Minor Introns vs Major Introns
Transcript of Minor Introns vs Major Introns
![Page 1: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/1.jpg)
introduction two different types classification of minor introns results
.
.
. ..
.
.
Minor Introns vs Major Introns
Sebastian Bartschat
Bioinformatics, Leipzig
October 2009
![Page 2: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/2.jpg)
introduction two different types classification of minor introns results
table of content
.. .1 introduction
.. .2 two different types
.. .3 classification of minor introns
.. .4 results
![Page 3: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/3.jpg)
introduction two different types classification of minor introns results
reminder
non-coding regions, interrupting two exons
most genes in higher eukaryotes contain introns
intron removal and ligation of 2 consecutive exons is calledsplicing
2 trans-esterifications carried out by the spliceosome
![Page 4: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/4.jpg)
introduction two different types classification of minor introns results
reminder
non-coding regions, interrupting two exons
most genes in higher eukaryotes contain introns
intron removal and ligation of 2 consecutive exons is calledsplicing
2 trans-esterifications carried out by the spliceosome
![Page 5: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/5.jpg)
introduction two different types classification of minor introns results
major introns (U2-dependent)
found in all eukaryotes
excision is dependent on U2 snRNA
poly-pyrimidine tract upstream of 3’splice site
more degenerate splice site signals
GT-AG, AT-AC and GC-AG
![Page 6: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/6.jpg)
introduction two different types classification of minor introns results
minor introns (U12-dependent)
found in plants and most metazoan taxa
no evidence found in simple eukaryotes like S.cerevisiae,C.elegans or protists
excision of minor introns is dependent on U12 snRNA
frequency in vertebrates in the range of 0.15 − 0.34%
conserved splice site sequences
lack of poly-pyrimidine tract
GT-AG, AT-AC, other RT-AN(R is purine, N is any nucleotide)
![Page 7: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/7.jpg)
introduction two different types classification of minor introns results
comparison
Steitz et al. [3]
![Page 8: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/8.jpg)
introduction two different types classification of minor introns results
Steitz et al. [3]
![Page 9: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/9.jpg)
introduction two different types classification of minor introns results
getting started
focusing on T.spiralis and C.elegans
using ESTs and BLAST to get possible splice sites
GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTTTGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTTTTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT
PWMs to determine the correct splice site
frequency matrices were used for classification
![Page 10: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/10.jpg)
introduction two different types classification of minor introns results
getting started
focusing on T.spiralis and C.elegans
using ESTs and BLAST to get possible splice sites
GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTTTGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTTTTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT
PWMs to determine the correct splice site
frequency matrices were used for classification
![Page 11: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/11.jpg)
introduction two different types classification of minor introns results
intron scoring
PU5′ss(X ) =
12∏i=0
pixi, with U either U2 or U12
PUbps(X ) calculated for each 13nt segment in the range of
(-40, -5) upstream of 3’ss
computation of log-odd ratios
L5′ss = log2
(PU12
5′ssPU2
5′ss
)and Lbps = log2
(PU12
bps
PU2bps
)transformation into z-Scores S5′ss and Sbps by subtracting thesample mean an dividing by the standard deviation
![Page 12: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/12.jpg)
introduction two different types classification of minor introns results
intron scoring
PU5′ss(X ) =
12∏i=0
pixi, with U either U2 or U12
PUbps(X ) calculated for each 13nt segment in the range of
(-40, -5) upstream of 3’ss
computation of log-odd ratios
L5′ss = log2
(PU12
5′ssPU2
5′ss
)and Lbps = log2
(PU12
bps
PU2bps
)transformation into z-Scores S5′ss and Sbps by subtracting thesample mean an dividing by the standard deviation
![Page 13: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/13.jpg)
introduction two different types classification of minor introns results
separation
often there is no obvious cluster
same importance of 5’splice site and branch site
usage of a reference set of 27 minor introns [1]
minimum values of their 5’ss and branch site scores asappropriate threshold
![Page 14: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/14.jpg)
introduction two different types classification of minor introns results
finding homologous introns
...1 identifying the T.spiralis genes containing minor introns
...2 homology search using BLASTX for detection of C.elegansproteins
...3 reconstruction of genomic structure with TBLASTN
...4 analysing the introns (with respect to their positions andtypes)
![Page 15: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/15.jpg)
introduction two different types classification of minor introns results
-6 -4 -2 0 2 4 6 85’ splice site score
-4
-2
0
2
4
6
bran
ch s
ite s
core
burge (control)gt-ag typeat-ac typegc-ag type
discrimination of introns of T.spiralis
![Page 16: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/16.jpg)
introduction two different types classification of minor introns results
evolution of introns
loss of intron
conversion to U2 introns
shift of splice sites, including a change of type
![Page 17: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/17.jpg)
introduction two different types classification of minor introns results
references
C B Burge, R A Padgett, and P A Sharp.Evolutionary fates and origins of u12-type introns.Mol Cell, 2(6):773–85, Dec 1998.
M Davila Lopez, M A Rosenblad, and T Samuelsson.Computational screen for spliceosomal rna genes aids in defining thephylogenetic distribution of major and minor spliceosomal components.Nucleic Acids Res, 36(9):3001–10, May 2008.
A A Patel and J A Steitz.Splicing double: insights from the second spliceosome.Nat Rev Mol Cell Biol, 4(12):960–70, Dec 2003.
N Sheth, X Roca, M L Hastings, T Roeder, A R Krainer, and R Sachidanandam.Comprehensive splice-site analysis using comparative genomics.Nucleic Acids Res, 34(14):3955–67, 2006.
![Page 18: Minor Introns vs Major Introns](https://reader031.fdocuments.in/reader031/viewer/2022021508/58667d8f1a28abf7408b54fb/html5/thumbnails/18.jpg)
introduction two different types classification of minor introns results
the end
Thank you for your attention!