MiR-21 Lowers Blood Pressure in Spontaneous Hypertensive Rats … · 3Department of Cellular and...

DOI: 10.1161/CIRCULATIONAHA.116.023926

1

MiR-21 Lowers Blood Pressure in Spontaneous Hypertensive Rats By

Up-Regulating Mitochondrial Translation

Running title: Li et al.; miR-21 and mitochondria

Huaping Li, MD1; Xiaorong Zhang, PhD2; Feng Wang, MD, PhD1; Ling Zhou, MD1; Zhongwei

Yin, MD1; Jiahui Fan, MD1; Xiang Nie, MD1; Peihua Wang, MD, PhD1; Xiang-Dong Fu, PhD2,3;

Chen Chen, MD, PhD1; Dao Wen Wang, MD, PhD1

1Division of Cardiology, Department of Internal Medicine, Tongji Hospital, Tongji Medical

College, Huazhong University of Science and Technology, Wuhan, China; 2Key Laboratory of

RNA Biology, Institute of Biophysics, Chinese Academy of Sciences, Beijing, China; 3Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla,

CA; Institute of Genomic Medicine, University of California, San Diego, La Jolla, CA

Address for Correspondence: Chen Chen and Dao Wen Wang Division of Cardiology, Department of Internal Medicine Tongji Hospital, Tongji Medical College Huazhong University of Science & Technology 1095# Jiefang Ave. Wuhan 430030, China Tel. & Fax: 86-27-8366-3280 Email: [email protected]; [email protected]

Journal Subject Terms: Basic Science Research

Chen Chen, MD, PhD ; Dao Wen Wang, MD, PhD

1Division of Cardiology, Department of Internal Medicine, Tongji Hospital, Tongji Medical

College, Huazhong University of Science and Technology, Wuhan, China; 2Key Laboratory of

RNRNRNA BiBiBiololologggyy,y Institute of Biophysics, Chinnesse Academy oof Scienenences, Beijing, China;3DDeD pppartment of CeCCelluuulararar andndnd MMMolecccuuularar Medicciiinee, Unnniviviversiitytyty of CCaC lifofoforrniaiaia,, San DiDiDiegegego,,, La JoJoJolllla,

CACC ; Instttititituuuteee oof GGGenommmici Medddiciicininine,e Uniiivvverssittyy ooofff Caliiifooorniaiaia, Sannn DiDiDieegego, La a a JJoJollaaa, CA

by guest on August 21, 2016

http://circ.ahajournals.org/D

ownloaded from

by guest on A

ugust 21, 2016http://circ.ahajournals.org/

Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

by guest on A


Dow

nloaded from



ownloaded from

http://circ.ahajournals.org/






























2

Abstract

Background—Excessive reactive oxygen species (ROS) generated in mitochondria has been implicated as a causal event in hypertensive cardiomyopathy. Multiple recent studies suggest that miRNAs are able to translocate to mitochondria to modulate mitochondrial activities, but the medical significance of such new miRNA function has remained unclear. Here we characterized spontaneous hypertensive rats (SHRs) in comparison with Wistar rats, finding that miR-21 was dramatically induced in SHRs relative to Wistar rats. We designed a series of experiments to determine whether miR-21 is involved in regulating ROS generation in mitochondria, and if so, how induced miR-21 may either contribute to hypertensive cardiomyopathy or represent a compensatory response. Methods—Western blotting was used to compare the expression of key nuclear genome (nDNA)-encoded and mitochondrial genome (mtDNA)-encoded genes involved in ROS production in SHRs and Wistar rats. Bioinformatics was used to predict miRNA targets followed by biochemcial validation using real-time PCR (qRT-PCR) and Ago2 immunoprecipitation. Direct role of miRNA in mitochondria was determined by GW182 dependency, which is required for miRNA to function in the cytoplasm, but not in mitochondria. rAAV9 was used to deliver miRNA mimic to rats via tail vein and blood pressure was monitored with a photoelectric tail-cuff system. Cardiac structure and functions were assessed by echocardiography and catheter manometer system. Results—We observed a marked reduction of mt-Cytb in the heart of SHRs. Down-regulation of mt-Cytb by siRNA in mitochondria recapitulates some key disease features, including elevated ROS production. Computational prediction coupled with biochemical analysis revealed that miR-21 directly targeted mt-Cytb to positively modulate mt-Cytb translation in mitochondria. Circulating miR-21 levels in hypertensive patients were significantly higher than those in controls, showing a positive correlation between miR-21 expression and blood pressure. Remarkably, rAAV-mediated delivery of miR-21 was sufficient to reduce blood pressure and attenuate cardiac hypertrophy in SHRs. Conclusions—Our findings reveal a positive function of miR-21 in mitochondrial translation, which is sufficient to reduce blood pressure and alleviate cardiac hypertrophy in SHRs. This observation indicates that induced miR-21 is part of the compensatory program and suggests a novel theoretical ground for developing miRNA-based therapeutics against hypertension.

Key words: miR-21; mitochondria; cytochrome b; mitochondrial ROS

miRNA mimic to rats via tail vein and blood pressure was monitored with a photoelectric tail-cuff system. Cardiac structure and functions were assessed by eccchohohocacaardrdrdioioiogrgrgrapaphyand catheter manometer system. Results—We observed a marked reduction of mt-Cytb in the heart of SHRs. Down-regulation of mt-Cytb by siRNA in mitochondria recapitulates some key disease features, including elevated ROS prprp odododucucuctit on. CoCoC mputational prediction couplededed with biochemical aaanann lysis revealed that miR-R-R-212121 ddireccctltltlyy y taaargrgrgeted mt-Cytb to positively mooddulate mt-Cytbbb tttransssllation in mitochondria.

ircrcrcuuulating miiiRR-R 212121 levevvelelelsss ininin hhhypypypererertetetenC ssisivvve patieieiennntss wewererere sssigiggnininififf cacaantntntlylyly hhihighg ererer ttthahahannn thththoseee ininin cccononontrtrtrolhowowowing a positiveee corrrrrerelatiiiononon betweenn mmmiR-221 exxppressiononon aaanndnd blololood ppprressssssuuure. Remememarrrkkkably, AAVAVAV-m- ediateeed d d deeelliveeerrry of ff mmim R-211 wwwasass sufficcic eeentt rereredduduce bbloood presssssurrreeetto t and attttteenenuauauate carrdididiac

hyypep rtrtrtrororophphphyy y ininin SHRHHRs.CConcllu isions—OOur fifi dndiings reveall a po isititive ffun tctiion fof miRiR 2-211 iin mititochho dnd iri lal ttransllatition, ff



ownloaded from



3

Clinical Perspective

What Is New?

mtDNA-encoded Cytb is down regulated in spontaneous hypertensive rat (SHR) model

Cytb down-regulation contributes to elevated mitochondrial ROS

miR-21 directly targets Cytb to enhance its translation in mitochondria

Induced miR-21 positively correlates to high blood pressure in human patients

rAAV9-delivered miR-21 mimic is able to lower blood pressure and relieve cardiac

hypertrophy in animal model

What Are the Clinical Implications?

The induction of miR-21 is part of the compensatory program, not cause, in the genetic

animal model for hypertensive cardiomyopathy

Delivery of exogenous miR-21 mimic may be used to treat high blood pressure patients

What Are the Clinical Implications?

ThThTheee inininductttiooion of miR-21 is part of the comomompensatory progrgg ammm,,, not cause, in the genetic

yyy animal modoodel fororor hhhypypypererertetetensnsnsivivive cardiomymyyoppaathyhyhy

Deliveeeryryry ooof exxxoogenouououss miR-R-R-2122 mmmimiccc mmmayy beee uuus ed ttooo treaaatt highhh blololoodoo pressssssururure patiennntss



ownloaded from



4

Hypertension has remained a major public health burden, as it is associated with considerable

morbidity and mortality1. Patients with high blood pressure frequently show abnormalities in

cardiac structure and function, including left ventricular hypertrophy, systolic/diastolic

dysfunction, and in many cases, heart failure2. Despite advances in developing anti-hypertensive

therapies, the number of patients with uncontrolled hypertension continues to rise, thus stressing

the importance of understanding the mechanisms underlying hypertension and hypertensive

cardiomyopathy in order to develop new intervention strategies.

Recent studies have linked mutations in mitochondrial DNA (mt-DNA) to hypertension3, 4,

which has been attributed, at least in part, to increased ROS production5. In fact, elevated ROS

has been implicated in diverse pathologies, such as heart failure, atherosclerosis, diabetes, chronic

kidney disease, and cancer. However, most clinical trials of antioxidants (e.g. vitamin E and

vitamin C) on hypertension have met limited success6. The conundrum might result from

inaccessibility of orally administered antioxidants to sources of free radicals, particularly those

generated by the mitochondria7. Recent results have also attributed AngII-induced hypertension to

increased mt-ROS8. Importantly, while inhibition of mt-ROS by MitoQ showed a measureable

degree of benefit in reducing blood pressure and alleviating cardiac hypertrophy in spontaneous

hypertensive rats (SHRs)9, mitochondria-targeted antioxidants seem relatively inefficient in

scavenging mt-ROS6.

MicroRNAs (miRNAs) are a class of small (~22nt) non-coding RNAs that negatively

regulate gene expression at post-transcriptional levels10. Interestingly, recent data suggest that

miRNAs may also regulate gene expression in a positive fashion11, 12. Early studies have linked

altered miRNA expression to hypertension, atherosclerosis, arrhythmia and fibrosis13. A recent

study indicates that stress-induced nuclear miR-181c compromises mitochondrial translation,

has been implicated in diverse pathologies, such as heart failure, atherosclerosis, dddiaiaiabebebetetees,s,s, ccchrhrhrooonic

kidney disease, and cancer. However, most clinic vitamin E and al trials of antioxidants (e.g.

vitamin C))) on hypertension have met limited success6 The conundrum might result from .

naccccccessibility yy ooof ooorarr lllly yy adadadmimiminininistststerereredede aaantntn ioxidadaantnn ss tto sououourcrcrceseses of ff frfrfreeeeee rradadadici alls,s,s, pppararartititicuc laaarlrlrly y y thththososose

gennenerrrated by thehehe mmmiitoccchhhondddriiiaa7 Recentt rrresultsss hhhavvee alalalsososo aaattttttririribbb. utededed AngggIII--innnduced hhhypypypeeertensiooonnn to

nncrcreaeasesedd mtmt-R-ROSOS8. ImImpoportrtanantltlyy, wwhihilele iinhnhibibititioionn ofof mmtt-R-ROSOS bbyy MiMitotoQQ shshowoweded aa mmeaeasusurereabablele



ownloaded from



5

leading to defective mitochondrial electron transport chain (ETC) function and increased

mt-ROS14. However, the functional consequences have not yet been directly linked to the action

of this miRNA within the mitochondria. Interestingly, another recent report demonstrates that

miR-1, a miRNA specifically induced during myogenesis, is not only efficiently targeted to

mitochondria, but is also able to directly enhance mitochondrial translation15. These studies have

thus raised a new regulatory paradigm for miRNAs to function in mitochondria.

The ETC complexes are well known to be the major source of mt-ROS16. Previous studies

have focused on nuclear-encoded subunits of the ETC and their contributions to mt-ROS

production in the SHR model17, 18. Because mutations in mtDNA have been linked to essential

hypertension, we hypothesized that altered expression of mtDNA-encoded proteins might be

causal to initiation and/or progression of hypertension. In the present study, we identified

down-regulation of mtDNA-encoded Cytb in SHRs, which appears to directly contribute to

increased mt-ROS. We found that miR-21, a key miRNA induced in SHRs, is able to translocate

into mitochondria to counteract mt-Cytb down-regulation, and strikingly, we showed that

exogenous miR-21 delivered by rAAV was sufficient to lower blood pressure in the SHR model,

suggesting a new therapeutic strategy against hypertension.

Methods

All animal studies were conducted with the approval of the Animal Research Committee of Tongji

Medical College, and in accordance with the NIH Guide for the Care and Use of Laboratory

Animals. Patients and controls were enrolled in accordance with the Declaration of Helsinki and

approved by the Ethics Committee of Tongji Hospital. Blood samples were collected via venous

puncture after obtaining written informed consent. Expanded versions of the Methods including

list of antibodies (Supplemental Table 1) and list of PCR primers (Supplemental Table 2) are

hypertension, we hypothesized that mtDNA- altered expression of encoded proteinsnsns mmmigigighththt bbbe e e

causal to initiation and/or progression of hypertension. In the present study, we identified

Cytb in SHRsdown-regggulation of mtDNA-encoded , which appears to directly contribute to

ncrrreaeaeased mt-RRROSOSOS. WeWeWe fffouououndndnd ttthahahat t t mimm R-RR-2122 , a kekekeyy mim RNNNA A A ininindududuceeeddd ininin SHRHH s,,, iiis s s ababablelele to trtrtranananslslslocococataa e

ntooo mmmitochondddririr a too cccoouo nterereraaca t mt-Cyttbbb downnn---regguulatatatioioionnn, aandndnd strrrikkinggglyyy, wwwe showwweeded thhhat

exexogogenenououss mimiR-R-2121 ddeleliviverereded bbyy rArAAVAV wwasas ssufuffificicienentt ttoo lolowewerr blbloooodd prpresessusurere SHSHRR momodedell, iinn ththee



ownloaded from



6

presented in the Online Supplement.

Mitochondria isolation

Mitochondria were isolated using the MACS Mitochondria Extraction Kit from Miltenyi Biotec

GmbH (Bergisch Gladbach, Germany) as described19. Briefly, cells were lysed, and mitochondria

were magnetically captured with anti-TOM22 antibody-coated beads and eluted mitochondria

were collected by centrifugation at 13000g for 2min at 4°C.

Quantification of ROS production

The oxidative fluorescent dye, dihydroethidium (DHE; Invitrogen, Carlsbad, CA) was applied to

frozen, 7 m sections from various organs at 40 mol for 30min. Fluorescence intensity was

measured under a Nikon DXM1200 fluorescence microscope and images were analyzed with the

Image-Pro software (Media Cybernetics, Bethesda, MD).

mt-ROS was measured with MitoSOX™ Red (Invitrogen, Carlsbad, CA) on live cells, as

described20. Briefly, cells were washed three times with PBS. MitoSOX™ Red (diluted to a final

concentration of 5μM) was added to the media and incubated for 30min at 37°C in the dark. After

incubation, cells were trypsinized and washed with ice-cold PBS three times. Mt-ROS was

quantified by flow cytometry (BD Biosciences, CA) with 510nm excitation/580nm emission

filters. Total ROS was quantified using 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA,

Invitrogen, Carlsbad, CA), as described21.

Quantification of the copy number of miR-21 and cytb in the mitochondria

To quantify the levels of Cytb mRNA in the mitochondria, total mitochondrial RNA was reverse

transcribed to cDNA. A standard curve was generated by qPCR using serially diluted Cytb DNA,

which was used to determine the absolute levels of Cytb. miR-21 was similarly quantified in the

mitochondria based on a standard curve generated with serially diluted miR-21 (Riobio Co., Ltd,

measured under a Nikon DXM1200 fluorescence microscope and images were annnalalalyzyzyzededed wwwititith h h thtt e

mage-Pro software (Media Cybernetics, Bethesda, MD).

was measured with mt-ROS MitoSOX™ Red Invitrogen, Carlsbad, CA) on live cells, as( on live cells,

descsccririribed20. BrBrrieieieflflly,yy ccelelellslsls wwwererreee wawawashshsheddd ttthree timimimess wittthh h PBPBPBS.S.S. d dd (d(d(dilii utededed tttooo a a a fififinan lMMMitititoSoSoSOXOXOX™™ ReReReddd

conncncenee tration ofofof 55μMμMM) was aadadded to thehe mediaaa andd incncncubububatatatededed for 3330miiinn attat 3337°C innn ttthehehe dddark. AAAfftf e

nncucubabatitionon, cecellllss wewerere ttryrypspsininizizeded aandnd wwasashehedd wiwithth iicece-c-cololdd PBPBSS ththrereee titimemess. MMt-t-ROROSS wawass



ownloaded from



7

Guangzhou, China). Quantitative analysis of miR-21 in purified mitochondria from cells and

tissues was according to the published procedure15, 22.

Polysome analysis

Mitochondrial polysome profiling on sucrose gradient was carried out as described previously15, 23.

Briefly, mitochondria purified from H9c2 cells were suspended in the lysis buffer on ice for

20min. The lysate was centrifuged at 9,000g for 30min to remove particles, loaded on a 10%-30%

sucrose gradient, and centrifuged at 180,000g for 260min in Beckman SW41-Ti rotor. After

centrifugation, 13 fractions were collected for RNA and protein analysis. Purified mitochondria

were free of cytoplasmic ribosomes, as indicated by the lack of representative cytoplasmic

ribosomal proteins (RPS3 and RPL4) in Western blots. Representative mitochondrial ribosomal

proteins (MRPS27 and MRPL45) on individual gradient fractions were detected by Western

blotting and specific rRNA, mRNA, and miRNA transcripts were quantified by real-time RT-PCR.

The assignment of small and large ribosomal subunits, monosomes, and putative polysomes was

based on the distribution of both rRNAs and ribosomal proteins and comparison with published

mitochondrial polysome profiles. To characterize putative polysomes, the lysate was treated with

5U/ml RNase I for 40min at 25°C to convert polysome to monosome. The relative abundance of

individual transcripts in each fraction was presented as the percentage of the total fraction.

Application of recombinant adeno-associated virus (rAAV) to animals

rAAVs (type 9) containing miR-21, mut-miR-21, anti-miR-21, mut-anti-miR-21 or green

fluorescent protein (GFP) were prepared by triple plasmid co-transfection in HEK293T cells, as

previously described24. Detail information was provided in the Online Expanded Methods.

Statistical analysis

Data were presented as mean ± SEM (n noted in specific figure legends). Student’s t tests and

ibosomal proteins (RPS3 and RPL4) in Western blots. Representative mitochondrdrdriaiaial ll ririribobobosososomamamal

proteins (MRPS27 and MRPL45) on individual gradient fractions were detected by Western

blotting and specific rRNA, mRNA, and miRNA transcripts were quantified by real-time RT-PCR

Theee aaassignmentntnt of f f smsmsmalala l l l ananand d lalalargrgrge e e ririr booososos mal sssubuu ununits,s,s, mmmonononosososommmesss, , ananand dd puutatatatititiveveve pppolysysysomomomeseses wwwas

baseseedd d on the dddisisistttribiibutioioion offf bbboth rRNAAsss and ririribbbossomomomalalal ppprororoteteteinnns ananand cooompmppaararison wwwittth pppublishehehed

mimitotochchonondrdriaiall popolylysosomeme pprorofifileless. TToo chchararacacteteririzeze ppututatativivee popolylysosomemess, tthehe llysysatatee wawass trtreaeatetedd wiwithth



ownloaded from



8

ANOVA with Bonferroni post hoc analysis were performed to determine statistical significance

between different treatment groups. The data of blood pressure in rats over the time course were

statistically analyzed by repeated measured ANOVA. To assess the significance of the correlations,

Spearman's rank correlation coefficient was calculated. In all cases, statistical significance was

defined as p<0.05.

Results

Down-regulation of mitochondrial Cytb linked to increased ROS production in SHR heart

We performed HE staining to detect gross morphological changes and Sirius red staining to detect

fibrosis in various organs of SHRs at the age of 9 months. Compared with other organs, we

observed significant hypertrophy and fibrosis in the heart of SHRs (Figure 1A, B). We therefore

focused on cardiac damage in SHRs.

We detected total superoxide and substantially increased ROS in frozen heart sections of

SHRs compared to Wistar controls (Figure 1C). We next measured the expression of several

representative proteins of the ETC by Western blotting, and consistent with earlier reports17, 18, we

found significant up-regulation of nuclear genome (nDNA)-encoded NDUFA10 (subunit of ETC

I) and UQCRC1 (subunit of ETC III) (Figure 1D, E). Interestingly, we also detected a significant

decrease of mtDNA-encoded ND1 (subunit of ETC I) and Cytb (subunit of ETC III) in SHR

hearts relative to controls, while COI (subunit of ETC IV) remained unaltered (Figure 1D, E).

These data suggest a compromised coordination of nDNA and mtDNA-encoded ETC components

in the heart of SHRs.

By measuring ROS production in other organs, we also found increased ROS in liver,

kidney and aorta of SHRs compared to Wistar controls (Supplemental Figure 1A). We also

fibrosis in various organs of SHRs at the age of 9 months. Compared with other ooorgrgrgananans,s,s, wwwe ee

observed significant hypertrophy and fibrosis in the heart of SHRs (Figure 1A, B). We therefore

focused on cardiac damage in SHRs.

We detttecececteeed dd toootatatalll sususupepeperororoxixixidedede andndnd substttanaa tiiaally yy ininincrcrcreaeaeasess d dd ROROROSSS ininin frooozezezen n n heheheara t sesesectctctioioionsnsns of

SHHRsRsRs compareeed d d tooo WWWisisistar cococontn rols (((Figuguure 1CC)C .. WWee nenenextxtxt mmmeaeassus reeedd d theee eexprprpression oooff seseseveral

eeppprpresesenentatatitiveve pproroteteininss ofof ththee ETETCC byby WWesesteternrn bblolottttiningg, aandnd coconsnsisistetentnt wwitithh eaearlrlieierr rerepoportrtss1717, 18818, wewe



ownloaded from



9

detected decreased expression of Cytb in both liver and kidney in SHRs relative to Wistar controls

(Supplemental Figure 1B-I).

Based on the demonstrated ability of exogenous siRNAs to target mtDNA-encoded

transcripts in the mitochondria (Zhang and Fu, unpublished results), we explored the use of

specific siRNAs against mtDNA-encoded Cytb, ND1 and COI to determine their contributions to

ROS production in H9c2 cells, a rat cell line derived from embryonic heart tissue. We found that

each siRNA treatment led to specific down-regulation of their mitochondrial targets at both the

mRNA (Figure 1F) and protein (Figure 1G, H) levels. Interestingly, siCytb specifically caused

elevated ROS in comparison with siND1 and siCOI (Figure 1I), which is evident from quantified

results (Figure 1J and Supplemental Figure 1J, K). These data indicate a critical role of Cytb in

ROS generation.

Identification of miR-21 involved in the regulation of Cytb expression

Given recently reported roles of miRNAs in mitochondria, we tested the hypothesis that Cytb

down-regulation might be mediated by a specific miRNA in SHRs. We thus employed rnahybrid

software (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html) to search for

potential miRNAs that may specifically target the Cytb transcript. This led to the identification of

miR-21, which showed the potential to target Cytb mRNA in a highly conserved region among

human, rat, and mouse (Figure 2A). More importantly, we found that miR-21 was overexpressed

in the mitochondria of SHR hearts (Figure 2B and Supplemental Figure 2A), which might be

responsible for causing Cytb down-regulation.

To determine the potential effect of miR-21 on Cytb expression, we transfected a miR-21

mimic into H9c2 cells. To demonstrate that transfected miR-21 mimic entered the mitochondria,

we used anti-TOM22 coated microbeads to purify the mitochondria from transfected cells,

esults (Figure 1J and Supplemental Figure 1J, K). These data indicate a critical rororolelele ooof f f CyCyCytbtbtb iiinnn

ROS generation.

dentification of miR-21 involved in the regulation of Cytb expression

Givvevennn recentlyyy rrreppporoo teeed d d rororolelel sss ofofof mmmiRiRiRNANANAs in mmmititi occhhondnddririria,a,a, wwwee tetetesststededed thehehe hypypypototothehehesisisis thhhatatat CCCytytytbb b

downwnwn-regulatiooonnn mimmighhht be mmmeede iated byby aaa speciiifffic mim RNRNRNAAA iinin SSSHRRRss.s Weee tthhususus emploooyyyeddd rrnahybbbrrir d

((hthttptp:/://b/bibibisiserervv.tetechchfafakk.ununi-i-bibielelefefeleldd.dede/r/rnanahyhybrbridid/s/sububmimissssioionn.hthtmlmlooftftwawarere )) toto sseaearcrchh foforr



ownloaded from



10

showing no measurable contamination of cytoplasmic GAPDH mRNA in our preparation (Figure

2C). We next quantified miR-21 in both cytosol and purified mitochondria from transfected cells,

detecting transfected miR-21 in the mitochondria (Figure 2D). By transfecting a miR-21 inhibitor

into the cell, we detected decreased miR-21 in both cytosol and purified mitochondria (Figure 2E).

We made similar observations on both HK2 and HEK293 cells (Supplemental Figure 2B-E).

Contrary to our expectation, we detected a specific increase in the Cytb protein level in

miR-21 mimic-transfected H9c2 cells (Figure 2F). Quantitative analysis based on triplicated

experiments demonstrated increased Cytb protein without change at the mRNA level (Figure 2G,

H). The effect was specific as other subunits of the ETC were unaffected (Figure 2F-H). We did

not observe the converse effect with the miR-21 inhibitor on the expression of the Cytb protein in

transfected H9c2 cells (Figure 2F, G), indicating the limited abundance of endogenous miR-21 in

the mitochondria of H9c2 cells, which we confirmed by measuring the ratio of miR-21 molecules

per Cytb transcript in the mitochondria, showing insignificant amounts of miR-21 in

untransfected cells (Table 1). We made similar observations on multiple other cell types, including

HK2, HEK293 and HUVEC cells (Supplemental Figure 2F-K). These data are reminiscent of the

positive role of miR-1 in mitochondrial translation15, and suggest a protective role of induced

miR-21 as part of the compensatory program in SHRs

MiR-21 directly enhanced Cytb mRNA translation in the mitochondria

To pursue the mechanism underlying miR-21 enhanced mitochondrial translation, we performed

RNA co-immunoprecipitation with anti-Ago2, which has been previously shown to have a

fraction localized in the mitochondria15. We found that Ago2 showed increased association with

the Cytb mRNA after miR-21 transfection (Figure 3A), consistent with miR-21-guided targeting

of the microRNA machinery to Cytb.

not observe the converse effect with the miR-21 inhibitor on the expression of the e e CyCyCytbtbtb ppprororoteteteininin in

ransfected H9c2 cells (Figure 2F, G), indicating the limited abundance of endogenous miR-21 in

he mitochondria of H9c2 cells, which we confirmed by measuring the ratio of miR-21 moleculerr

per r CyCyC tb transcrcrcrippt t t in ttthehehe mmmittococochohohondndndria,aa, showinining ininsigngngnififificicicananant t amamamououountnn sss ofoo mmmiRiRiR-2-2-2111 in

untrtrrananansfected cececelll sss ((Tababable 1).).). We made sssimilarrr ooobseservvvatatatioioionnsns ooonn n mumuulltl ipleee othththere cell tytytypepepesss, incluuuddid ng

HKHK22, HHEKEK292933 anandd HUHUVEVECC cecellllss (S(Supupplplememenentatall FiFigugurere 2F2F-K-K)). TThehesese ddatataa araree reremimininiscscenentt ofof tthehe



ownloaded from



11

To determine how miR-21 might enhance the expression of Cytb at the protein level, we

performed polysome analysis, a gold standard for studying translation. We characterized the

10%-30% sucrose gradient fraction by showing the distribution of representative small and large

mitochondrial ribosomal proteins (MRPS27 and MRPL45) as well as 12S and 16S rRNAs in the

expected fractions (Figure 3B), as reported in the literature15, 23. We detected no contamination of

cytoplasmic ribosomes based on immunoblotting for 18S and 28S ribosomal proteins RPL4 and

RPS3, respectively, in our gradient fractions. We further showed that the putative polysome

fractions near the bottom of the gradient (fractions 12 and 13) could be converted to monosome

by RNase I treatment (Figure 3B). Significantly, by RT-qPCR, we detected increased Cytb mRNA

in the putative polysome fractions (fractions 12 and 13) in response to transfected miR-21 mimic

(Figure 3C) in comparison with the internal CO1 mRNA control (Figure 3D, 3E). These data

suggest that miR-21 directly enhanced Cytb mRNA translation in mitochondria.

To rigorously rule out indirect effects of the miR-21 mimic via cytoplasmic targets, we

performed a diagnostic analysis on the differential requirement for the Ago2 cofactor GW182,

which is required for miRNA effects in the cytoplasm25, but not in mitochondria18. As expected,

GW182 knockdown prevented miR-21 mediated translational repression of its cytoplasmic target

PTEN (Figure 3F-H)26. Under these conditions, GW182 RNAi-treated H9c2 cells continued to

show enhanced Cytb translation by the miR-21 mimic (Figure 3F-H). The same results were also

obtained in transfected HK2 and HEK293 cells (Supplemental Figure 3A-F). Together, these data

strongly suggest a direct role of miR-21 in enhancing Cytb translation in mitochondria.

The ability of transfected miR-21 mimic to quench ROS

To determine the functional consequence of the transfected miR-21 mimic, we used MitoSOX™

Red to monitor mitochondrial ROS production. This reagent rapidly and selectively targets

n the putative polysome fractions (fractions 12 and 13) in response to transfecteddd mmmiRiRiR-2-2-2111 mimimimimm c

Figure 3C) in comparison with the internal CO1 mRNA control (Figure 3D, 3E). These data

uggest that miR-21 directly enhanced Cytb mRNA translation in mitochondria.

To rigorororouououslslsly rururulelele oooututt iiindndndiririrecece t eeeffff ects ooof ff thhee miiiR-R-R-212121 mmmimmmicicic vvviai cccytopopoplalalasmsmsmicicic tararrgegegetststs,, wewewe t

perfrfrfoorormed a diiiagagagnonnostiiic analylylysis on the dddifferennntttiall rreqeqquiuiuirererememeenntn fororor the AAgogogo222 cofactctctooor GGGW18222,

whwhicichh isis rreqequiuireredd foforr mimiRNRNAA efeffefectctss inin tthehe ccytytopoplalasmsm22525, bubutt nonott inin mmititocochohondndririaa181818. AsAs eexpxpecectetedd,



ownloaded from



12

mitochondria in live cells, which can be oxidized by superoxide but not by other ROS- or reactive

nitrogen species (RNS)-generating systems. We found that the transfected miR-21 mimic had no

significant impact on mt-ROS in H9c2 cells (Figure 4A), nor in HK2 and HEK293 cells

(Supplemental Figure 4A, B). mt-ROS could be induced with either siCytb or Antimycin A

(inhibitor of electron transfer at ETC III) (Figure 4B) and siCytb was unable to further elevate

mt-ROS in cells treated with Antimycin A (Figure 4B). Under these conditions, we found that the

transfected miR-21 mimic was able to suppress siCytb induced-, but not Antimycin A-elevated,

mt-ROS (Figure 4C and 4D).

These data indicated that the protective effect conferred by miR-21 via increased Cytb was

dependent on electron transfer at ETC III, suggesting that the unbalanced composition in the ETC

III complex interfered with its normal function, leading to increased mt-ROS. Total ROS detected

by DCFH-DA showed a similar trend as mt-ROS under similar conditions (Figure 4E and 4F). We

obtained the same results in HK2 and HEK293 cells (Supplemental Figure 4C-F). We further

confirmed that miR-21 was able to counteract siCytb induced mt-ROS by upregulating Cytb at the

protein level (Figure 4G and 4H). Together, these data support a model in which increased

mt-ROS is induced by siCytb and suppressed by miR-21 (Figure 4I).

Blood pressure reduction by short-term rAAV-miR-21 treatment

To investigate the functional relevance of our molecular findings, we characterized clinical

characteristics among patients with hypertension in comparison with control subjects

(Supplemental Table 3). Except for blood pressure, there were no significant differences in age,

sex, BMI, levels of fasting glucose and lipids and other biochemical parameters among the two

comparison groups. However, hypertensive patients showed significant higher levels of

circulating miR-21 than healthy controls (Figure 5A). We thus further investigated the

dependent on electron transfer at ETC III, suggesting that the unbalanced composssitititioioionnn ininin ttthehehe EEETCT

II complex interfered with its normal function, leading to increased mt-ROS. Total ROS detected

by DCFH-DA showed a similar trend as mt-ROS under similar conditions (Figure 4E and 4F). We

obtaataininined the samamame e rerr suuultltltsss ininin HHHK2K2K2 aaandnn HHHEKE 29333 ceeellls (SSSupupupplplplemememenenentatatalll FiFF gugugure 444C-C-C-F)F)F). Weee fffurururthththererer

confnfnfiririrmed thattt mmmiRRR-211 was aabable to couuntntteract siiiCyyttb iiindndnducucucededed mmmt--RRROS bby upupupregulaaatititingngng CCCytb aaat the

prprototeieinn lelevevell (F(Figigururee 4G4G aandnd 44H)H). ToTogegeththerer, ththesesee dadatata ssupuppoportrt aa mmododelel iinn whwhicichh inincrcreaeasesedd



ownloaded from



13

relationship between plasma miR-21 concentrations and blood pressure levels among all

participants, finding that the plasma levels of miR-21 were positively correlated with the levels of

either systolic or diastolic blood pressure (Figure 5B, C). These findings suggest a potential role

of increased miR-21 as part of the compensatory program in hypertensive patients in light of our

findings in SHRs.

We next employed the SHR model to determine whether miR-21 could reduce blood

pressure and alleviate cardiac hypertrophy by using rAAV to deliver miR-21 into the animal. We

first monitored potential short-term effects of miR-21 treatment on blood pressure and cardiac

hypertrophy. Eight-week-old male SHRs were divided into 6 groups (n=10 in each), each treated

with NS (control saline), rAAV-GFP, rAAV-miR-21, rAAV-mut-miR-21, rAAV-anti-miR-21 or

rAAV-mut-anti-miR-21 for 4 weeks. The blood pressure among various groups of SHRs showed

no significant differences before rAAV delivery (Figure 5D). After one month treatment,

rAAV-miR-21 significantly reduced systolic blood pressure measured either by tail-cuff or

hemodynamic detection in SHRs, and in contrast, rAAV-anti-miR-21 showed no obvious effect

(Figure 5E and 5F).

We confirmed increased miR-21 in hearts of rAAV-miR-21 treated SHRs by RT-PCR (Figure

5G), and upregulated Cytb by Western blot (Figure 5H-K). Importantly, DHE detected decreased

ROS only in rAAV-miR-21 treated SHRs (Figure 5L, M). We observed no significant difference

in cardiac function and morphology among various groups of SHRs (Table 2 and Figure 5N, O).

To search for potential organs that may contribute to elevated blood pressure, we

examined several organs, particularly liver and kidney, the latter of which has recently been linked

to hypertension27, 28. Although lung is known to contribute to pulmonary hypertension, we did

not detect any differences in morphology, miR-21 levels, and expression of representative n-DNA

with NNS (control saline), rAAV-GFP, rAAV-miR-21, rAAV-mut-miR-21, rAAV-antntnti-i-i-mmimiR-R-R-212121 ooorrr

AAV-mut-anti-miR-21 for 4 weeks. The blood pressure among various groups of SHRs showed

no significant differences before rAAV deliv Figure 5Dery ( ). After one month treatment,

sisisignnnifii icccananantltltly y y d d syyystststolic bblololoAAVAVAV-miR-21 rereedududucececeddd oddd preessssssururure e e mememeasasasurururededed eeeitii her r r bybyby tttaiaiail-l cuuuffffff ooor r r

hemomomodynamic deded teeecctiooonn n in SSSHHRH s, and iinnn contrrarast, 21 d no eff t rrAAVAVAV a-a-antntnti-ii mmim R-R-R-21 ssshhowewewed no ooobvbvbvioouuus effececect

FFigigururee 5E5E aandnd 55F)F).



ownloaded from



14

and mt-DNA encoded mitochondrial proteins between Wistar and SHR (Supplemental Figure 5).

We thus excluded lung from further analysis. Strikingly, we detected increased miR-21, elevated

Cytb protein, and decreased ROS in liver and kidney, but not aorta, in rAAV-miR-21 treated SHRs

(Figure 6A-I). Somewhat unexpectedly, we did not detect the effect of miR-21 inhibitor in

increasing the blood pressure in SHRs as anticipated by inhibiting the compensatory program,

despite the ability of rAAV-anti-miR-21 decrease the expression of miR-21 in various organs

(Figure 6A, B).

Together, our data indicate that exogenous miR-21 is able to counteract the disease state,

but reduction of endogenous miR-21 by antagomir is insufficient to alter the phenotype in the

established disease state, at least in the treatment window we studied (see further in Discussion).

Cardiac hypertrophy alleviated by long-term rAAV-miR-21 treatment

We next measured the effects of chronic miR-21 treatment on blood pressure and cardiac

hypertrophy. Eight-week-old male SHRs were divided into three groups (n=5 in each), each

treated with rAAV-GFP, rAAV-miR-21, and rAAV-mut-miR-21 for 28 weeks. We found that

rAAV-miR-21, but not rAAV-GFP or rAAV-mut-miR-21, could indeed significantly lower systolic

blood pressure in SHRs (Figure 7A). We achieved ~20 mmHg reduction in blood pressure after

four weeks of rAAV-miR-21 treatment, which was maintained throughout the remaining study

period (Figure 7A).

By week 36, hemodynamic variables of SHRs were measured by a catheter tip manometer

advanced from the right carotid artery into the LV. We found that rAAV-miR-21 was still able to

significantly reduce peak systolic blood pressure in SHRs (Figure 7B). We further characterized

hemodynamic and echocardiographic variables in the SHR model. Although we found no

difference in cardiac performance (dp/dtmax and dp/dtmin) among three rAAV treatment groups, the

established disease state, at least in the treatment window we studied (see further ininin DDDisisiscucucussssssioioion)nn . d

Cardiac hypertrophy alleviated by long-term rAAV-miR-21 treatment

We next measured the effects of chronic miR-21 treatment on blood pressure and cardiac

hypepeperrrtrophy. EEEigigighththt-w- eeeeeek-k-k-ololold d mamamalelele SSSHRRRs s wereee dddivviddded d d ininintototo ttthrhh eeeeee gggrororoupupups ss (n=5=5=5 iiin n n eaeaeach),),), eeeacacach h h

reaaateteed with rAAAAAAVVV-GFGFFPPP, rAAAAVV-V miR-21, and rAAAAAAVV-mumuut-t-t-mimimiR-R-R-2212 ffororor 28 wweekekeks. We fofofoununnddd that

AAAVAV-m-miRiR-2-211, bbutut nnotot rrAAAAV-V-GFGFPP oror rrAAAAV-V-mumut-t-mimiR-R-2121, ssigigninifificacantntlyly rr ssysystotolilicccocoululdd inindedeeded yy llowowerer



ownloaded from



15

interventricular septum thickness in end-diastolic (IVSTs) and end-systolic (IVSTd) of the left

ventricle decreased significantly in SHRs treated with rAAV-miR-21, but not rAAV-mut-miR-21

(Table 3). Neither body weight (data not shown) nor heart rate was affected, but cardiac mass

index was clearly reduced in SHRs treated with rAAV-miR-21 (Figure 7C).

HE staining of myocardial tissue sections showed that rAAV-miR-21 treatment

significantly reduced the size of the cardiac myocytes in SHRs (Figure 7D, E). Furthermore,

microscopic analysis after Sirius Red staining to detect myocardial fibrosis and matrix

proliferation showed that the red-stained area of cardiac tissues was significantly decreased in

rAAV-miR-21 treated animals compared to other groups (Figure 7D, F). We also performed DHE

staining and Western blotting, observing decreased levels of ROS (Figure 7D, G). Consistently,

BNP, an indicator for cardiac hypertrophy, was significantly reduced in SHRs treated with

rAAV-miR-21 (Figure 7H). RT-PCR revealed increased miR-21 both in the cytosol and

mitochondria (Supplemental Figure 6A, B) and Western blot showed increased Cytb protein in the

heart of rAAV-miR-21 treated SHRs (Figure 7I, J). Among other organs, we found that the

expression of miR-21 and Cytb were also increased only in liver and kidney, which was

accompanied with decreased ROS (Supplemental Figure 6C-O). Together, these data

demonstrated significant benefits of in vivo delivered miR-21 in the improvement of

pathophysiology of this hypertensive animal model.

Discussion

In the present study, we observed down-regulation of the mitochondrial genome-encoded Cytb in

SHRs, which appears to directly contribute to increased mt-ROS. We found that miR-21 was able

to translocate into the mitochondria to counteract mt-Cytb down-regulation, likely as part of the

taining and Western blotting, observing decreased levels of ROS (Figure 7D, G). CoCoConsnsnsisisistetetentntntlylyly,

BNP, an indicator for cardiac hypertrophy, was significantly reduced in SHRs treated with

AAV-miR-21 (Figure 7H). RT-PCR revealed increased miR-21 both in the cytosol and d

mitototocchchondria (((SSSupppppplememementntntalaa FFFigigigururureee 6AAA, B) anddd WWessterrrnnn blblblototot ssshooowewewed d d innncrcc easesesed d d CyCyCytbtt pprororoteteteininin iiin nn the

heararart t t of rAAV-V--mimm R-RR-2111 ttreattteddd SHRs (FFiigure 77I7 ,,, J)). AmAmmonononggg otoo hheh r ooro gansnns, wewewe founddd ttthahahat the

exexprpresessisionon ooff mimiR-R-2121 aandnd CCytytbb wewerere aalslsoo inincrcreaeasesedd ononlyly iinn liliveverr anandd kikidndneyey, whwhicichh wawass



ownloaded from



16

compensatory program to hypertension. Strikingly, we showed that delivery of exogenous miR-21

by rAAV9 was sufficient to lower blood pressure in the SHR model, suggesting a new therapeutic

strategy against hypertension.

In the cardiovascular system, Complex I and Complex III of the ETC are the major sites

for ROS production29, 30. In fact, multiple studies suggest that Complex III is more important than

Complex I in generating mt-ROS in the heart30-32. Consistent with these reports, we found that

siRNA-mediated silencing of Cytb, which is the only mtDNA-encoded subunit of Complex III,

caused elevated ROS. In contrast, siRNAs against ND1 (Complex I) and COI (Complex IV) did

not elevate ROS. Given that previous studies failed to induce ROS by down-regulating nuclear

genome-encoded subunits of Complex III33, 34, our data suggest a more crucial role for the

mtDNA-encoded subunit in dictating the functional state of ETC III in mitochondria.

It has been widely accepted that miRNAs negatively regulate gene expression at the

post-transcriptional levels in the cytoplasm35. Considering the fact that miR-21 was up regulated,

we initially thought that such induced miR-21 might positively contribute to hypertension in the

SHR model. Unexpectedly, our data suggest that miR-21 is part of the compensatory program to

counteract Cytb down-regulation by enhancing Cytb translation in mitochondria. Notably, these

data are consistent with the recent report by Zhang et al., showing miR-1 enhanced mitochondrial

translation during C2C12 differentiation15. This study also established the requirement for

GW182 in the negative effects of microRNA in the cytoplasm, but not for their positive effects in

mitochondria, which indicates direct microRNA actions in mitochondria. Using this criterion,

we showed that miR-21 directly acts on Cytb to enhance its translation in mitochondria.

It has been reported previously that both damaged and enhanced respiratory chain

activities are able to induce considerable amounts of ROS36, 37. Similarly, we showed that only

genome-encoded subunits of Complex III33, 34, our data suggest a more crucial rolelele fffororor ttthehehe

mtDNA-encoded subunit in dictating the functional state of ETC III in mitochondria.

It has been widely accepted that miRNAs negatively regulate gene expression at the

poststst-t-t-transcriptititiooonalalal levevevelelelsss inini ttthehehe cccytytytopo lalalasm35. CoCC nsnsidererrinining gg thththe ee fafafacctct ttthahh t t t mimm R-R-R-212121 wwwasaa uppp rereregugugulalalatett d

we iinnin tially thooouuughthht thahahat suchchch induced mimm R-21 mmmigghht pppososositititiiviveleelyy cononontribbbuutee e ttoto hyperrrteeennnsiiion in thheh

SHSHRR momodedell. UUnenexpxpecectetedldlyy, oourur ddatataa tthahatt mimiR-R-2121 iiss papartrt ooffssuguggegeststaa tthehe ccomompepensnsatatororyy prprogograramm toto ff



ownloaded from



17

when the respiratory chain is in its normal state, ROS production is set at its lowest point

(maintained at physiological level). Hypertension decreased Cytb expression, impaired ETC III

complex function, and increased electron leakage, which eventually led to elevated ROS

production. In accordance, miR-21 restored Cytb to normal levels, thus decreasing ROS.

Consistent with our findings, it has been reported in HCA cells that both catalase and gp91ds-tat

inhibited bradykinin-induced ROS, but showed no effect on ROS under normal conditions38.

Overall, various compensatory mechanisms may help maintain ROS under normal physiological

conditions, but under certain pathophysiological conditions, such a homeostatic program may be

compromised, leading to elevated ROS production.

Strikingly, we found that exogenous miR-21 delivered by rAAV was sufficient to lower

blood pressure in the SHR model. We note a previous report by Kaeppel et al. suggesting the

ability of rAAV to directly integrate into mt-DNA39. Whether rAAV was inserted into the

mitochondrial genome along with miR-21 in our system remains to be investigated. A concern

regarding viral vectors is their potential toxicity. To address this, we measured liver function,

kidney function, and morphology of liver and kidney at the end of the experiment (Supplemental

Figure 7). Our results showed no evidence for liver and kidney toxicity, which implies that the

rAAV9 was nontoxic, although we could not completely rule out potential off-target effects of

rAAV in the current study.

MiR-21 has been extensively studied in cardiovascular diseases. Consistent with our

findings, miR-21 has been reported to have a protective role in I/R by reducing cardiomyocyte

apoptosis through targeting the PDCD4 mRNA40. Furthermore, in vivo silencing of miR-21 using

a specific antagomir has been found to reduce cardiac fibrosis and cardiac dysfunction in pressure

overloaded heart41. Our present work demonstrated that miR-21 delivered by rAAV9, which is

Strikingly, we found that exogenous miR-21 delivered by rAAV was sufficiccieieientntnt tttoo o lololowewewerrr

SHR model. Weblood pressure in the note a previous report by Kaeppel et al. suggesting the

ability of rAAV to directly integrate into mt-DNA39. Whether rAAV was inserted into the

mitototocchchondrial l ggegenononomemee aaalololongngng wwwititith h h mimm R-RR-2122 in ououour sysystememem rrremememaiaa nsnsns to oo bebb iiinvnn esesestititigagagateteted.dd AAA ccconononcececernrnrn

liveeer fuuunnnction,,egagaarrdrding viralll vvvectcctorss is thhheiiri potentiaal toxicittityyy. TToo adadaddrdrdresesess s thththis, wwew mmmeasususurrred

kikidndneyey ffununctctioionn, aandnd mmororphpholologogyy ofof lliviverer aandnd kkididneneyy aatt ththee enendd ofof tthehe eexpxpererimimenentt (S(Supupplplememenentatall



ownloaded from



18

predominantly expressed in cardiomyocytes rather than cardiac fibroblasts42, 43, not only reduced

hypertension, but also improved hypertensive hypertrophy and cardiac fibrosis in SHRs. It is

important to point out that besides cardiomyocytes, rAAV delivered miR-21 also targets other

organs, such as kidney and liver, which may collectively contribute to the observed reduction of

blood pressure, consistent with a recent report linking kidney to hypertension27, 28. Importantly,

our data showed that rAAV did not infect the aorta, implying that inhibition of ROS production in

aorta may be a consequence, but not a cause of lowered blood pressure. These possibilities are

intriguing subjects for future studies to understand complex and coordinated regulation of

hypertension in mammals.

Another interesting issue is that a miR-21 mimic could induce Cytb, but miR-21 inhibitor

showed no effect both in vitro and in vivo. This is likely due to low abundance of miR-21 in the

mitochondria under normal physiological conditions, as observed earlier44. Even under

pathological conditions, we did not record the effect of miR-21 inhibitor on exacerbating the

hypertensive phenotype. We reason that induced miR-21 is likely part of the compensatory

program, but the endogenous miR-21, although clearly induced in SHRs, may not have reached a

sufficient threshold to antagonize an already established disease state in the animal model.

Consequently, the miR-21 inhibitor showed no measurable effect in worsening the disease

phenotype. Additionally, lowering miR-21 may require extended periods of time to alter the

disease state to a measurable degree. It is also possible that induced miR-21 is only part of the

proposed compensatory program in SHRs such that inhibition of miR-21 alone was insufficient to

alter the program.

In summary, our findings reveal a positive function of miR-21 in mitochondrial translation,

and its systemic delivery to animals is sufficient to reduce blood pressure and suppress cardiac

miR-21 Another interesting issue is that a mimic could induce Cytb, but mmmiRiRiR-2-2-2111 inininhihihibibibitot r

howed no effect both in vitro and in vivo. This is likely due to low abundance of miR-21 in the

mitochondria under normal physiological conditions, as observed earlier44. Even under

pathhhoolological cononondiiitititionnns,s,s, wwwe ee dididid d d nononottt rrecccororo d the e efee feecct oof f f mimimiR-R-R-2122ttt iiinhnhnhibibibitttororor on n n exexexacacacerererbatititingngng ttthehehe

hyppepertrr ensive ppphehehenonnotypepepe. WeWee rreason thatat induccceddd mmiRiRR-2-2-2111 isisis lllikikikelyyy ppap rt of thththe e compppennnsasasatttory

prprogograramm, bbutut tthehe eendndogogenenououss mimiR-R-2121, alalththououghgh ccleleararlyly iindnducuceded iinn SHSHRsRs, mamayy nonott hahaveve rreaeachcheded aa



ownloaded from



19

hypertrophy in SHRs. These observations provide a theoretical basis for developing

miRNA-based therapeutics against hypertension and associated diseases.

Acknowledgments: We thank colleagues in Dr. Wang’s group for various technical help and

stimulating discussion during the course of this investigation.

Funding Sources: This work was supported by grants from the National Natural Science

Foundation of China [Nos. 91439203, 91440102 and 31571197] and the 973 program of the

Ministry of Science and Technology of China [No. 2012CB517800].

Conflict of Interest Disclosures: None.

References

1. Drazner MH. The progression of hypertensive heart disease. Circulation. 2011;123:327-334. 2. Lip GY, Felmeden DC, Li-Saw-Hee FL and Beevers DG. Hypertensive heart disease. A complex syndrome or a hypertensive 'cardiomyopathy'? Eur Heart J. 2000;21:1653-1665. 3. Teng L, Zheng J, Leng J and Ding Y. Clinical and molecular characterization of a Han Chinese family with high penetrance of essential hypertension. Mitochondrial DNA. 2012;23:461-465. 4. Nikitin AG, Lavrikova EY and Chistiakov DA. The heteroplasmic 15059G>A mutation in the mitochondrial cytochrome b gene and essential hypertension in type 2 diabetes. DiabetesMetab Syndr. 2012;6:150-156. 5. Ding Y, Xia B, Yu J, Leng J and Huang J. Mitochondrial DNA mutations and essential hypertension (Review). Int J Mol Med. 2013;32:768-774. 6. Touyz RM. Reactive oxygen species, vascular oxidative stress, and redox signaling in hypertension: what is the clinical significance? Hypertension. 2004;44:248-252. 7. Li X, Fang P, Mai J, Choi ET, Wang H and Yang XF. Targeting mitochondrial reactive oxygen species as novel therapy for inflammatory diseases and cancers. J Hematol Oncol. 2013;6:19. 8. Dikalova AE, Bikineyeva AT, Budzyn K, Nazarewicz RR, McCann L, Lewis W, Harrison DG and Dikalov SI. Therapeutic targeting of mitochondrial superoxide in hypertension. Circ Res. 2010;107:106-116.

References

1. Drazner MH. The progression of hypertensive heart disease. Circulation. 201111;1;1;1232323:33272727-3-3-33444.2. Lip GY,YY Feleelmemeedededenn n DCDCDC,, LiLiLi-S-S-Sawawa -HHHee FLL anndd BeBeeevevevererrss s DGDGD . HyHHypepeperttennnsisisiveveve hhheaeaeartrr dddissseaeaeasesese... A AAcompmpmplex syndrororommme orr aa a hypepeperrtensive 'cacaardiomymyyoppaathyyy'??? EuEuEur r r HHeH aartt t J. 202200000;;;21:165535 -1- 6665. JJ3. Teng g L,L,L, ZZhehhenggg JJJ, Leeengngng J andndd DDDinining g Y. CCCllliniiccall aaand mmoloolece uuulaara chahharacaccteteterizatitiiononon ooofff a Hannn ChChChinininesseseee famimimilylyly wwiiith hh hhhighghgh pppeneneeetrannnccece oofff ese seennntttialalal hhhypypypererertensssioioionnn. MiMiMitochchchonono drdriaiaial DNNNAA. 2012 23 461 465



ownloaded from



20

9. Graham D, Huynh NN, Hamilton CA, Beattie E, Smith RA, Cocheme HM, Murphy MP and Dominiczak AF. Mitochondria-targeted antioxidant MitoQ10 improves endothelial function and attenuates cardiac hypertrophy. Hypertension. 2009;54:322-328. 10. Thomson DW, Bracken CP and Goodall GJ. Experimental strategies for microRNA target identification. Nucleic Acids Res. 2011;39:6845-6853. 11. Orom UA, Nielsen FC and Lund AH. MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. Mol Cell. 2008;30:460-471. 12. Vasudevan S and Steitz JA. AU-rich-element-mediated upregulation of translation by FXR1 and Argonaute 2. Cell. 2007;128:1105-1118. 13. Small EM, Frost RJ and Olson EN. MicroRNAs add a new dimension to cardiovascular disease. Circulation. 2010;121:1022-1032. 14. Das S, Ferlito M, Kent OA, Fox-Talbot K, Wang R, Liu D, Raghavachari N, Yang Y, Wheelan SJ, Murphy E and Steenbergen C. Nuclear miRNA regulates the mitochondrial genome in the heart. Circ Res. 2012;110:1596-1603. 15. Zhang X, Zuo X, Yang B, Li Z, Xue Y, Zhou Y, Huang J, Zhao X, Zhou J, Yan Y, Zhang H, Guo P, Sun H, Guo L, Zhang Y and Fu XD. MicroRNA directly enhances mitochondrial translation during muscle differentiation. Cell. 2014;158:607-619. 16. Zhang DX and Gutterman DD. Mitochondrial reactive oxygen species-mediated signaling in endothelial cells. Am J Physiol Heart Circ Physiol. 2007;292:H2023-2031. 17. Meng C, Jin X, Xia L, Shen SM, Wang XL, Cai J, Chen GQ, Wang LS and Fang NY. Alterations of mitochondrial enzymes contribute to cardiac hypertrophy before hypertension development in spontaneously hypertensive rats. J Proteome Res. 2009;8:2463-2475. 18. Jullig M, Hickey AJ, Chai CC, Skea GL, Middleditch MJ, Costa S, Choong SY, Philips AR and Cooper GJ. Is the failing heart out of fuel or a worn engine running rich? A study of mitochondria in old spontaneously hypertensive rats. Proteomics. 2008;8:2556-2572. 19. Barrey E, Saint-Auret G, Bonnamy B, Damas D, Boyer O and Gidrol X. Pre-microRNA and mature microRNA in human mitochondria. PLoS One. 2011;6:e20220. 20. Mukhopadhyay P, Rajesh M, Hasko G, Hawkins BJ, Madesh M and Pacher P. Simultaneous detection of apoptosis and mitochondrial superoxide production in live cells by flow cytometry and confocal microscopy. Nat Protoc. 2007;2:2295-2301. 21. Yang S, Chen C, Wang H, Rao X, Wang F, Duan Q, Chen F, Long G, Gong W, Zou MH and Wang DW. Protective effects of Acyl-coA thioesterase 1 on diabetic heart via PPARalpha/PGC1alpha signaling. PLoS One. 2012;7:e50376. 22. Lu J and Tsourkas A. Imaging individual microRNAs in single mammalian cells in situ. Nucleic Acids Res. 2009;37:e100. 23. Antonicka H, Sasarman F, Nishimura T, Paupe V and Shoubridge EA. The mitochondrial RNA-binding protein GRSF1 localizes to RNA granules and is required for posttranscriptional mitochondrial gene expression. Cell Metab. 2013;17:386-398. 24. Xie J, Xie Q, Zhang H, Ameres SL, Hung JH, Su Q, He R, Mu X, Seher Ahmed S, Park S, Kato H, Li C, Mueller C, Mello CC, Weng Z, Flotte TR, Zamore PD and Gao G.

Guo P, Sun H, Guo L, Zhang Y and Fu XD. MicroRNA directly enhances mitochondddrir al ranslation during muscle differentiation. Cell. 2014;158:607-619.

16. Zhang DX and Gutterman DD. Mitochondrial reactive oxygen species-medididiatatatededd sssigigignananalililingngngn endothelial cells. Am J Physiol Heart Circ Physiol. 2007;292:H2023-2031.

17. Meng C, Jin X, Xia L, Shen SM, Wang XL, Cai J, Chen GQ, Wang LS and Fang NY. Alteraraatititionononsss ofofof mmitococochondrial enzymes contribute tttoo o cardiac hypertrrtrorr phhhyy y before hypertension devevevelololopment ininin spopopontanananeoeoeousuu lylyly hhhypypyperee tensnsn ive raaatststs. JJ PPrototteoeoeomememe Reseses. 2020200999;8;; :24646463-3-3-24242475.18.. Jullig M, HiHHickkkeyeyy AJ,J,J, CCChai CCCCCC, SSSkea GGLLL, MMiddldldleditchhh MMJJJ, CCostatta SSS, CCChoongngng SY,Y,Y, PPhiliiipspsps ARRR aaandnn Coopeeer GGGJ.. Isss ttthe fffaiaiailing heaeaeartt ooout of fufufuel oor aaa wowoworn enngn innneee runnnnningngng rich? AAA stututudy of rmitochchchononondrdrdriaiaia iiinn ollldd sppspooontaneeeouououslslsly y y hyhyh pepepertrtrtenenensisisiveveve ratats. PrPrProtototeoeoeomimimicsc ... 2020200888;;8:2225555556-6-6 2525257772. 1919. BBarrey EE, SSaiint-AAuret GG, BBonnamy BB, DDamas DD, BBoyer OO a dnd GGididroll XX. PPre-miicroRNRNAA



ownloaded from



21

MicroRNA-regulated, systemically delivered rAAV9: a step closer to CNS-restricted transgene expression. Mol Ther. 2011;19:526-535. 25. Eulalio A, Huntzinger E and Izaurralde E. GW182 interaction with Argonaute is essential for miRNA-mediated translational repression and mRNA decay. Nat Struct Mol Biol. 2008;15:346-353. 26. Wu XT and Li XL. miR-21 Contributes to Cardiac Aging by Targeting PTEN. J Am Coll Cardiol. 2015;66:C4-C4. 27. Cuevas S, Zhang YR, Yang Y, Escano C, Asico L, Jones JE, Armando I and Jose PA. Role of Renal DJ-1 in the Pathogenesis of Hypertension Associated With Increased Reactive Oxygen Species Production. Hypertension. 2012;59:446-452. 28. Brezniceanu ML, Liu F, Wei CC, Chenier I, Godin N, Zhang SL, Filep JG, Ingelfinger JR and Chan JSD. Attenuation of interstitial fibrosis and tubular apoptosis in db/db transgenic mice overexpressing catalase in renal proximal tubular cells. Diabetes. 2008;57:451-459. 29. Murphy E and Steenbergen C. Preconditioning: the mitochondrial connection. Annu Rev Physiol. 2007;69:51-67. 30. Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL and Lesnefsky EJ. Production of reactive oxygen species by mitochondria: central role of complex III. J Biol Chem. 2003;278:36027-36031. 31. St-Pierre J, Buckingham JA, Roebuck SJ and Brand MD. Topology of superoxide production from different sites in the mitochondrial electron transport chain. J Biol Chem. 2002;277:44784-44790. 32. Demin OV, Kholodenko BN and Skulachev VP. A model of O2.-generation in the complex III of the electron transport chain. Mol Cell Biochem. 1998;184:21-33. 33. Aguilera-Aguirre L, Bacsi A, Saavedra-Molina A, Kurosky A, Sur S and Boldogh I. Mitochondrial dysfunction increases allergic airway inflammation. J Immunol. 2009;183:5379-5387. 34. Korde AS, Yadav VR, Zheng YM and Wang YX. Primary role of mitochondrial Rieske iron-sulfur protein in hypoxic ROS production in pulmonary artery myocytes. Free Radic Biol Med. 2011;50:945-952. 35. Vasudevan S, Tong Y and Steitz JA. Switching from repression to activation: microRNAs can up-regulate translation. Science. 2007;318:1931-1934. 36. Tsutsui H, Kinugawa S and Matsushima S. Mitochondrial oxidative stress and dysfunction in myocardial remodelling. Cardiovasc Res. 2009;81:449-456. 37. Finkel T. Cell biology - A clean energy programme. Nature. 2006;444:151-152. 38. Larsen BT, Bubolz AH, Mendoza SA, Pritchard KA, Jr. and Gutterman DD. Bradykinin-induced dilation of human coronary arterioles requires NADPH oxidase-derived reactive oxygen species. Arterioscler Thromb Vasc Biol. 2009;29:739-745. 39. Kaeppel C, Beattie SG, Fronza R, van Logtenstein R, Salmon F, Schmidt S, Wolf S, Nowrouzi A, Glimm H, von Kalle C, Petry H, Gaudet D and Schmidt M. A largely random AAV integration profile after LPLD gene therapy. Nat Med. 2013;19:889-891.

30. Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL and Lesnefsky EJ. Productioon nn of reactiveoxygen species by mitochondria: central role of complex III. J Biol Chem. 2003;278:36027-36031.31. St-Pierre J, Buckingham JA, Roebuck SJ and Brand MD. Topology of superoxide production from different sites in the mitochondrial electron transport chain. J Biol Chem.2002;2;2;2777777:4:4:44747478488 -4444744 90.32. Demin nn OVOVOV, KhKhKholoo odododenee kokoko BBBN NN annnd d d Skulacacacheh v v VP... AAA momomodeeelll ofofof OOO2...-g-generereratatatioioion nn in ttthehehe cccomomomplpp exII offf the electron trrannnsppport chchchain. MoMoMol CCCell Biiochemem. 1191998;11;18884:2221-33.

33. Aguileeerarara-A-AAgguiiirrrre L,, , BBaB csi A,A,A, SSaaavedraa-a-Mololinnna a a AAA, KKKurururoskykyky A, Surr r SSS and BoBoBoldldldogogogh I. Mitochchchononondrdrdriaiaialll ddyysfssfununctctction ininncrcrcreaeaeasesesesss allllelelergrgrgicicic aaairrrway y y inininflflflamamammamamatitit ononn. J JJ Immmmuuunononolll.20200909 1;18383 5:5373799-53538787.



ownloaded from



22

40. Qin Y, Yu Y, Dong H, Bian X, Guo X and Dong S. MicroRNA 21 inhibits left ventricular remodeling in the early phase of rat model with ischemia-reperfusion injury by suppressing cell apoptosis. Int J Med Sci. 2012;9:413-423. 41. Thum T, Gross C, Fiedler J, Fischer T, Kissler S, Bussen M, Galuppo P, Just S, Rottbauer W, Frantz S, Castoldi M, Soutschek J, Koteliansky V, Rosenwald A, Basson MA, Licht JD, Pena JT, Rouhanifard SH, Muckenthaler MU, Tuschl T, Martin GR, Bauersachs J and Engelhardt S. MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts. Nature. 2008;456:980-984. 42. Kho C, Lee A, Jeong D, Oh JG, Chaanine AH, Kizana E, Park WJ and Hajjar RJ. SUMO1-dependent modulation of SERCA2a in heart failure. Nature. 2011;477:601-605. 43. Aoyama Y, Kobayashi K, Morishita Y, Maeda K and Murohara T. Wnt11 gene therapy with adeno-associated virus 9 improves the survival of mice with myocarditis induced by coxsackievirus B3 through the suppression of the inflammatory reaction. J Mol Cell Cardiol. 2015;84:45-51. 44. Ricci EP, Limousin T, Soto-Rifo R, Allison R, Poyry T, Decimo D, Jackson RJ and Ohlmann T. Activation of a microRNA response in trans reveals a new role for poly(A) in translational repression. Nucleic Acids Res. 2011;39:5215-5231.

Ohlmann T. Activation of a microRNA response in trans reveals a new role for poly(y(y(A) in ranslational repression. Nucleic Acids Res. 2011;39:5215-5231.



ownloaded from



23

Table 1. The ratio of miR-21 molecules per Cytb transcript in mitochondria of cultured cells.

Cell types Negative control miR-21 mimic miR-21 inhibitor H9c2 0.110 97* 0.066* HK2 0.073 47* 0.028*

HEK293 0.052 40* 0.029* *p<0.05 vs. Negative control, n=3.

Table 2. Comparison of echocardiographic and hemodynamic measurements in short-term rAAV-miR-21 treated SHRs.

Wistar SHRs NS rAAV-GFP rAAV-miR-21 rAAV-anti-miR-21 rAAV-mut-miR-21 rAAV-mut-anti-miR-21HR(bpm) 396 ±3.9 407±9.3 429±9.6 416±10.3 413±5.3 433±7.3 425±6.7

Pes(mmHg) 140±1 219±3* 214±9 181±6† 210±6 218±3 219±9

dp/dtmax 13558±1015 15245±1130 15927±1154 14238±775 15421±732 15968±833 16965±1106 dp/dtmin -10645±1566 -13561±593 -12860±1226 -11797±766 -13745±1178 -13629±1248 -13038±1269 EF (%) 79.8±3.1 88.1±2.3* 88.0±2.2 86.8±2.9 84.5±1.7 85.4±3.0 86.5±3.1 IVSTd(mm) 2.02±0.07 2.24±0.12 2.20±0.10 2.09±0.06 2.21±0.14 2.20±0.09 2.26±0.11

IVSTs (mm) 3.30±0.13 3.25±0.09 3.43±0.12 3.37±0.17 3.33±0.15 3.27±0.14 3.35±0.13

HR, heart rate; Pes, end systolic pressure; dp/dtmax, peak instantaneous rate of left ventricular pressure increase; dp/dtmin, peak instantaneous rate of left ventricular pressure increase decline; EF, ejection fraction of left ventricular; IVSTd, interventricular septum thickness in end-diastolic of left ventricle; IVSTs, interventricular septum thickness in end-systolic of left ventricular. Data were presented as mean±SEM, n=10. *p<0.05 vs. Wistar control, †p<0.05 vs. SHRs treated with NS.

Wistar SHRsNS rAAV-GFP rAAV-miR-21 rAAV-anti-miR-21 rAAV-mut-miR-21 rArArAAVAVAV-m-m-mututut-a-a-antntnti-i-i-mimimi

) 396 ±3.9 407±9.3 429±9.6 416±10.3 413±5.3 433±7.3 425±6.7

Hg) 140±1 219±3* 214±9 181±6† 210±6 218±3 219±9

max 1313135555558±8±8±101010151515 152525245±1130 15927±1154 14238±775 15421±732 51515968±833 16965±1106 min -1- 0645±1 66566 66 -1353561±5933 -128686860±0±0±12121 26 -11797±77666 -1337474745±5±5±111 78 -13626 9±1222484848 -131330303038±8±8 1269

%) 79.8±3.1 8888.88 ±1±2.2.2.3*3*3* 8888.88 0±222.2 22 86.8±22.9 8884.5±1.1.1.777 8588 .4±3±3±3.000 886. ±5±5±3.1d 2.02±0.07 2.22 2422 0±± 1. 2 2.2 20±0.10 2.09±0 0.. 6 66 222.212121±0±0±0.1.1.1444 .2. 0200±0±0±0.09 2.26 00±0 11.11

s 333.303030±0±0±0 11.1333 3.33 2522 0±± 0. 9 3.3.3.434343±0±0±0.111222 33.3.373737±0±0±0.1.. 7 77 3.3.3.333333±0±0±0.1.1.1555 .3.27±0±0±0 11.1444 3.35 00±0 11.13

eart rate; PPes, e dnd systolilic pressure; ddp/d/dtmax, pe kak iinstantaneous rate fof ll feft vent iricullar pressure iincrease; dd /p/ddtmintt , pe kak iinstantaneous rate fof ll feft ventr



ownloaded from



24

Table 3. Comparison of echocardiographic and hemodynamic measurements in long-term treated SHRs.

rAAV-GFP rAAV-miR-21 rAAV-mut-miR-21 p value HR (bpm) 395 ±7 384 ±16 398 ±12 0.59 Pes (mmHg) 244 ±3 224 ±7† 250 ±5 0.002 dp/dtmax 14474 ±438 14162 ±1163 14125 ±383 0.826 dp/dtmin -14003±620 -12619±889 -14250±738 0.266 EF (%) 85.2 ±0.6 81.0 ±1.1* 86.2 ±1.1 0.016 FS (%) 33.9 ±2.8 30.7 ±2.9 33.6 ±2.5 0.450 IVSTd (mm) 2.92 ±0.07 2.66 ±0.04* 2.88 ±0.12 0.014 IVSTs (mm) 3.76 ±0.14 3.30 ±0.10* 3.76 ±0.09 0.030 HR, heart rate; Pes, end systolic pressure; dp/dtmax, peak instantaneous rate of left ventricular pressure increase; dp/dtmin, peak instantaneous rate of left ventricular pressure increase decline; EF, ejection fraction of left ventricular; FS, fractional shortening; IVSTd, interventricular septum thickness in end-diastolic of left ventricle; IVSTs, interventricular septum thickness in end-systolic of left ventricular. Data were presented as mean±SEM, n=5. *p<0.05 vs. rAAV-GFP, †p<0.01 vs. rAAV-GFP.

d (mm) 2.92 ±0.07 2.66 ±0.04* 2.88 ±0.12 0.014 s (mm) 3.76 ±0.14 3.30 ±0.10* 3.76 ±0.09 0.00.0303030 0 0 eart rate; Pes, end systolic pressure; dp/dtmax, peak instantaneous rate of left ventricular pressure increase; dp/dtmintt , peak instantntntananeoee ususus rrratatatee e ofofof lllefefeft t t vevev ntntrre increase decline; EF, ejection fraction of left ventricular; FS, fractional shortening; IVSTd, interventricular septum thickknenenesss in enddd-dididiastttolililic omcle; IVSTs, interventricular septum thickness in end-systolic of left ventricular. Data were presented as mean±SEM, n=5. 05 vs. rAAV-GFP, †p<0.01 vs. rAAV-GFP.



ownloaded from



25

Figure Legends

Figure 1. Down-regulated mitochondrial Cytb linked to increased ROS production in the heart of

SHRs. (A) Representative images of HE staining in various organs of SHRs compared to Wistars.

(B) Representative images of Sirus red staining in various organs of SHRs compared to Wistars.

(C) Representative images of ROS detected by DHE probe in frozen heart sections of SHRs

compared to Wistars. (D, E) Western blot analysis of the ETC subunits in the heart of SHRs. n=3,

results from Wistars were set to 1, *p<0.05 compared to Wistars. (F) mRNA levels of

mitochondrial subunits in H9c2 cells transfected with the indicated siRNAs. n=3, results from

si-NC were set to 1, *p<0.05 relative to si-NC. (G, H) Protein levels of mitochondrial subunits in

H9c2 cells transfected with the indicated siRNAs. (I, J) ROS levels in H9c2 cells transfected with

si-ND1, si-Cytb or si-COI. n=3, results from si-NC were set to 1, *p<0.05, **p<0.01 related to

si-NC.

Figure 2. miR-21 enhanced translation of Cytb in the mitochondria. (A) Sequence alignment of

miR-21 on the Cytb mRNA from different organisms. Extensive base-pairings are evident both at

the 5’ seed and the 3’ region of miR-21. (B) MiR-21 levels in purified mitochondria for SHR and

Wistar hearts. n=3, results from Wistars were set to 1, *p<0.05. (C) Real-time PCR analysis of

mitochondrial Cytb mRNA and cytoplasmic GAPDH mRNA in purified mitochondria. (D, E)

MiR-21 levels in the cytosol and mitochondria of transfected H9c2 cells. n=3, results from control

cytosol were set to 1. (F, G) Effects of transfected miR-21 on mitochondrial subunits at the protein

levels. n=3, results from control were set to 1, *p<0.05. (H) Effects of miR-21 on mitochondrial

subunits at the mRNA levels. n=3, results from control were set to 1.

i-NC were set to 1, *p<0.05 relativ (G, H) Proteine to si-NC. leve of mitochondrls iaiaial ll suuubuninn ts in

H9c2 cells transfected with the indicated siRNAs. (I, J) ROS levels in H9c2 cells ttrararannnsfefefectctctededed wwwititithhh.

si-Cytb i-ND1, or si-COI. n=3, results from si-NC were set to 1, *p<0.05, **p<0.01 related to m

i-NNNC.C.C.

FiFiFigugurerere 222. mimimiR-R-R-212121 eeenhnhnhanannceceddd trtrtranananslslslatatatioioionnn ofofof CCCytytytb bb ininin thththeee mimimitototochchchononondrdrdriaiaia. (A(A(A))) SeSeSequququenenencecece aalililigngngnmementtnt ooofff



ownloaded from



26

Figure 3. MiR-21-stimulated interaction of the Cytb mRNA with the mitochondrial translation

machinery. (A) Real-Time PCR analysis of mRNA in association with Ago2 in H9c2 cells. n=3,

results from control were set to 1, **p<0.01. (B) Mitochondrial polysome profiling. Isolated

mitochondria free of markers of cytoplasmic ribosomes (RPS3 and RPL4) were fractionated on a

sucrose gradient. The assignment of small and large ribosomal subunits, monosomes, and putative

polysomes was based on the distribution of both 12/16S RNAs and mitochondrial ribosomal

proteins (MRPS27 and MRPL45). The putative polysome fractions near the bottom of the

gradient (fractions 12 and 13) could be converted to monosomes by RNase I treatment. The

relative abundance of individual transcripts in each fraction was presented as the percentage of the

total fraction. (C-E) The association of the Cytb mRNA with putative polysome fractions (fraction

12 and 13) in response to miR-21 mimic treatment. n=3, results from control were set to 1,

*p<0.05. (F-H) Effects of miR-21 on Cytb and PTEN protein expression with the miRNA

machinery selectively inactivated by knocking down GW182 in the cytoplasm, n=3, results from

si-NC control were set to 1.

Figure 4. Transfected miR-21 mimic to quench ROS. (A) Effect of miR-21 on mt-ROS in

transfected H9c2 cells. (B) Effects of si-Cytb and Antimycin A on mt-ROS. (C) Effect of miR-21

on mt-ROS in si-Cytb treated cells. (D) Effect of miR-21 on mt-ROS in Antimycin A treated cells.

(E) Effect of miR-21 on total-ROS. (F) Effect of miR-21 on total-ROS in si-Cytb treated cells. (G,

H) Effect of miR-21 on the Cytb protein level, results from si-NC control were set to 1. (I) A

model to illustrate the effects of siCytb and miR-21 on mt-ROS production. All data were

presented as mean±SEM, n=3.

otal fraction. (C-E) The associa(C-E) tion of the Cytb mRNA with putative polysome frararactctctioioionsnsns (((frfrfracacactitit on

12 and 13) in response to miR-21 mimic treatment. n=3 results from control were set to , , results from were set to 1

*p<0.05. (((F-H) Effects of miR-21 on Cytb and PTEN protein expression with the miRNA

machchchiiinery seleleeccctivvvelee y y y inininacacactitt vavavatttededed bbby yy knnnocoo kinggg dddowwn GWGWGW1818182 22 innn ttthehehe nnn=3==cycycytototoplasasasm,m,m, , rereresususultltltsss frfrfromo

control s o ... i-NNNCC C wewew rrre seeet to 1



ownloaded from



27

Figure 5. Short-term treatment of rAAV delivered miR-21 reduced blood pressure in SHRs. (A)

The levels of circulating miR-21 in healthy control and hypertensive patients. *p<0.01. (B) The

correlation between circulating miR-21 levels and systolic pressure; (C) The correlation between

circulating miR-21 levels and diastolic pressure. (D, E) Systolic blood pressure in SHRs measured

by tail-cuff method. (F) Max pressure of carotid artery monitored by Millar Pressure-Volume

System. (G) MiR-21 levels in heart of various groups, results from Wistars were set to 1. (H-K)

Western blot analysis of Cytb protein in the heart of rAAV-miR-21 treated SHRs, results from

Wistars were set to 1. (L-O) HE, Sirius red and DHE staining of myocardial tissue in SHRs. All

data were presented as mean±SEM, n=10, *p<0.05, **p<0.01.

Figure 6. Effects of short-term rAAV-miR-21 treatments in various organs of SHRs. (A-D)

MiR-21 levels in liver, kidney, aorta and brain of various groups, results from Wistars were set to

1. (E-H) Western blot analysis of Cytb protein in liver, kidney, aorta and brain of various groups.

(I) ROS detected by DHE probe in liver, kidney, aorta and brain of various groups. All data were

presented as mean±SEM, n=5, *p<0.05, **p<0.01.

Figure 7. Long-term treatment of rAAV delivered miR-21 reduced blood pressure and inhibited

cardiac hypertrophy in SHRs (A) Systolic blood pressure in SHRs measured by tail-cuff method.

(B) Max pressure of carotid artery monitored by Millar Pressure-Volume System. (C) Cardiac

mass index in SHRs treated with rAAV-miR-21. (D) Representative images of HE staining, Sirius

Red staining and DHE of myocardial tissue in SHRs. (E-G) Quantification of cardiomyocyte size,

fibrosis and ROS under different treatment conditions. (H) Real-Time PCR analysis of BNP

mRNA levels in SHR hearts, results from rAAV-GFP were set to 1. (I, J) Western blot analysis of

Figure 6. (A-D)Effects of short-term rAAV-miR-21 treatments in various organs of SHRs.

MiR-21 levels in liver, kidney, aorta and brain of various groups, results f Wistarsfrom were set to

. (((E-E-E-H)H Westeeernrnrn bbbloll t anananalalalysysy isisis ooof f f CyCyCytb ppproteinnn iiin1 llivver,,, kikikidndndneyeyey, aoaoaortttaaa annnd dd braiaiain n n ofofof vvvarioooususus gggrororoupupu s.

I) ROROROS detectttededed bbbyy DHDHDHE prprproobo e in livererr, kidneyeyey, aoaortaa a anananddd brbrbraaia n ofofof varrrioouusu groups.s.. AAAllll data wewewere

prpresesenentetedd asas mmeaean±n±SESEMM, nn=5=5, *pp<0<0 0.055, **pp<0<0 0.011.



ownloaded from



28

Cytb protein in the heart of rAAV-miR-21 treated SHRs, results from rAAV-GFP were set to 1.

All data were presented as mean±SEM, curves were compared using repeated measured ANOVA,

n=5, *p<0.05, **p<0.01.



ownloaded from


Wistar

SHR

SIRUS RED

HE

A

Wistar

SHR

B

Heart Liver Kidney Aorta Brain

Heart Liver Kidney Aorta Brain

100 μm 100μm 100 μm 50 μm 100 μm

100 μm 100μm 100 μm 50 μm 100 μm

SSIRUSS

Heart LLiivveerr Kiddnney AAoorrttaa BBrrainn

100 μm 100μm 100 μm 50 μm 100 μm



ownloaded from


C D

E F

Heart

Wistar SHRWistar SHR

NDUFA10

UQCRC1

mt-ND1

mt-Cytb

mt-COI

GAPDH

Heart41KD

53KD

36KD

43KD

57KD

36KD20 μm

F

Wistar SHRWistar SHR

mmtt-CCOOII

GGAAPPDDHH

57KD

36KD20 μm



ownloaded from


G H

I

mt-ND1

mt-Cytb

mt-COI

GAPDH

si-NC si-ND1

si-Cytb si-COI

J

36KD

43KD

57KD

36KD GAPDH

si--NNC si-ND1

J



ownloaded from


A

B C

mt-Cytb

GAPDH

RT-PCRCC

mmt-Cytbb

GAPDH

RRT--PPCRTT



ownloaded from


ED



ownloaded from


F

mt-ND1

mt-Cytb

mt-COI

UQCRC1

GAPDH

G

H

36KD

43KD

57KD

53KD

36KD

mt-ND1

mt-Cytb

mt-COI

UQCRC1

GGAAPPDDHH H



ownloaded from


A

Ago2

B

97KD

48KD

38KD

47KD

26KD

AAggoo22

38KDD

47KDD

26KDD



ownloaded from


C

D

mimic random miR-21 mimic

E

48KD

38KD

48KD

38KD

E



ownloaded from


F G

GW182

mt-Cytb

PTEN

NDUFA10

GAPDH

H

H9c2210KD

43KD

47KD

41KD

36KD

mt-Cytb

PTEN

NDUFA10

GAPDH



ownloaded from


A B C

E FD E F



ownloaded from


G H

mt-Cytb

GAPDH

si-NC

si-Cytb

mimic random

miR-21 mimic

I

43KD

36KD GAPDH

si-NC

si-Cytb

mimic random

mmiRR--221 mmiimmiicc



ownloaded from


A B C



ownloaded from


D E F



ownloaded from


G H

mt-ND1

mt-Cytb

mt-COI

GAPDH

I

36KD

43KD

57KD

36KD

mt-ND1

mt-Cytb

mt-COI

GAPDHH

36KD

43KD

57KD

36KD



ownloaded from


J K L

DHE HE SIRUS RED

Heart

100 μm 50 μm 100 μm



ownloaded from


M N O



ownloaded from


A B C



ownloaded from


D E F

mt-ND1

mt-Cytb

mt-COI

GAPDH

Liver Kidney

mt-ND1

mt-Cytb

mt-COI

GAPDH

36KD

43KD

57KD

36KD

36KD

43KD

57KD

36KD

mt-ND1

mt-Cytb

mt-COOII

GGAAPPDDHH

Liver KKiiddnneeyy

36KD

43KD

57KD

3636KDKD

36KD

43KD

557KD

336KDD



ownloaded from


mt-ND1

mt-Cytb

mt-COI

GAPDH

Aortamt-ND1

mt-Cytb

mt-COI

GAPDH

Brain

G H

36KD

43KD

57KD

36KD

36KD

43KD

57KD

36KD

mt-ND1

mt-Cytb

mt-COI

GAPDH

Aortamt-ND1

mt-Cytb

mt-COI

GAPDH

Brain

36KD

43KD

57KD

36KD



ownloaded from


Liver

Kidney

Aorta

Brain

DHE

I

100 μm

100 μm

50 μm

100 μm

Kidney

Aorta

BBrraaiinn

HE

101000 μμmm

50 μm

10000 μmm



ownloaded from


BA



ownloaded from


C D E

HE

SIRUSRED

DHE

rAAV-GFP rAAV-miR-21 rAAV-mut-miR-21

20 μm

100 μm

100 μm

SIRUSRED

DDHHEE

rrAAAAVV-GGFFPP rrAAAAVV-mmiiRR-2211 rrAAAAVV-mmuutt-mmiiRR-2211

200 μm

100 μm

100 μm



ownloaded from


F G H



ownloaded from


mt-ND1

mt-Cytb

mt-COI

GAPDH

I J

36KD

43KD

57KD

36KD

mt-ND1

mt-Cytb

mt-COI

GAPDH



ownloaded from


Wang, Xiang-Dong Fu, Chen Chen and Daowen WangHuaping Li, Xiaorong Zhang, Feng Wang, Ling Zhou, Zhongwei Yin, Jiahui Fan, Xiang Nie, Peihua

Mitochondrial TranslationMiR-21 Lowers Blood Pressure in Spontaneous Hypertensive Rats By Up-Regulating

Print ISSN: 0009-7322. Online ISSN: 1524-4539 Copyright © 2016 American Heart Association, Inc. All rights reserved.

is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231Circulation published online August 19, 2016;Circulation.

http://circ.ahajournals.org/content/early/2016/08/15/CIRCULATIONAHA.116.023926World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://circ.ahajournals.org/content/suppl/2016/08/19/CIRCULATIONAHA.116.023926.DC1.htmlData Supplement (unedited) at:

http://circ.ahajournals.org//subscriptions/

is online at: Circulation Information about subscribing to Subscriptions:

http://www.lww.com/reprints Information about reprints can be found online at: Reprints:

document. Permissions and Rights Question and Answer available in the

Permissions in the middle column of the Web page under Services. Further information about this process isOnce the online version of the published article for which permission is being requested is located, click Request

can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office.Circulation Requests for permissions to reproduce figures, tables, or portions of articles originally published inPermissions:



ownloaded from

http://circ.ahajournals.org/content/early/2016/08/15/CIRCULATIONAHA.116.023926

http://circ.ahajournals.org/content/suppl/2016/08/19/CIRCULATIONAHA.116.023926.DC1.html

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://circ.ahajournals.org//subscriptions/


SUPPLEMENTAL MATERIAL

MiR-21 Lowers Blood Pressure in Spontaneous Hypertensive Rats by

Up-regulating Mitochondrial Translation

Huaping Li1, M.D.; Xiaorong Zhang2, Ph.D.; Feng Wang1, M.D., Ph.D.; Ling

Zhou1, M.D.; Zhongwei Yin1, M.D.; Jiahui Fan1, M.D.; Xiang Nie1, M.D.; Peihua

Wang1, M.D., Ph.D.; Xiang-Dong Fu2,3, Ph.D.; Chen Chen1, M.D., Ph.D.; and

Dao Wen Wang1, M.D., Ph.D.

1Division of Cardiology, Department of Internal Medicine, Tongji Hospital,

Tongji Medical College, Huazhong University of Science and Technology,

Wuhan 430030, China.

2Key Laboratory of RNA Biology, Institute of Biophysics, Chinese Academy of

Sciences, Beijing 100101, China

3Department of Cellular and Molecular Medicine, University of California, San

Diego, La Jolla, CA 92093-0651, USA; Institute of Genomic Medicine,

University of California, San Diego, La Jolla, CA 92093-0651, USA.

Corresponding authors:

Chen Chen and Dao Wen Wang

Division of Cardiology, Department of Internal Medicine, Tongji Hospital, Tongji

Medical College, Huazhong University of Science & Technology, 1095#

Jiefang Ave., Wuhan 430030, China

Tel. & Fax: 86-27-8366-3280

Email: [email protected]; [email protected]

mailto:[email protected]

Expanded Methods

Cell culture and transfection

H9c2, HK2, HEK293T and HUVEC cells were maintained in DMEM with

10% FBS (Life Technologies, Carlsbad, CA). MiRNA mimics (50nM), inhibitors

(50nM), siRNAs (50nM), and random small RNA controls (50nM) were

transfected by Lipofectamine 2000 (Life Technologies, Carlsbad, CA). All of

them used in the present study were purchased from Riobio Co., Ltd

(Guangzhou, China).

Protein extraction and Western blotting

Protein concentrations were determined by the Bradford method. For

Western blotting, total cell lysate was resolved by SDS-PAGE, transferred to

nitrocellulose membrane, and blocked with 5% non-fat dry milk in TBS-T. The

membrane was incubated with indicated primary antibody overnight at 4°C,

followed by peroxidase-conjugated secondary antibody for 2 hours, and finally

developed with the ECL system (Beyotime Institute of Biotechnology, Nanjing,

China). Antibodies used in the present study were listed in Supplemental Table

1. Western blotting results were quantified by densitometry and processed with

the ImageJ software (National Institutes of Health software).

RNA extraction and quantitative RT-PCR

Total RNA was isolated using TRIzol and reverse transcribed with

SuperScript® III First Strand Synthesis Kit (Life Technologies, Carlsbad, CA).

Real-time PCR assays were performed with the SYBR® Select Master Mix

(Life Technologies, Carlsbad, CA) on a 7900HT FAST Real-Time PCR System

(Life Technologies, Carlsbad, CA) at 95°C for 10 min, 40 cycles at 95°C for

15 s in each cycle, and 60°C for 1 min in the final cycle. All reactions were

performed in triplicate. The data were analyzed, as described1. Primers used

in the present study were listed in Supplemental Table 2.

RNA immunoprecipitation

Lysed mitochondria extracts were immunoprecipitated with anti-Ago2

antibody (Abnova Corporation, Taiwan, China) or IgG (Santa Cruz

Biotechnology, Santa Cruz, CA) using protein G Sepharose beads (Santa Cruz

Biotechnology, Santa Cruz, CA), as described 2. After elution from the beads,

bound RNA were extracted with TRIzol and quantified by real time RT-PCR.

Study on human patients

In accordance with the Declaration of Helsinki and approved by the Ethics

Committee of Tongji Hospital, 100 patients with hypertension and 120 controls

were enrolled for the present study. All patients were admitted to

Cardiovascular Division in Tongji Hospital between September 2012 and

January 2016 and 5ml blood samples were collected via venous puncture after

obtaining written informed consent. The clinical characteristics among patients

with hypertension in comparison with control subjects were listed in

Supplemental Table 3. After centrifugation, the plasma were transferred to

RNase-free tubes and stored at -80°C until analysis.

Application of recombinant adeno-associated virus (rAAV) to animals

All animal studies were conducted with the approval of the Animal

Research Committee of Tongji Medical College, and in accordance with the

NIH Guide for the Care and Use of Laboratory Animals. For in vivo

experiments, male SHRs at 8 weeks of age (Vital River Laboratory Animal

Technology Co., Ltd. Beijing, China) were divided into different groups (short

term treatments: NS (saline), rAAV-GFP, rAAV-miR-21, rAAV-mut-miR-21,

rAAV-anti-miR-21 and rAAV-mut-anti-miR-21, n=10; chronic treatments:

rAAV-GFP, rAAV-miR-21, and rAAV-mut-miR-21, n=5). Rats in each group

were injected with rAAV (5x1011 genome copies per rat) via tail vein using a

modified hydrodynamic transfection method, as described previously3. Briefly,

puncture of the lateral tail vein was performed with the rat lying on its right side

and the base of the tail placed between the index and middle fingers; rAAV

dissolved in saline was rapidly injected into the tail vein. Control rats were

injected with an equal volume of saline. Treated SHRs were sacrificed (short

term treatments: 4 week post injection; chronic treatments: 28 weeks post

injection) and tissue samples were snap-frozen in liquid nitrogen or

immediately processed for paraffin embedding. During this procedure,

anaesthetization of rats was performed with intraperitoneal injection of xylazine

(5 mg/kg) and ketamine (80 mg/kg) mixture. To assess the adequacy of

anesthesia during echocardiographic and hemodynamic examinations,

parameters such as responsiveness, blood pressure, respiratory rate and

heart rate were monitored. At the end of the procedure, animals were

sacrificed by CO2 inhalation, as previously described4.

Measurement of blood pressure and cardiac echocardiography

After rAAV injection, systolic blood pressures were measured every 4

weeks for 28 weeks at room temperature by a photoelectric tail-cuff system

(PowerLab, AD Instrument Pty Ltd, Bella Vista, NSW, Australia), as described

previously5.

Upon anesthetization, echocardiography was performed with VIVID 7

(General Electric, Milwaukee, WI) equipped with a 15-MHz linear array

ultrasound transducer, as previously described6. To monitor LV catheterization,

a catheter manometer (MPVS-400; Millar Instruments, Inc. Houston, TX) was

inserted via the right carotid artery into the left ventricle. After stabilization for

20min, data were continuously recorded by using conductance data

acquisition. Individual cardiac function parameters were calculated with the

PVAN3.6 software (Millar Instruments, Inc. Houston, TX), as described

previously7. For histological analysis, tissue sections were analyzed by light

microscopy after hematoxylin-eosin staining, and the ImageJ program was

used to measure the area of each cell, as described8. Over 200

cardiomyocytes were measured per section.

Histological analysis

Formalin-fixed organs were embedded in paraffin and sectioned into 4 mm

slices. The morphology and fibrosis were detected by HE and Sirius red

staining, respectively. Tissue sections were visualized by microscope, and

measured by mage-Pro Plus Version 6.0 (Media Cybernetics, Bethesda, MD,

USA).

Supplemental Table 1. List of Antibodies.

Antibody Company Catalog number

Ago2 Abnova H00027161-M01 NDUFA10 ABGENT AP9768c

UQCRC1 ABGENT AP18967a

mt-ND1 ABclonal A5250 mt-Cytb proteintech 55090-1-AP mt-COI BOSTER BA4150

MRPL45 ABclonal A5052 MRPS27 ABclonal A4527

RPL4 ABclonal A7620 RPS3 ABclonal A2533

GW182 ABclonal A6115 PTEN ABclonal A2113

Supplemental Table 2. List of PCR primers.

Forward Reverse

Rat-CYTB 5' CCCATTCATTATCGCCGC 3' 5' GGGTGTTGAGGGGGTTAGC 3'

Rat-ND1 5' GCTACATACAACTACGCAAAGGC 3’ 5' TATTGAGGTGGTTAGGGGGC 3'

Rat-COI 5' GCTCGTAAACCGTTGACTCT 3' 5' TCAGTTCCCGAAGCCTCC 3'

Rat-UQCRC1 5’CCAAGGACCTGCCAAAAGTT 3' 5' GGTGTGCCCTGGAATGCT 3'

Rat-GAPDH 5’ACAGCAACAGGGTGGTGGAC 3’ 5’TTTGAGGGTGCAGCGAACTT 3’

Rat-BNP 5' TCTGCTCCTGCTTTTCCTTA 3’ 5' GAACTATGTGCCATCTTGGA 3’

Rat-12s RNA 5' ACTGGGATTAGATACCCCACTATG 3' 5'ATCGATTATAGAACAGGCTCCTC 3'

Rat-16s RNA 5' GTTATACCTTACCCCTTCTCGC 3' 5' CCCATTTCTTTCCGCTTCA 3'

Rat-5s RNA 5’ GATCTCGGAAGCTAAGCAGG 3’ 5’ AAGCCTACAGCACCCGGTAT 3’

Rat-BNP 5' TCTGCTCCTGCTTTTCCTTA 3’ 5' GAACTATGTGCCATCTTGGA 3’

Supplemental Table 3. The clinical baseline characteristics of the

hypertension patients.

Characteristics Control (n=120) Hypertension (n=100) P value

Male/female (n/n) 60/60 50/50 1

Age (years) 53.9 ±0.97 53.6 ±1.31 0.805

BMI (kg/m2) 23.9 ±0.43 24.9 ±0.36 0.073

SBP (mmHg) 118.8 ±1.06 158.3 ±1.62* <0.001

DBP (mmHg) 73.9 ±0.87 91.9 ±1.27* <0.001

Cr (mmol/L) 77.7 ±3.68 80.1 ±3.35 0.627

BUN (mmol/L) 5.82±0.28 5.80 ±0.22 0.953

Fasting glucose (mmol/L) 5.65 ±0.14 5.97 ±0.15 0.129

TG (mmol/L) 1.39±0.11 1.57 ±0.08 0.178

TC (mmol/L) 4.07±0.08 4.28±0.09 0.063

HDL (mmol/L) 1.08 ±0.03 1.07 ±0.03 0.915

LDL (mmol/L) 2.41 ±0.07 2.59 ±0.08 0.072

BMI, Body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; Cr,

Creatinine; BUN, Blood urea nitrogen; TG, Triglyceride; TC, total cholesterol; HDL,

high-density lipoprotein; LDL, low-density lipoprotein; comparison among healthy control,

hypertension patients with high blood pressure, and hypertension patients with normal

blood pressure, Data were presented as mean ± SEM. *p<0.001 vs. control.

Supplemental Figure 1. Detection of ROS and expression of ETC

subunits in various organs of Wistars and SHRs.

A

B C

D E

F G

H I

J K

(A) Representative images of ROS detected by DHE probe in liver, kidney,

aorta and brain sections of SHRs compared to Wistars. (B-I) Western blot

analysis of the ETC subunits in the liver, kidney, aorta and brain of SHRs. n=3,

*p<0.05 compared to Wistars. (J) Protein levels of mitochondrial subunits in

H9c2 cells transfected with the indicated siRNAs. (K) ROS levels in H9c2 cells

transfected with si-ND1, si-Cytb or si-COI. n=3, **p<0.01 related to si-NC.

Supplemental Figure 2. MiR-21 enhanced translation of Cytb into the

mitochondria.

A

B C

D E

F G

H I

J K

(A) Total miR-21 levels in different tissue of SHRs and Wistar. n=3, *p<0.05.

(B-E) MiR-21 levels in the cytosol and mitochondria of transfected HK2 and

HEK293 cells. n=3. (F-K) Effects of miR-21 on the protein expressions of

mitochondrial subunits. n=3, *p<0.05.

Supplemental Figure 3. Effects of miR-21 on Cytb and PTEN expression

by knocking down GW182.

A

B C

D

E F

(A-C) Effects of miR-21 on Cytb and PTEN in HK2 cells. (D-F) Effects of

miR-21 on Cytb and PTEN in HEK293 cells. n=3.

Supplemental Figure 4. Effects of miR-21 on ROS.

A B

C D

E F

(A) Effects of miR-21 on mt-ROS in HK2 cells. (B) Effects of miR-21 on

mt-ROS in HEK293 cells. (C) Effects of miR-21 on mt-ROS in si-Cytb treated

HK2 cells. (D) Effects of miR-21 on mt-ROS in si-Cytb treated HEK293 cells.

(E) Effects of miR-21 on total-ROS in si-Cytb treated HK2 cells. (F) Effects of

miR-21 on total-ROS in si-Cytb treated HEK293 cells. n=3.

Supplemental Figure 5. Morphology, miR-21 levels and expression of

ETC subunits in lungs of Wistars and SHRs.

A

B C

D

(A) Representative images of morphology, fibrosis and ROS in lung sections of

SHRs compared to Wistars. (B) miR-21 level in lung of SHRs compared to

Wistars. (C-D) Western blotting analysis of the ETC subunits in lung tissues.

n=3, *p<0.05

Supplemental Figure 6. Effects of long-term rAAV-miR-21 treatments in

various organs of SHRs.

A B

C D

E F

G H

I J

K

L M

N O

(A, B) Levels of miR-21 in cytosol and mitochondria of SHRs hearts. n=5,

**p<0.01 vs. rAAV-GFP. (C-F) MiR-21 levels in liver, kidney, aorta and brain of

various groups. (G-K) Western blotting analysis of Cytb protein in liver, kidney,

aorta and brain of various groups. (L-O) Representative images of HE staining,

Sirius Red staining and DHE of liver, kidney, aorta and brain of various groups.

All data were presented as mean ± SEM, n=5, *p<0.05, **p<0.01.

Supplemental Figure 7. Effects of short-term rAAV-miR-21 treatments on

function and morphology of liver and kidney.

A B

C D

E

(A-D) Plasma AST, ALT, CR and UREA in various groups. (E) Representative images of HE staining of liver and kidney in various groups. n=10.

References

1. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL,

Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ. Real-time quantification of

micrornas by stem-loop rt-pcr. Nucleic Acids Res. 2005;33:e179

2. Beitzinger M, Meister G. Experimental identification of microrna targets by

immunoprecipitation of argonaute protein complexes. Methods Mol Biol. 2011;732:153-167

3. Song E, Lee SK, Wang J, Ince N, Ouyang N, Min J, Chen J, Shankar P, Lieberman J. Rna

interference targeting fas protects mice from fulminant hepatitis. Nat Med. 2003;9:347-351

4. Yang S, Chen C, Wang H, Rao X, Wang F, Duan Q, Chen F, Long G, Gong W, Zou MH, Wang

DW. Protective effects of acyl-coa thioesterase 1 on diabetic heart via pparalpha/pgc1alpha

signaling. PLoS One. 2012;7:e50376

5. Xiao B, Li X, Yan J, Yu X, Yang G, Xiao X, Voltz JW, Zeldin DC, Wang DW. Overexpression

of cytochrome p450 epoxygenases prevents development of hypertension in spontaneously

hypertensive rats by enhancing atrial natriuretic peptide. J Pharmacol Exp Ther.

2010;334:784-794

6. Ma F, Lin F, Chen C, Cheng J, Zeldin DC, Wang Y, Wang DW. Indapamide lowers blood

pressure by increasing production of epoxyeicosatrienoic acids in the kidney. Mol Pharmacol.

2013;84:286-295

7. Xu X, Wan W, Ji L, Lao S, Powers AS, Zhao W, Erikson JM, Zhang JQ. Exercise training

combined with angiotensin ii receptor blockade limits post-infarct ventricular remodelling in

rats. Cardiovasc Res. 2008;78:523-532

8. Rangan GK, Tesch GH. Quantification of renal pathology by image analysis. Nephrology

(Carlton). 2007;12:553-558

MiR-21 Lowers Blood Pressure in Spontaneous Hypertensive Rats … · 3Department of Cellular and...

Documents

Transcript of MiR-21 Lowers Blood Pressure in Spontaneous Hypertensive Rats … · 3Department of Cellular and...