A term used to explain a coded region that repeats itselfregion that repeats itself

ExampleExample ATTGCATTGCATTGCATTGCATTGCATTGCATTGCATTGCATTGCATTGC

Short Tandem RepeatsShort Tandem RepeatsTerm used for Term used for

applicationapplication Commonly used in ForensicsCommonly used in Forensics

Repeats are usually between 2 and Repeats are usually between 2 and 10 base pairs10 base pairs

Forensic Scientists generally use 4-5 Forensic Scientists generally use 4-5 bp repeatsbp repeats

Tandem Repeats are Tandem Repeats are generally considered generally considered

IntronsIntrons Introns are generally NONCODING Introns are generally NONCODING

DNA segments or Junk DNADNA segments or Junk DNA

Not all people have the Not all people have the same number of Repeats same number of Repeats

on an STR segmenton an STR segment

Even if two people had similar Even if two people had similar repeats for one region, there is a repeats for one region, there is a very slim chance that two different very slim chance that two different people would have the same number people would have the same number of repeats at each of the 13 coded, of repeats at each of the 13 coded, repeat regionsrepeat regions

The Human Genome The Human Genome project has discovered 13 project has discovered 13 Variable Repeat regions Variable Repeat regions on the Human Genomeon the Human Genome

Not including sex chromosomesNot including sex chromosomes

How does STR work?How does STR work?

A DNA sample would be A DNA sample would be treated and the Repeat treated and the Repeat

sequences would be sequences would be amplified using PCRamplified using PCR

Once these regions have been Once these regions have been amplified, they are visualized by Gel amplified, they are visualized by Gel ElectrophoresisElectrophoresis

This will tell you how many repeats This will tell you how many repeats there are of a particular segmentthere are of a particular segment

Once a profile is created Scientists Once a profile is created Scientists can send results to CODIScan send results to CODIS

CODIS - Combined DNA CODIS - Combined DNA Index SystemIndex System

An FBI funded database that houses DNA An FBI funded database that houses DNA samples of Serial criminals and Sex samples of Serial criminals and Sex offenders offenders

FBI requires 10 of the 13 CODIS regions to FBI requires 10 of the 13 CODIS regions to be uploaded to the Databasebe uploaded to the Database

Over 4.5 million ProfilesOver 4.5 million Profiles Has positively identified 49,500 DNA Has positively identified 49,500 DNA

samples helping to solve of 50,500 samples helping to solve of 50,500 investigationsinvestigations

The chances of two people having The chances of two people having the same DNA fingerprint at all 13 the same DNA fingerprint at all 13 loci is 1 in 1 Billion loci is 1 in 1 Billion

DNA Analysis in DNA Analysis in ForensicsForensics

Originally began with RFLP and Gel Originally began with RFLP and Gel ElectrophoresisElectrophoresis

The invention of PCR and STR The invention of PCR and STR brought about the ability to brought about the ability to sequence and compare sequence and compare small small regions of DNAregions of DNA

*Eventually it is possible that our *Eventually it is possible that our DNA sequencing technology will DNA sequencing technology will allow us to do direct, accurate allow us to do direct, accurate comparisons of very large DNA comparisons of very large DNA segments and possibly even a whole segments and possibly even a whole genome*genome*

DNA Use as EvidenceDNA Use as Evidence

Compare suspect DNA to DNA left at Compare suspect DNA to DNA left at Crime SceneCrime Scene

Exonerate innocent people of a crimeExonerate innocent people of a crime Identify crime and catastrophe victimsIdentify crime and catastrophe victims Family lineages (paternal and maternal Family lineages (paternal and maternal

linkage)linkage) Trace STD’s to rape victim / Track Trace STD’s to rape victim / Track

DiseaseDisease Trace Agricultural products back to a Trace Agricultural products back to a

farmfarm

DNA analysis at this DNA analysis at this point is not 100% point is not 100%

effectiveeffective Identical twins share 100% DNAIdentical twins share 100% DNA

People who are related have similar DNA - People who are related have similar DNA - so we have to be sure that the regions we so we have to be sure that the regions we are coding are large enough to account for are coding are large enough to account for thisthis

Human Mating is not randomHuman Mating is not random

Neither is Violent Crime - most violent Neither is Violent Crime - most violent crime is committed by someone the victim crime is committed by someone the victim knew.knew.