MicrosomalTriglycerideTransferProteinActivityIsNot ... · MTP gene expression in stable...

Microsomal Triglyceride Transfer Protein Activity Is NotRequired for the Initiation of Apolipoprotein B-containingLipoprotein Assembly in McA-RH7777 Cells*

Received for publication, January 9, 2007, and in revised form, July 18, 2007 Published, JBC Papers in Press, August 8, 2007, DOI 10.1074/jbc.M700229200

Nassrin Dashti‡§1, Medha Manchekar‡, Yanwen Liu‡, Zhihuan Sun‡, and Jere P. Segrest‡¶

From the ‡Department of Medicine, Basic Sciences Section, Atherosclerosis Research Unit, §Department of Cell Biology,and ¶Department of Biochemistry and Molecular Genetics, University of Alabama at Birmingham Medical Center,Birmingham, Alabama 35294

We previously demonstrated that the N-terminal 1000amino acid residues of human apolipoprotein (apo) B (desig-nated apoB:1000) are competent to fold into a three-sidedlipovitellin-like lipid binding cavity to form the apoB “lipidpocket” without a structural requirement for microsomaltriglyceride transfer protein (MTP). Our results establishedthat this primordial apoB-containing particle is phospholip-id-rich (Manchekar,M., Richardson, P. E., Forte, T.M., Datta,G., Segrest, J. P., and Dashti, N. (2004) J. Biol. Chem. 279,39757–39766). In this study we have investigated the putativefunctional role of MTP in the initial lipidation of apoB:1000in stable transformants of McA-RH7777 cells. Inhibition ofMTP lipid transfer activity by 0.1 �M BMS-197636 and 5, 10,and 20 �M of BMS-200150 had no detectable effect on thesynthesis, lipidation, and secretion of apoB:1000-containingparticles. Under identical experimental conditions, the syn-thesis, lipidation, and secretion of endogenous apoB100-con-taining particles in HepG2 and parental untransfected McA-RH7777 cells were inhibited by 86–94%. BMS-200150 at 40�M nearly abolished the secretion of endogenous apoB100-containing particles in HepG2 and parental McA-RH cellsbut caused only 15–20% inhibition in the secretion of apoB:1000-containing particles. This modest decrease was attrib-utable to the nonspecific effect of a high concentration of thiscompound on hepatic protein synthesis, as reflected in a sim-ilar (20–25%) reduction in albumin secretion. Suppression ofMTP gene expression in stable transformants of McA-RH7777 cells by micro-interfering RNA led to 60–70%decrease in MTP mRNA and protein levels, but it had nodetectable effect on the secretion of apoB:1000. Our resultsprovide a compelling argument that the initial addition ofphospholipids to apoB:1000 and initiation of apoB-contain-ing lipoprotein assembly occur independently of MTP lipidtransfer activity.

Apolipoprotein B (apoB)2 is synthesized primarily in hepato-cytes and enterocytes and has a fundamental role in the trans-port andmetabolism of plasma triacylglycerols (TAG) and cho-lesterol (1, 2). ApoB is a predominant protein component ofvery low density lipoproteins (VLDL) and intermediate densitylipoproteins and is essentially the only apoprotein componentof low density lipoproteins (LDL2) (3, 4). ApoB100 (the full-length protein) is one of the largestmonomeric proteins knownwith 4536 amino acid residues (2). It is expressed primarily inmammalian liver, is an essential structural component for theformation and secretion of VLDL, and serves as a ligand for theLDL receptor (2). ApoB is present as a single molecule perlipoprotein particle (5); and therefore, its concentration in theplasma approximates the number of potential atherogeniclipoprotein particles.The processes involved in the assembly of apoB-containing

lipoproteins in the liver are complex and are regulated at mul-tiple levels throughout the secretory pathway. The assembly ofapoB-containing lipoproteins occurs co-translationally (1), i.e.while the C-terminal portion is still being synthesized on theribosome of the endoplasmic reticulum (ER), the N-terminalportion is translocated across the ER and is assembled as a smalllipoprotein particle. The addition of lipids to apoB is widelybelieved to occur in two steps (2, 6, 7). The first step involves theaddition of small amounts of lipids to apoB, as it is translatedand translocated into the lumen of ER preventing its degrada-tion and formation of a partially lipidated small pre-VLDL par-ticle in the high density lipoprotein (HDL) density range (2, 7,8). In the second step, this pre-VLDL particle is believed toacquire the bulk of its core lipids and is converted to bona fideVLDL (2, 7, 9), presumably by fusing with a large, VLDL-sized,apoB-free TAG particle (9). Biochemical studies of VLDLassembly support the concept that the bulk of neutral lipids areadded in the second step after apoB translation is completed(10).

* This work was supported by the National Institutes of Health GrantsHL084685 and PO1 HL34343. The costs of publication of this article weredefrayed in part by the payment of page charges. This article must there-fore be hereby marked “advertisement” in accordance with 18 U.S.C. Sec-tion 1734 solely to indicate this fact.

1 To whom correspondence should be addressed: Dept. of Medicine, Univer-sity of Alabama at Birmingham, 1808 7th Ave. South, BDB-D680, Birming-ham, AL 35292-0012. Tel.: 205-975-2159; Fax: 205-975-8079; E-mail:[email protected].

2 The abbreviations used are: apoB, apolipoprotein B; apoB:1000, N-terminal22.05% (residues 1–1000) of the mature protein; BSA, bovine serum albu-min; DMEM, Dulbecco’s modified Eagle’s medium; Me2SO, dimethyl sulf-oxide; ER, endoplasmic reticulum; FBS, fetal bovine serum; GAPDH, glycer-aldehyde-3-phosphate dehydrogenase; HDL, high density lipoprotein; HS,horse serum; LDL, low density lipoprotein; LV, lipovitellin; MTP, microsomaltriglyceride transfer protein; NDGGE, nondenaturing gradient gel electro-phoresis; PL, phospholipids; PBS, phosphate-buffered saline; TAG, triacyl-glycerol; VLDL, very low density lipoprotein; miRNA, micro-interferingRNA; RNAi, RNA interference; oligo, oligonucleotide.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 39, pp. 28597–28608, September 28, 2007© 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

SEPTEMBER 28, 2007 • VOLUME 282 • NUMBER 39 JOURNAL OF BIOLOGICAL CHEMISTRY 28597

by guest on June 22, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

One of themost important factors in the assembly and secre-tion of apoB-containing lipoproteins ismicrosomal triglyceridetransfer protein (MTP), which predominantly resides in the ERof hepatocytes and enterocytes (11–14). A vital role of MTP inthe formation and secretion of apoB-containing lipoproteinparticles is further substantiated by the observation thatpatients with abetalipoproteinemia, an autosomal-recessivedisorder caused by mutations in the MTP gene, have low levelsof apoB in plasma (11). Although the obligatory role of MTP inthe secretion of VLDL is well established, the precise mecha-nism by which MTP transfers lipids to the nascent apoBpolypeptide during its synthesis and assembly into VLDL is notfully understood. Furthermore, the relative importance ofMTPin the two steps of VLDL assembly remains unclear and con-troversial. Some studies indicate that MTP has a crucial role inthe first step assembly of VLDL (15–20), but it is not requiredfor the second-step core expansion during VLDL assembly (17,19–21). Others support the concept that MTP is essential fortransferring bulk TAG into the lumen of ER for the conversionof small apoB-containing lipoproteins to largeVLDL-sized par-ticle (22–24) and chylomicrons (25). The potential role ofMTPin the initial lipidation of apoB and nucleation of the primordialapoB-containing particle has not been elucidated.Previously, based on experimentally derived results (26, 27)

and all atom molecular modeling of the ��1 domain (aminoacid residues 1–1000) of apoB100 (28), we proposed that initi-ation of apoB particle assembly occurs when the ��1 domain,designated apoB:1000, folds into a three-sided lipovitellin (LV)-like lipid binding cavity to form the apoB “lipid pocket.” Ourresults supported a model in which the first 1000 amino acidresidues of apoB are competent to complete the lipid pocketwithout a structural requirement for MTP, and that this lipidpocket has a fixed lipid capacity on the order of 50 phospholip-ids (PL) for a total stoichiometry of 70 lipid molecules, a num-ber in close agreement with that reported for the LV complex(29–31). We propose that the initiation complex in the assem-bly of apoB-containing lipoprotein particle is PL-rich suggest-ing a small bilayer type organization rather than a TAG-richemulsion proposed by others (32). Although our results (27, 28)demonstrated that MTP is not a structural requirement for theformation of the lipid pocket, they did not rule out its potentialfunctional role, i.e. transfer of lipids to the nascent apoB:1000,in this process.Because MTP both binds to apoB and transfers lipids (33),

this study was a logical continuation of our previous work andfocused on the following important question: “is MTP involvedin the initial addition of PL to nascent apoB:1000 and initiationof apoB-containing lipoprotein particle assembly?” To addressthis question, we tested the effects of two well characterizedinhibitors of MTP lipid transfer activity, BMS-197636 andBMS-200150 (13, 34), on the de novo synthesis, lipidation, andsecretion of apoB:1000 in stable transformants of McA-RH7777 cells. We also suppressed theMTP gene expression bymiRNA and determined the subsequent effect on the secretionof apoB:1000. Our results provide a compelling argument thatthe initial addition of phospholipids to apoB:1000 and initiationof apoB-containing lipoprotein assembly occur independentlyof MTP lipid transfer activity.

EXPERIMENTAL PROCEDURES

Materials—Horse serum (HS) and antibiotic-antimycoticwere obtained from Invitrogen. Tris/glycine gels were obtainedfrom Invitrogen. Dulbecco’s modified Eagle’s medium(DMEM), minimum essential medium (MEM), trypsin, andG418 were purchased from Mediatech, Inc. (Herndon, VA).Fetal bovine serum (FBS), sodium deoxycholate, Triton X-100,dimethyl sulfoxide (Me2SO), phenylmethylsulfonyl fluoride,benzamidine, leupeptin, aprotinin, pepstatin A, fatty acid-freebovine serum albumin (BSA), and rabbit antibody to humanalbumin were from Sigma. Protein G-Sepharose CL-4B,[3H]glycine, [14C]oleic acid, andAmplify were fromAmershamBiosciences.Tran35S-label [35S]methionine/cysteine([35S]Met/Cys) was from MP Biomedicals, Inc. (Irvine, CA). Immobilinpolyvinylidene difluoride transfer membrane and CentriprepYM-30 centrifugal filter deviceswere purchased fromMilliporeCorp. (Bedford, MA). Affinity-purified polyclonal antibody tohuman apoB100 was prepared in our laboratory and biotiny-lated as described previously (26). MTP inhibitors, BMS-197636 and BMS-200150, and polyclonal antibody to bovineMTP 97-kDa large subunit (11) were kindly provided by Dr.David Gordon and Dr. J. R. Wetterau (Bristol-Myers SquibbCo.), and apoB100 cDNA was a gift from Dr. Zemin Yao (Uni-versity of Ottawa Heart Institute, Ottawa, Ontario, Canada).Construction of Truncated ApoB Expression Plasmid—Trun-

cated apoB cDNA spanning nucleotides 1–3081 of the full-length apoB100 cDNA was prepared from pB100L-L (35) as aPCR template and appropriate primers as described previouslyin detail (26). The amplified PCR product was cloned into theTOPO TA cloning vector and used to transform cells. Clonesharboring the vector were selected and identified by restrictionenzyme digestion and nucleotide sequencing of the entire openreading frames. Only clones with 100% correct sequence wereused in these studies. The 3081-bp fragment (apoB:1000) wasexcised from the vector, extracted, purified, and ligated into themammalian expression vector, the Moloney murine leukemiavirus-based retrovirus LNCX (36), containing the neomycinphosphotransferase gene, which confers G418 resistance foruse as a selectablemarker. The apoB expression vector pLNCB:1000 was used to transform cells, and clones harboring plas-mid-containing apoB gene with the correct orientation wereidentified by restriction enzyme digestion and confirmed bynucleotide sequencing as described previously (26).Cell Culture and Transfection—McA-RH7777 cells (referred

to as McA-RH here) were obtained from American Type Cul-ture Collection (Manassas, VA). Clonal stable transformants ofMcA-RH cells expressing apoB:1000, denoting amino acid res-idues 1–1000 of the mature protein lacking the signal peptide,were generated as described previously in detail (26). Cells weregrown in DMEM containing 20% HS, 5% FBS, and 0.2 mg/mlG418, and medium was changed every 48 h. All experimentswere conducted with 4–5-day-old cells as described previously(26). The human hepatoblastoma HepG2 cell line (obtainedfrom American Type Culture Collection) was seeded onto tis-sue culture dishes in MEM containing 10% (v/v) FBS and wereincubated at 37 °C in a 95% air, 5% CO2 atmosphere as

Role of MTP in the Initiation of ApoB Lipoprotein Assembly

28598 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 39 • SEPTEMBER 28, 2007


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

described previously (37).Mediumwas changed every 48 h, andall experiments were conducted with 4–5-day-old cells.MTP Inhibition—The MTP inhibitors BMS-197636 and

BMS-200150 (Bristol-Myers Squibb Co.) (13, 34) were dis-solved inMe2SO at concentrations of 0.025 and 10mM, respec-tively. FinalMe2SO concentrationwas normalized to 0.4% in allexperimental and control dishes.De Novo Synthesis and Secretion of ApoB and Albumin—

Clonal stable transformants of McA-RH cells expressing apoB:1000 andHepG2 and parentalMcA-RH cells producing endog-enous human and rat full-length apoB100, respectively, weregrown for 4 days in 6-well dishes. At the start of experiments,maintenance media were removed; monolayers were washedtwice with phosphate-buffered saline (PBS), and cells were pre-incubated for 45min in serum-, methionine-, and cysteine-freeDMEM. Fresh serum-, methionine-, and cysteine-free DMEMwas added, and the incorporation of [35S]Met/Cys (100 �Ci/mlof medium) into newly synthesized apoB:1000, apoB100, andalbumin in the presence or absence of BMS-197636 and BMS-200150 was determined after 3.5 h of incubation. Controldishes received the same amount of Me2SO, i.e. 0.4% final con-centration. In a separate experiment, the effects of MTP inhib-itor, BMS-197636, on the synthesis and secretion of apoB:1000was determined as a function of time. After the indicated incu-bation time, the 35S-labeled conditioned media were col-lected; preservative mixtures at final concentrations of 500units/ml penicillin-G, 50 �g/ml streptomycin sulfate, 20�g/ml chloramphenicol, 1.3 mg/ml �-aminocaproic acid, 1mg/ml EDTA, 1 mM benzamidine, 1 mM phenylmethylsulfo-nyl fluoride, and 100 kallikrein-inactivating units of aproti-nin/ml was added to prevent oxidative and proteolytic dam-age. The media were centrifuged at 2,000 rpm for 30 min at4 °C to remove broken cells and debris. Cell monolayers werewashed with cold PBS, and lysis buffer containing preserva-tive mixture described above plus leupeptin (50 �g/ml) andpepstatin A (50 �g/ml) was added, and cells were processedas described previously (26). The secreted 35S-labeled apoBand albumin in the media and 35S-labeled apoB in cell lysateswere isolated by immunoprecipitation as described below.Metabolic Labeling of the Lipid Content of ApoB-containing

Lipoprotein Particles—Cells were grown in 6-well dishes asdescribed above. At the start of experiments, maintenancemedia were removed; cells were washed twice with PBS andwere incubated for 17 h in serum-free DMEM (for McA-RHcells) or MEM (for HepG2 cells) containing either [3H]glycerol(7 �Ci/ml of medium) or [14C]oleic acid (0.4 mM) bound to0.75% BSA. In experiments where the radiolabeled lipids asso-ciated with apoB-containing particles were determined byautoradiography, cells were labeled with both [3H]glycerol and[14C]oleic acid to enhance the signal. The labeled conditionedmedia were processed and supplemented with preservatives asdescribed above. Cell monolayers were washed with PBS,scraped off the plate in 1.0ml of PBS, and sonicated. The incor-poration of [3H]glycerol or [14C]oleic acid into various lipidmoieties of apoB-containing lipoproteins secreted into themedium and accumulated in the cells was determined byimmunoprecipitation or by nondenaturing gradient gel elec-

trophoresis (NDGGE) as described below. Cell protein contentwas measured by the method of Lowry et al. (38).Immunoprecipitation—The 35S-labeled proteins secreted

into the conditioned media and accumulated in the cells wereimmunoprecipitated using monospecific polyclonal antibodyto human or rat apoB100 coupled to protein G-SepharoseCL-4B as described previously (27, 39). The 35S-labeled albu-min in the conditionedmedia of HepG2 andMcA-RH cells wasdetermined as above using rabbit antibody to human and ratalbumin, respectively. The 35S-labeled proteins were extractedfrom protein G as described previously (26) and resolved on4–12% SDS-PAGE (40). After electrophoresis, the gels wereanalyzed by autoradiography, in conjunction with computer-assisted image processing, or by immunoblotting as describedbelow and in the figure legends.NDGGE—The [3H]glycerol-labeled apoB-containing lipo-

protein particles in the conditioned media were separated on4–20%NDGGEas described previously (26). Gelswere stained,and the bands corresponding to apoB100 (in parentalMcA-RHand HepG2 cells) and apoB:1000 (in stably transfectedMcA-RHcells), identified by immunoblotting of a duplicate gel,were excised and analyzed for lipids as described below. Alter-natively, the incorporation of [3H]glycerol and [14C]oleic acidinto total lipids of intact apoB-containing lipoproteins wasdetermined by NDGGE of the labeled conditioned media andautoradiography.Immunoblot Analysis—The apoB-containing particles were

separated on 4–12% SDS-PAGE (40) or on 4–20% NDGGE.After electrophoresis, proteins were detected by Western blotanalysis (41) using biotinylated antibody to human apoB100 asdescribed previously (26).Lipid Analysis of Isolated Full-length and Truncated ApoB-

containing Particles—The bands corresponding to labeledapoB100- or apoB:1000-containing particles were excised fromNDGGE, and lipids were extracted with chloroform/methanol(2:1) as described previously in detail (27); complete extractionwas assessed by liquid scintillation counting the final gel homo-genate. Total labeled lipids extracted from gel-isolated apoB-containing lipoproteins were washed by the Folch method (42)and applied to a TLC plate as described previously (43). Thebands corresponding to PL, diacylglycerols, and TAG, identi-fied by comparison to known standards, were visualized withiodine; each bandwas scraped off the plate, placed in a countingvial, and quantified by liquid scintillation counting.RT-PCRandSequencing—Total RNA fromparental untrans-

fected McA-RH cells and apoB:1000-expressing stable trans-formants of McA-RH was isolated with TRIzol reagent(Invitrogen). MTP mRNA was determined by one-step semi-quantitative reverse transcriptase (RT)-PCR using sense strandprimer AGGCTGGGGAAGGGCCCGTC and antisensestrand primer AATGTTCTTCACATCCATGT. Glyceralde-hyde-3-phosphate dehydrogenase (GAPDH) mRNA level wasused as internal control using sense strand primer GACAA-GATGGTGAAGGTCGGT and antisense primer TTGGC-CCCACCCTTCAGGTG.Suppression ofMTP Expression bymiRNA—The pre-miRNA

sequences were designed using RNAi designer on-line tool(Invitrogen). Seven different double-stranded oligo duplexes




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

encoding desired miRNA target sequences were selected andcloned into pcDNATM6.2-GW, a BLOCK-iTTM pol II miRRNAi expression vector (Invitrogen). The BLOCK-iTTM pol IImiR RNAi expression vectors are specifically designed to allowexpression of miRNA sequences and contain specific miRflanking sequences that allow proper processing of themiRNA.The vectors also contain the spectinomycin resistance gene forselection in bacteria and the blasticidin resistance gene forselection inmammalian cells. The sequences of one of themostefficient oligo duplexes are as follows: top sequence 5�-GCT-GTTTAAGATGACAGCAGCAGCCGTTTTGGCCACTG-ACTGACGGCTGCTGGTCATCTTAAA-3� and bottomsequence 5�-CCTGTTTAAGATGACCAGCAGCCGTCAG-TCAGTGGCCAAAACGGCTGCTGCTGTCATCTTAAAC-3�. The sequences of the negative control oligo duplex are asfollows: top sequence 5�-GCTGAAATGTACTGCGCGTGG-AGACGTTTTGGCCACTGACTGACGTCTCCACGCAGT-ACATTT-3� and bottom sequence 5�-CCTGAAATGTACTG-CGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCAC-GCGCAGTACATTTC-3�. Escherichia coli DH5� cells weretransformed using the vectors harboring the respective double-stranded oligo encoding the engineered pre-miRNAs. Plasmidswere purified using standard techniques, analyzed to confirmcorrect sequence, and used to transfect apoB:1000-expressingstable transformants of McA-RH cells.Transfecting miRNA into ApoB:1000-expressing McA-RH

Cells—Cells were seeded onto 60-mm dishes and grown inDMEM containing 20% horse serum and 5% FBS as describedabove. After 24 h and at�50–60% confluency, cells were trans-fected using TransIT�-LT1 transfection reagent (Mirus, Mad-ison, WI) according to the manufacturer’s instructions. Thecells were trypsinized 48 h post-transfection and were grown inDMEMcontaining serumand 10�g/ml blasticidin (Invitrogen)to select for clonal stable cells. Cells were then maintained inDMEM containing serum and 5 �g/ml blasticidin for 18–20days; medium was changed twice weekly, and cells wereexpanded every 4 days as described previously (26). Thisapproach was necessary to reduce the level of pre-existingMTP, which has a long half-life, i.e. 4.4 days inHepG2 cells (44).MTP mRNA level was determined by RT-PCR, and MTP pro-tein level was assessed by immunoblotting (41) using polyclonalantibody to bovine MTP 97-kDa large subunit.

RESULTS

MTP Inhibitors Have No Effect on the Secretion or CellularAccumulation of 35S-Labeled ApoB:1000 Expressed inMcA-RH Cells but Markedly Decrease Those of EndogenousFull-length ApoB100 in HepG2 and Parental UntransfectedMcA-RH Cells—The liver-derived McA-RH cells retain theability to synthesize and secrete lipoproteins similar to thosein primary hepatocytes (45). McA-RH cells secrete both ratapoB100 and apoB48 in the form of lipoprotein particle (45)and, unlike human-derived hepatoma HepG2 cells, secrete alarge fraction of apoB100 in the form of VLDL particles (46).McA-RH cells have a high expression capacity (47) and havesuccessfully been used in numerous studies (23, 26, 27, 48–50)as a model to investigate the mechanisms of apoB-containinglipoprotein assembly in the liver.

Using stable transformants of McA-RH cells, we demon-strated previously that the first 1000 amino acid residues ofapoB100 are competent to form the apoB lipid pocket and ini-tiate apoBparticle assemblywithout the structural requirementfor MTP (27). This experimentally derived observation wassupported by our all atommolecular model for apoB:1000 (28).In this study, we examined the putative functional role of MTPin the initial lipidation of nascent apoB:1000 and initiation ofapoB assembly in stable transformants of McA-RH cells. Wetested the effects of two known inhibitors ofMTP lipid transferactivity, BMS-197636 and BMS-200150 (13, 17, 51), on the syn-thesis, lipidation, and secretion of apoB:1000-containing parti-cles stably expressed in McA-RH cells. Because this class ofinhibitors has been shown to markedly decrease the secretionof apoB100-containing particles in HepG2 cells (13) andMcA-RH cells (23, 48), we included these cells as positivecontrols.As the first step, we determined the dose-dependent effects

of BMS-200150 on the de novo synthesis and secretion of apoB:1000 in McA-RH cells and de novo synthesis and secretion ofapoB100 in HepG2 cells. Cells were metabolically labeled with[35S]Met/Cys in the presence or absence of MTP inhibitor for3.5 h.We initially used 5 and 10�M of BMS-200150 that inhibitTAG transfer activity of MTP by 70 and 80%, respectively (13),and have been shown to inhibit apoB100 secretion in HepG2cells by 65 and 90%, respectively (13). As shown in Fig. 1A,BMS-200150 at 5 or 10 �M had no detectable effect on thesecretion or cellular accumulation of 35S-labeled apoB:1000expressed in McA-RH cells. By contrast, the secretion of 35S-labeled apoB100 in HepG2 cells was decreased by 86 and 94%with 5 and 10 �M of BMS-200150, respectively, and its cellularaccumulation was diminished by 65%. This resulted in 83%inhibition in the net de novo synthesis and secretion of apoB100(Fig. 1A). Similar results were obtained after 17 h of incubationwith the inhibitors (data not shown).

FIGURE 1. MTP activity is not required for the synthesis and secretion ofapoB:1000 in McA-RH cells but is required for the secretion of apoB100 inHepG2 cells. Stable transformants of McA-RH cells expressing human (h)apoB:1000 (the N-terminal 1000 residues of full-length apoB100) were grownfor 4 days in DMEM containing 20% HS and 5% FBS. HepG2 cells, whichsecrete apoB100, were grown for 4 days in MEM containing 10% FBS. Afterremoving the maintenance media, cells were washed with PBS and were pre-incubated for 45 min in serum-, methionine-, and cysteine-free DMEM. Freshserum-, methionine-, and cysteine-free DMEM containing [35S]Met/Cys (100�Ci/ml) was added, and cells were incubated for 3.5 h in the presence orabsence of 5 and 10 �M BMS-200150 (A) or 20 �M BMS-200150 (B). The 35S-labeled apoB in cell lysate and secreted into the medium was immunopre-cipitated using monospecific polyclonal antibody to human apoB100, andproteins were separated by 4 –12% SDS-PAGE and subjected to autoradiog-raphy. The autoradiogram is representative of three separate experiments.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

We reasoned that perhaps higher concentrations of BMS-200150 might be necessary to inhibit the secretion of apoB:1000-containing particles. As such, we used 20 �MBMS-200150, a concentration that inhibits the secretion ofapoB100 in HepG2 cells by greater than 90% (13), but weobserved no change in either the secretion or cellular accumu-lation of 35S-labeled apoB:1000 inMcA-RH cells (Fig. 1B). Evenat 40 �M BMS-200150, a concentration that almost completelyabolished the secretion of human endogenous apoB100 inHepG2 cells (Fig. 2 and Fig. 3B) and rat endogenous apoB100 inparental untransfectedMcA-RH cells (Fig. 2 and Fig. 3C), therewas no change in the cellular accumulation of 35S-labeled apoB:1000, and only amodest 15–20%decrease in its secretion (Fig. 2and Fig. 3A).Another potent inhibitor of MTP lipid transfer activity,

BMS-197636, which is effective at very low concentrations, i.e.0.1 and 0.2 �M (48, 52), was also tested. BMS-197636 had noeffect on the synthesis or secretion of 35S-labeled apoB:1000 inMcA-RH cells at either 0.1 �M (Fig. 2 and Fig. 3A) or 0.2 �M(data not shown). The unchanged synthesis and secretion of35S-labeled apoB:1000 in the presence of 0.1 �M BMS-197636was sustained over the range of 2–24 h of incubation as com-pared with cells incubated withMe2SO control (Fig. 4). By con-trast, 0.1 �M BMS-197636 inhibited the secretion and cellularaccumulation of 35S-labeled endogenous apoB100 by 90 and60%, respectively, in HepG2 cells (Fig. 2 and Fig. 3B) and by 87and 56%, respectively, in parental untransfected McA-RH cells(Fig. 2 and Fig. 3C). To establish the specificity of the effects ofMTP inhibitors on apoB production, their influence on thesecretion of newly synthesized albumin, a marker of hepaticprotein synthesis and secretion, was also determined in both

cell lines. The secretion of 35S-labeled human albumin inHepG2 cells and rat albumin inMcA-RH cells was not affectedby either 0.1 �M BMS-197636 or 20 �M BMS-200150 (Fig. 3D).At 40�MBMS-200150, the secretion of newly synthesized albu-min was inhibited by �20–25% in both cell lines (Fig. 3D).These results clearly showed that the inhibitory effect of 0.1�MBMS-197363 and 5, 10, and 20 �M BMS-200150 on the synthe-sis and secretion of apoB100 in HepG2 and parental untrans-fected McA-RH cells was specific. Furthermore, results dem-onstrated that themoderate inhibition in the secretion of apoB:1000 in stable transformants of McA-RH cells by 40 �M BMS-200150 was due, most likely, to the effect of a highconcentration of this compound generally on cell metabolism.The MTP inhibitors did not have any significant effect on thecell protein content. In a series of 10 experiments, the totalprotein content of cells, expressed as mean � S.E. (n � 20), inMe2SO control, 0.1 �M BMS-197636, and 40 �M BMS-200150was 1.72 � 0.06, 1.72 � 0.08, and 1.69 � 0.1 mg/dish, respec-tively, for apoB:1000-expressing McA-RH cells; 1.82 � 0.11,1.75 � 0.10, and 1.78 � 0.16 mg/dish, respectively, for HepG2cells; and 1.50� 0.05, 1.60� 0.07, and 1.31� 0.13, respectively,for parental untransfected McA-RH cells. These results indi-cate that the inhibitors, at concentrations used in this study,were not cytotoxic.MTP Lipid Transfer Activity Is Not Required for the Initial

Lipidation of ApoB:1000 in Stable Transformants of McA-RHCells—We next examined the effects of MTP inhibitors on thelipidation of apoB:1000. McA-RH cells stably expressing apoB:1000, parental untransfected McA-RH cells, and HepG2 cellswere incubated for 17 h with serum-free medium containing[3H]glycerol (7 �Ci/ml of medium) and [14C]oleic acid (0.4 mMbound to 0.75% BSA) in the presence or absence of 0.1 �MBMS-197636 or 40 �M BMS-200150. The labeled conditionedmediawere concentrated and subjected toNDGGE followed byautoradiography as described previously (27) and under the“Experimental Procedures.” Bands corresponding to apoB:1000-containing particles in stable McA-RH cells, rat endoge-nous apoB100-containing particles in parental untransfectedMcA-RH cells, and human endogenous apoB100-containingparticles in HepG2 cells, were identified by their Stokes diam-eter (Sd), immunoblotting with antibody to human or ratapoB100, and their co-mobility with control plasma LDL, whenapplicable, of a duplicate gel. The intensities of the labeled lipidsassociated with the apoB-containing particles were measuredby computer-assisted image processing. We observed thatcompared with Me2SO control (Fig. 5, A–C, lane 1), 0.1 �MBMS-197636 had no effect on the 3H/14C-labeled lipid contentof intact apoB:1000-containing particles in stable transfor-mants of McA-RH cells (Fig. 5B, lane 2) but reduced that asso-ciated with intact endogenous apoB100-containing lipopro-teins by 70% in both parental untransfectedMcA-RH cells (Fig.5A, lane 2) and in HepG2 cells (Fig. 5C, lane 2). BMS-200150 at40 �M caused only a modest 13% inhibition in the 3H/14C-la-beled lipid content of apoB:1000-containing particles secretedby stable transformants of McA-RH cells (Fig. 5B, lane 3) butnearly abolished that of endogenous apoB100-containing par-ticles secreted by both parental untransfected McA-RH cells(Fig. 5A, lane 3) andHepG2 cells (Fig. 5C, lane 3). The inefficacy

FIGURE 2. Inhibition of MTP lipid transfer activity by BMS-197636 andhigh concentration of BMS-200150 does not affect the synthesis andsecretion of apoB:1000 in McA-RH cells, but almost completely abolishesthose of endogenous apoB100 in HepG2 and parental untransfectedMcA-RH cells. Stable transformants of McA-RH expressing human apoB:1000and HepG2 and parental untransfected McA-RH cells secreting endogenoushuman and rat apoB100, respectively, were grown as described in the legendto Fig. 1. Cells were incubated for 3.5 h with serum-, methionine-, and cys-teine-free DMEM containing [35S]Met/Cys (100 �Ci/ml) in the presence orabsence of the 0.1 �M BMS-197636 or 40 �M BMS-200150. 35S-Labeled apoB incell lysates and media were immunoprecipitated with antibody to humanapoB100 (hApoB100) in apoB:1000 expressing McA-RH and HepG2 cells or ratapoB100 (rApoB100) in parental untransfected McA-RH cells. Proteins wereseparated by 4 –12% SDS-PAGE and subjected to autoradiography. The auto-radiogram is representative of three separate experiments. DMSO, Me2SO.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

of MTP inhibitors in decreasing the lipidation and secretion ofapoB:1000-containing particles was not because of altered lipidmetabolism in the transfected McA-RH cells. The rate of[14C]oleic acid (0.4mMbound to 0.75%BSA) incorporation intosecreted total lipids, expressed as nanomoles/mg cell protein,

was 16.27 � 0.52 and 18.81 � 0.71(mean � S.E., n � 3) in parentaluntransfected and apoB:1000-ex-pressing McA-RH cells, respec-tively. The corresponding values forcellular total lipids were 238.92 �0.68 and 203.97� 7.85, respectively.Inhibition of MTP Activity Has

No Effect on the Concentration orComposition of Newly SynthesizedLipids Associated With ApoB:1000-containing Particles Secretedby StableTransformants ofMcA-RHCells—To test if MTP inhibitorsaltered the composition of lipidsassociated with the secreted apoB:1000-containing particles withoutaffecting their concentrations, cellswere metabolically labeled with[3H]glycerol for 17 h in the presenceor absence of the MTP inhibitors.The labeled conditioned mediawere concentrated 10-fold andweresubjected to NDGGE for 48 h. Gelswere subsequently stained, andbands corresponding to secretedintact apoB:1000-containing parti-cles were excised from the gels. Lip-ids were extracted from the excisedbands and separated on TLC asdescribed previously (27).Results showed that compared

with Me2SO control, BMS-197636at 0.1�MandBMS-200150 at 10 and20 �M had no detectable effect oneither the concentration or the

composition of 3H-labeled lipids associated with apoB:1000-containing particles (Table 1), confirming the results obtainedby autoradiography (Fig. 5B). BMS-200150 at 40 �M caused amodest 15%decrease in the 3H-labeled lipid content of secretedintact apoB:1000-containing particles without altering theirlipid composition (Table 1). MTP inhibitors likewise had noeffect on the concentration or composition of newly synthe-sized lipids accumulated in apoB:1000-expressing McA-RHcells (Table 1). Similar results were obtained when apoB:1000-containing particles were isolated by immunoprecipi-tation using polyclonal antibody to human apoB100 (datanot shown). These results corroborated the effects of theseinhibitors of MTP lipid transfer activity on the newly synthe-sized and secreted 35S-labeled apoB:1000 (Figs. 1–3) and3H/14C-labeled lipids in intact particles determined by auto-radiography (Fig. 5B).Inhibition of MTP Lipid Transfer Activity Drastically

Decreases the Concentration and Alters the Composition ofNewly Synthesized Lipids Associated With EndogenousApoB100-containing Particles Secreted by HepG2 and ParentalUntransfectedMcA-RH Cells—HepG2 cells were incubated for17 h with [3H]glycerol as described above. Labeled conditioned

FIGURE 3. De novo synthesis and secretion of apoB lipid pocket formed by the N-terminal 1000 residuesof apoB are independent of MTP lipid transfer activity. McA-RH cells stably expressing human apoB:1000and HepG2 and parental untransfected McA-RH cells secreting human and rat endogenous apoB100, respec-tively, were grown under conditions described in the legend to Fig. 1. Cells were incubated with 35S-labeledmethionine/cysteine (100 �Ci/ml) in the presence or absence of the 0.1 �M BMS-197636 or 20 and 40 �M

BMS-200150 as described in the legend to Fig. 1. 35S-Labeled apoB:1000 in cell lysate and secreted into themedium of stable transformant of McA-RH cells (A), 35S-labeled human endogenous apoB100 in cell lysate andsecreted into the medium of HepG2 cells (B), and 35S-labeled rat endogenous apoB100 in cell lysate andsecreted into the medium of parental untransfected McA-RH cells (C) were immunoprecipitated with antibodyto human or rat apoB100 as described in the legend to Fig. 1. 35S-Labeled human and rat albumin secretedinto the conditioned media of HepG2 and McA-RH cells, respectively (D), were immunoprecipitated usingantibody to human and rat albumin, respectively, as described under “Experimental Procedures.” Theimmunoprecipitated apoB and albumin were resolved by 4 –12% SDS-PAGE and subjected to autoradiogra-phy. The intensity of the labeled proteins was determined by computer-assisted image processing. Each barrepresents the mean � S.E. of seven samples from three separate experiments normalized to cell protein andexpressed as a percentage of values in Me2SO (DMSO)-treated cells.

FIGURE 4. The inefficacy of BMS-197636 to inhibit the synthesis andsecretion of apoB:1000 in stable transformants of McA-RH cells is sus-tained over a 24-h incubation time. McA-RH cells stably expressing humanapoB:1000 were grown under conditions described in the legend to Fig. 1.Cells were incubated for the indicated time in serum-free DMEM containing[35S]Met/Cys (100 �Ci/ml) in the presence or absence of the 0.1 �M BMS-197636. 35S-Labeled apoB:1000 in the cell lysate and secreted into themedium was immunoprecipitated with antibody to human apoB100, andproteins were separated by 4 –12% SDS-PAGE and subjected to autoradiog-raphy as described in the legend to Fig. 1.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

media were subjected to NDGGE, and apoB100-containingparticles were identified by their co-mobility with humanplasma LDL and immunoblotting with antibody to humanapoB100. Intact particles were excised from the gels and ana-lyzed for lipids as described above. In sharp contrast to the

results obtained for apoB:1000 (Table 1), BMS-197636 (0.1�M)and BMS-200150 at all concentrations tested decreased the3H-labeled lipids associatedwith apoB100 by 75–90% (Table 2).AlthoughMTP inhibitors decreased all lipid species associatedwith the intact apoB100-containing lipoproteins, this reductionwas more pronounced in TAG, resulting in the secretion ofparticles that contained more PL and less TAG (Table 2). TheMTP inhibitors had no significant effect on the cellular concen-tration or composition of newly synthesized lipids in HepG2cells (Table 2). Similar results were obtained when apoB100-containing particles were isolated by immunoprecipitationusing polyclonal antibody to human apoB100 (data not shown).To assess the effects of MTP inhibitors on the lipid content

and composition of the secreted rat endogenous apoB100-con-taining particles, parental untransfected McA-RH cells weremetabolically labeled with [3H]glycerol in the presence orabsence of MTP inhibitors, as described for apoB:1000-ex-pressing McA-RH and HepG2 cells. The labeled conditionedmedia were concentrated and applied to NDGGE. Bands cor-responding to LDL-sized endogenous apoB100-containingparticles, identified by their apparent Sd, which was same asthat of plasma LDL, and immunoblotting with antibody to ratapoB100, were excised, and lipids were extracted as describedunder “Experimental Procedures.” As shown in Table 3, thetotal lipid content of rat apoB100-containing particles wasdecreased by 35 and 65% with BMS-197636 and BMS-200150,respectively. Similarly to that in HepG2 cells (Table 2), thedecrease in the presence of 40 �M BMS-200150 was more pro-nounced in TAG, resulting in the secretion of particles thatcontainedmore PL and less TAG (Table 3).MTP inhibitors hadno effect on the accumulation of lipids in the cells (Table 3).These results indicate that, as in HepG2 cells, the inhibitors of

FIGURE 5. Lipidation, assembly, and secretion of intact apoB:1000-con-taining particles are independent of MTP lipid transfer activity. Parentaluntransfected McA-RH cells secreting rat endogenous apoB100 (A), McA-RHcells stably expressing human apoB:1000 (B), and HepG2 cells secretinghuman endogenous apoB100 (C) were grown under conditions described inthe legend to Fig. 1. Cells were incubated for 17 h in serum-free DMEM con-taining 0.4 mM [14C]oleic acid bound to 0.75% BSA and [3H]glycerol (7 �Ci/ml)in the absence (lane 1) or presence of 0.1 �M BMS-197636 (lane 2) or 40 �M

BMS-200150 (lane 3). The labeled conditioned media were concentrated, andintact apoB-containing particles were separated by 4 –20% NDGGE. Gels werestained, dried, subjected to autoradiography, and analyzed by computer-assisted image processing. Sd, Stokes diameter.

TABLE 1Effects of MTP inhibitors on �3H�glycerol-labeled lipids accumulated in the cells and associated with secreted human apoB:1000-containingparticles in stable transformant of McA-RH cellsCells were incubated with serum-free DMEM and 3H-labeled glycerol (7 �Ci/ml medium) in the presence or absence of MTP inhibitors. Secreted particles were isolatedby NDGGE and analyzed for lipids. Values are means � S.E. of seven samples from three separate experiments normalized to cell protein. DAG indicates diacylglycerol.

MTP inhibitor Concentration

3H-Labeled lipids associated withsecreted apoB:1000-containing particles Cellular 3H-labeled lipids

Total lipids PL DAG TAG Total lipids PL DAG TAG% control % composition % control % composition

Me2SO 0.4% 99 � 2 64 � 1 11 � 1 25 � 1 100 � 2 87 � 2 8 � 1 6 � 1BMS-197636 0.1 �M 98 � 4 66 � 1 11 � 1 24 � 1 104 � 4 84 � 3 9 � 1 4 � 1BMS-200150 10 �M 90 � 2 66 � 2 7 � 1 26 � 2 110 � 3 93 � 1 5 � 1 2 � 1BMS-200150 20 �M 94 � 7 63 � 1 11 � 1 25 � 2 99 � 1 94 � 1 5 � 1 1 � 1BMS-200150 40 �M 85 � 4 65 � 1 11 � 1 24 � 1 107 � 7 82 � 5 6 � 1 4 � 1

TABLE 2Effects of MTP inhibitors on �3H�glycerol-labeled lipids accumulated in the cells and associated with secreted human endogenousapoB100-containing lipoproteins in HepG2 cellsCells were incubatedwith serum-free DMEM, and the incorporation of �3H�glycerol (7�Ci/ml ofmedium) into cellular lipids and secreted into themedium in the presenceor absence of MTP inhibitors was determined. Values are mean � S.E. of seven samples from three separate experiments normalized to cell protein. DAG indicatesdiacylglycerol.


3H-Labeled lipids associated withsecreted apoB100-containing particles Cellular 3H-labeled lipids


Me2SO 0.4% 100 � 3 40 � 3 9 � 1 51 � 3 100 � 2 67 � 2 8 � 1 25 � 2BMS-197636 0.1 �M 27 � 2 47 � 4 11 � 1 42 � 3 96 � 4 66 � 2 9 � 1 25 � 2BMS-200150 10 �M 27 � 6 47 � 2 10 � 1 43 � 3 80 � 2 77 � 1 4 � 1 18 � 1BMS-200150 20 �M 17 � 1 52 � 6 9 � 1 38 � 5 109 � 3 72 � 1 8 � 1 20 � 1BMS-200150 40 �M 10 � 1 51 � 5 10 � 1 39 � 3 87 � 6 69 � 1 8 � 1 23 � 1




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

MTP lipid transfer activity decreased the number of secretedendogenous apoB100-containing particles in parental untrans-fected McA-RH cells and that these particles contained lessTAG.MTP Level Is Not Altered in ApoB:1000-expressing Stable

Transformants of McA-RH Cells—The unchanged synthesisand secretion of apoB:1000 in stable transformants ofMcA-RHcells in the presence ofMTP inhibitors could be due to potentialalteration in theMTP expression level in these cells. To test thispossibility, wemeasuredMTPmRNAand protein levels by RT-PCR and Western blot, respectively, in both the parentaluntransfected and apoB:1000-expressing McA-RH cells. Asshown in Fig. 6A (representative of three individual dishes), wefound equivalent levels of MTPmRNA and protein in both celllines. These results validate the above observations and rule outthe possibility that altered MTP expression in transfectedMcA-RH cells might be the reason for the ineffectiveness ofMTP inhibitors to decrease the synthesis and secretion ofapoB:1000.Suppression of MTP Gene Expression in Stable Transfor-

mants of McA-RH Cells by miRNA Has No Effect on the Secre-tion of ApoB:1000—To further substantiate our hypothesis thataddition of phospholipids to apoB:1000 and initiation of apoBparticle assembly occur independently of MTP activity, weemployed RNAi to suppress MTP gene expression. McA-RHcells stably expressing apoB:1000 were transfected with either

MTP miRNA or negative control miRNA as described under“Experimental Procedures.”As shown in Fig. 6B (representativeof three individual dishes), transfection of cells with MTPmiRNA resulted in �60% decrease in MTP mRNA level ascompared with cells transfected with negative control miRNA.The GAPDHmRNA level was the same in both cell lines estab-lishing the specificity ofMTPmiRNA (Fig. 6B). After 18 days inDMEM-containing serumandblasticidin (5�g/ml ofmedium),the secretion of 35S-labeled apoB:1000 in both cell lines wasdetermined and was compared with theMTP protein levels. Asshown in Fig. 7, transfection of cells withMTPmiRNA led to an�70% decrease inMTP protein level when compared with cellstransfected with negative control miRNA. In contrast, therewas no change in the secretion of 35S-labeled apoB:1000 in

FIGURE 6. MTP mRNA and protein levels are not altered in McA-RH cellsstably expressing apoB:1000. A, MTP mRNA and protein levels in the paren-tal untransfected and stable transformants apoB:1000-expressing McA-RHcells were determined by RT-PCR and Western blot, respectively. B, McA-RHcells stably expressing apoB:1000 were transfected with MTP miRNA or neg-ative control miRNA as described under “Experimental Procedures.” The lev-els of MTP mRNA and GAPDH internal control were determined by RT-PCR.

FIGURE 7. Suppression of MTP gene expression does not affect the secre-tion of apoB:1000 in stable transformants of McA-RH cells. A, stable trans-formants of McA-RH cells expressing apoB:1000 were transfected with MTPmiRNA or negative control miRNA, as described in the legend to Fig. 6. Cellswere grown for 18 days in DMEM-containing serum and blasticidin (5 �g/mlof medium). Both cell lines were incubated for 3.5 h in serum-, methionine-,and cysteine-free DMEM containing [35S]Met/Cys (100 �Ci/ml). The 35S-la-beled apoB:1000 secreted into the medium was immunoprecipitated usingmonospecific polyclonal antibody to human apoB100, and proteins wereseparated by 4 –12% SDS-PAGE and subjected to autoradiography. Cellmonolayers from duplicate dishes were washed with PBS and analyzed forMTP protein level by Western blot. B, intensities of the MTP protein and 35S-labeled apoB:1000 bands were determined by computer-assisted imageprocessing, normalized for cell protein, and plotted as mean � S.E. of tripli-cate dishes.

TABLE 3Effects of MTP inhibitors on �3H�glycerol-labeled lipids accumulated in the cells and associated with secreted rat endogenousapoB100-containing particles in parental untransfected McA-RH cellsCells were incubated with serum-free DMEMand �3H�labeled glycerol (7�Ci/ml ofmedium) in the presence or absence ofMTP inhibitors. Secreted particles were isolatedby NDGGE and analyzed for lipids. Values are means � S.E. of nine samples for total lipids and seven samples for lipid composition from three separate experimentsnormalized to cell protein. DAG indicates diacylglycerol.


3H-Labeled lipids associated withsecreted apoB:1000-containing particles Cellular 3H-labeled lipids


Me2SO 0.4% 98 � 4 51 � 4 15 � 2 34 � 3 100 � 3 89 � 1 6 � 1 6 � 1BMS-197636 0.1 �M 68 � 3 50 � 4 17 � 2 33 � 3 93 � 4 88 � 2 7 � 1 7 � 2BMS-200150 20 �M 43 � 4 44 � 5 21 � 2 33 � 5 102 � 8 89 � 3 5 � 1 5 � 1BMS-200150 40 �M 37 � 3 66 � 5 14 � 1 20 � 4 92 � 7 86 � 1 6 � 1 8 � 1




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

McA-RH cells transfectedwithMTPmiRNA as comparedwithcells transfected with negative control miRNA (Fig. 7).

DISCUSSION

We previously suggested (53, 54), based on sequence homol-ogy between the��1 domain of apoB (N-terminal 1000-residuedomain of apoB100) and LV (54–57), that this region is homol-ogous to the proposed lipid binding cavity in LV, and therefore,this domain might be a lipid-binding pocket for apoB (54). Weproposed that formation of an LV-like lipid pocket is necessaryfor lipid transfer to apoB-containing lipoprotein particles, andwe suggested (53, 54) that initiation of particle assembly occurswhen the ��1 domain folds into a three-sided LV-like lipidbinding cavity. Alternatively, the lipid pocket we propose isformed by association of the region of the ��1 domain homol-ogous to the �A and �B sheets of LV with �D-like amphipathic�-sheet from MTP (53, 54). In our initial studies (26), we pro-vided evidence for the formation of a lipid pocket intermediatein the assembly of apoB-containing lipoproteins by the N-ter-minal 1000 amino acid residues of apoB100. We demonstratedthat apoB:1000 is secreted by stable transformants of McA-RHcells as a monodisperse, relatively lipid-enriched particle in theHDL3-like density range (26). In subsequent studies, our exper-imentally derived results (27) and all atommolecular modelingof the ��1 domain (28) demonstrated that the N-terminal 1000amino acid residues of apoB100 are necessary and competent toform the lipid pocket without the structural requirement forMTP and that the lipid pocket is PL-rich (27). These results,however, did not exclude the putative functional role ofMTP inthe initial lipidation of apoB:1000.To determine whether addition of phospholipids to apoB:

1000 and the formation of the PL-rich initiation complex inapoB assembly is dependent on MTP lipid transfer activity, wetested the effects of two well characterized (13, 34) and widelyused (13, 17, 20, 23, 33, 48, 52) inhibitors of MTP lipid transferactivity, BMS-197636 and BMS-200150, on the de novo synthe-sis, lipidation, and secretion of apoB:1000 in stable transfor-mants of McA-RH cells. To provide more definitive evidencefor our hypothesis that the initial step in apoB particle assemblyis independent of MTP activity, we suppressed MTP geneexpression in apoB:1000-expressing McA-RH cells by miRNA,and we assessed potential correlation between MTP proteinlevel and apoB:1000 secretion.Results clearly and consistently demonstrated that BMS-

200150 at 5, 10, or 20 �M and BMS-197636 at 0.1 or 0.2 �M hadno detectable effect on either the synthesis and secretion of35S-labeled apoB:1000 or the content and composition of lipidsassociated with the secreted intact apoB:1000-containing par-ticles in stable transformants of McA-RH cells. In marked con-trast, and consistent with previously reported studies inHepG2cells (13, 51) and McA-RH cells stably expressing humanapoB100 (23, 48), the secretion of 35S-labeled endogenousapoB100 in HepG2 and parental untransfected McA-RH cellswas inhibited by 86–94% with 5–20 �M BMS-200150 and wasalmost completely abolished with 0.1 �M BMS-197636. Even at40 �M of BMS-200150, a concentration that almost completelyabolished the synthesis and secretion of 35S-labeled endoge-nous apoB100 in HepG2 and parental untransfected McA-

RH7777 cells, we observed only a modest 15–20% inhibition inapoB:1000 lipidation and secretion in McA-RH cells. Becausealbumin secretion, a measure of hepatic function, was alsodecreased to the same extent, the observed inhibitory effect of40 �M BMS-200150 on apoB:1000 could be attributed to thenonspecific effect of a high concentration of this compound onhepatic protein synthesis.The lack of requirement ofMTP lipid transfer activity for the

synthesis and secretion of apoB:1000 was also evident in theunchanged lipid content and composition of the secreted intactapoB:1000-containing particles in the presence of BMS-197636(0.1 �M) and BMS-200150 (5–20 �M). The moderate 18%reduction in total lipid content of apoB:1000 with 40 �M BMS-200150, which correlated with a similar decrease in the de novosynthesis and secretion of apoB:1000, was because of its appar-ent nonspecific effect on hepatic protein synthesis. Under iden-tical experimental conditions, the labeled lipids associated withintact endogenous apoB100-containing particles secreted byHepG2 and parental untransfected McA-RH cells were eitherdrastically decreased or almost completely abolished. Theseparticles also had a lower content of TAG and higher level of PLas compared with those secreted by control Me2SO-treatedcells. The MTP inhibitors, however, did not have any effect oneither the concentration or composition of cellular lipids ineither HepG2 cells or parental untransfectedMcA-RH cells, anobservation similar to that reported by Wang et al. (23). Theinability ofMTP inhibitors to decrease the lipidation and secre-tion of apoB:1000-containing particles was not because ofaltered lipid metabolism in transfected McA-RH cells, as dem-onstrated by a similar rate of secretion of newly synthesizedlipids into the conditionedmedia of parental untransfected andapoB:1000-expressing McA-RH cells. Thus, by careful dose-response (Figs. 1–3 and Table 1) and time course (Fig. 4) exper-iments, we have demonstrated that the synthesis, lipidation,and secretion of apoB:1000-containing particles are independ-ent of MTP lipid transfer activity.To further validate the results obtained with the inhibitors of

MTP lipid transfer activity, we suppressed MTP gene expres-sion in apoB:1000-expressing McA-RH cells by miRNA. First,we found equivalent levels of MTP mRNA and protein inparental untransfected and apoB:1000-expressing McA-RH7777 cells. These results established that the inefficacy ofBMS-197636 and BMS-200150 to inhibit the synthesis andsecretion of apoB:1000 in McA-RH cells was not because ofaltered expression level ofMTP in these cells. Second, suppres-sion of MTP gene expression in stable transformants ofMcA-RH cells by miRNA led to a 60–70% reduction in MTPmRNA and protein levels. However, MTP deficiency had nodetectable effect on the secretion of 35S-labeled apoB:1000 inthese cells, corroborating the results obtained with the inhibi-tors of MTP lipid transfer activity. Collectively, these resultsstrongly support our hypothesis that the synthesis, PL addition,and secretion of apoB:1000-containing particles are independ-ent of the lipid transfer activity of MTP.MTP has a distinct preference for TAG transfer and its lipid

transport rate decreases in the order of TAG � cholesterylesters � diacylglycerol � cholesterol � PL (11, 52, 58, 59). In arecent study, Rava et al. (60) have supported our previous stud-




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

ies demonstrating that the primordial apoB-containing parti-cles are PL-rich (26–28) and have proposed that the PL transferactivity of MTP is sufficient for the assembly and secretion ofprimordial apoB lipoproteins. This conclusion was basedmainly on the observations derived from the effect of Dro-sophila MTP on the secretion of truncated forms of humanapoB in COS cells (60). These investigators showed thatDro-sophilaMTP, which is defective in TAG transfer activity buthas PL transfer activity equal to that of human MTP, sup-ports the secretion of human apoB48, apoB53, and apoB72 inCOS cells (60). Our results, indicating that MTP activity isnot required for the initiation of apoB assembly, are at vari-ance with the conclusion reached by Rava et al. (60).Although we do not know the exact reason for this discrep-ancy, we speculate that the inconsistency in the results arise,most likely, from the use of cell lines with distinctly differenttissue origins. Several differences between the two cell lines,with regard to lipoprotein metabolism, are noteworthy andare outlined below.First, in our study, we used lipoprotein producing rat hepa-

toma McA-RH cells, whereas Rava et al. (60) used COS cells,transformed African green monkey kidney fibroblast cells,which normally do not produce lipoproteins. Second, in thestudy by Rava et al. (60), the secretion of apoB18 in COS cellswas considerably higher than that of apoB48 and especiallyapoB53, whereas in McA-RH cells, apoB18 was secreted muchmore slowly than apoB48 and apoB53 (47). Third, Rava et al.(60) demonstrated thatMTP is not required for the secretion ofapoB18. Relevant to this finding are studies demonstrating thatapoB17 readily associates with phospholipids (61–63). Assum-ing that PL transfer activity of MTP is sufficient for the forma-tion of primordial apoB particles, it is reasonable to expect thatthe secretion of apoB18 in COS cells would increase, at leastpartially, by the expression of Drosophila MTP; this was notobserved by Rava et al. (60). Fourth, Rava et al. (60) were unableto measure any significant PL transfer activity in cell lysates ofCOS cells expressing either human or Drosophila MTP. Inaddition, these investigators (60) observed 72% decrease inTAG transfer activity in mouseMttp gene-deleted liver homo-genates but did not detect any change in PL transfer activity,indicating the presence of other PL transfer activities. In ourstudies, we found similar levels of MTP mRNA and protein inparental untransfected and apoB:1000-expressing McA-RHcells (Fig. 6), and we demonstrated that miRNA-mediated 70%decrease in MTP protein level had no effect on the secretion of35S-labeled apoB:1000 (Fig. 7). Fifth, in the study by Rava et al.(60), the secretion of apoB48 in COS cells was shown to bedependent onMTP expression. In contrast, studies byWang etal. (23) demonstrated that in McA-RH cells, the assembly/secretion of apoB48 HDLwas relatively unaffected by theMTPinhibitor, suggesting that secretion of apoB48 in liver-derivedcells may not depend on MTP activity. Considering the com-plexity of apoB-containing lipoprotein assembly, COS cellsmaynot have the full complement of numerous factors and chaper-ons known to be necessary for apoB-containing particle matu-ration (2). This possibility is supported by studies demonstrat-ing that nonhepatic cell lines synthesize apoB but cannotprocess it into lipoproteins (64).

Several lines of evidence support our results and conclusion.First, the PL transfer activity of MTP, which is �5% of its TAGtransfer activity, is inhibited by 60% in the presence of 0.1�M ofBMS-197636 (52). Our results demonstrated that 0.1 �M ofBMS-197636 had no detectable effect on either the synthesisand secretion of 35S-labeled apoB:1000 (Figs. 2–4) or the con-centration and composition of 3H-labeled lipids associatedwithintact apoB:1000-containing particles secreted by stableMcA-RH cells (Fig. 5 and Table 1). Second, BMS-200150 at5–20�M inhibits PL transfer activity of human (13) and rat (60)MTP by 30–40%,MTP lipid transfer activity in HepG2 cells by80–90% (51), and the synthesis, lipidation, and secretion ofendogenous apoB100-containing particles in HepG2 andparental untransfected McA-RH cells by 70–95%, as shown inthis study (Figs. 1 and 3 and Tables 2 and 3). Our results clearlydemonstrated that these concentrations of BMS-200150hadnodetectable effect on the de novo synthesis, lipidation, and secre-tion of apoB:1000-containing particles in McA-RH cells (Figs.1–3 and Table 1). Third, although MTP has been proposed tobe crucial for the proper folding and lipidation of apoB duringtranslocation into the lumen of ER (15, 18, 19), in vitro transla-tion studies have shown that apoB48 is efficiently translocatedinto the lumen of dog pancreas microsomes in which the activ-ity of MTP is not detectable (65). Fourth, in McA-RH cells,the secretion of human apoB29 and apoB18 was not affectedby theMTP inhibitor 4�-bromo-3�-methylmetaqualone (66).In mouse primary hepatocytes, BMS-197636 inhibited thesecretion of apoB100 by 90%, whereas apoB48 secretion wasonly slightly decreased (21). In mouse hepatocyte-like cell lineMhAT3F, which produces both apoB100 and apoB48, MTPinhibitor preferentially blocked the secretion of apoB100 (66).In HepG2 cells, synthesis of apoB polypeptides the size of 100–200 kDa was insensitive to MTP inhibitors, suggesting thatMTP inhibitors did not affect the initiation of apoB100 trans-lation (16). In human-derived differentiated intestinal Caco-2cells, BMS-200150 impaired the secretion of apoB100, whereasapoB48 secretion was relatively unaffected (67). Fifth, the liver-specific inactivation of the Mttp gene in the mouse loweredapoB100 levels in plasma by �95% but reduced plasma apoB48levels by only 20% (24), and MTP-deficient mouse hepatocytessecreted apoB-containing lipoproteins of HDL and LDL sizesbut not VLDL-sized lipoproteins (68).In summary, we investigated the putative functional role of

MTP in the initiation of apoB assembly relying on the use of twoinhibitors of MTP lipid transfer activity, BMS-197636 andBMS-200150, and suppression of MTP gene expression bymiRNA. Both inhibitors consistently failed to affect the synthe-sis, lipidation, assembly, and secretion of apoB:1000-containingparticles in stable transformants of McA-RH cells indicatingthatMTP activity is not required for the initial addition of PL tothe growing polypeptide. ThemiRNA-mediated suppression ofMTP gene expression led to a 60–70% reduction in MTPmRNA and protein levels but had no detectable effect on thesecretion of apoB:1000 in McA-RH cells. From the perspectiveof apoB assembly, our results do not rule out the role ofMTP inthe first step assembly of apoB-containing particles. At present,the structural elements within the apoB polypeptide that gov-ern requirement for MTP are not known. Available evidence




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

suggest the following: (i) segments equal to or greater thanapoB48 containing the N-terminal 17% of the protein respondtoMTP activity (14); (ii) sequences in the C terminus of apoB29bindPL (69); (iii) sequences between apoB29 and apoB32.5 aug-ment TAG binding (69); (iv) sequences between apoB32.5 andapoB41 account for themarked incorporation of TAG (69); and(v) the domain between apoB51 and apoB53 has a high require-ment for MTP (66), and this region is within the �2 domain ofapoB100 (53). Our results provide a compelling argument thatthe addition of phospholipids to apoB:1000 (apoB22.05), initi-ation of apoB particle assembly, and the formation of the pri-mordial PL-rich apoB-containing lipoproteins are independentof MTP lipid transfer activity. We propose that factor(s) otherthan MTP mediate this early stage of apoB lipoprotein particleassembly. Identification of this factor would render it an effica-cious pharmacological target to reduce the formation of athero-genic apoB-containing lipoproteins at the very early stage.

Acknowledgments—We thank Dr. David Gordon and Dr. J. R. Wet-terau (Bristol-Myers Squibb Co.) for providing BMS-197636, BMS-200150, and the antibody toMTP.We thank Dr. Zemin Yao (Univer-sity of Ottawa Heart Institute, Ottawa, Ontario) for providingapoB100 cDNA.

REFERENCES1. Schumaker, V. N., Phillips, M. L., and Chatterton, J. E. (1994)Adv. Protein

Chem. 45, 205–2482. Fisher, E. A., and Ginsberg, H. N. (2002) J. Biol. Chem. 277, 17377–173803. Knott, T. J., Pease, R. J., Powell, L.M.,Wallis, S. C., Rall, S. C., Jr., Innerarity,

T. L., Blackhart, B., Taylor,W.H.,Marcel, Y.,Milne, R., Johnson,D., Fuller,M., Lusis, A. J., McCarthy, B. J., Mahley, R.W., Levy-Wilson, B., and Scott,J. (1986) Nature 323, 734–738

4. Yang, C. Y., Chen, S. H., Gianturco, S. H., Bradley, W. A., Sparrow, J. T.,Tanimura,M., Li,W. H., Sparrow, D. A., DeLoof, H., Rosseneu,M., Lee, F.S., Gu, Z. W., Gotto, A. M., Jr., and Chan, L. (1986) Nature 323, 738–742

5. Elovson, J., Chatterton, J. E., Bell, G. T., Schumaker, V. N., Reuben, M. A.,Puppione, D. L., Reeve, J. R., Jr., and Young, N. L. (1988) J. Lipid Res. 29,1461–1473

6. Alexander, C. A., Hamilton, R. L., and Havel, R. J. (1976) J. Cell Biol. 69,241–263

7. Olofsson, S. O., Stillemark-Billton, P., and Asp, L. (2000) Trends Cardio-vasc. Med. 10, 338–345

8. Davis, R. A. (1999) Biochim. Biophys. Acta 1440, 1–319. Hamilton, R. L., Wong, J. S., Cham, C. M., Nielsen, L. B., and Young, S. G.

(1998) J. Lipid Res. 39, 1543–155710. Boren, J., Rustaeus, S., and Olofsson, S. O. (1994) J. Biol. Chem. 269,

25879–2588811. Wetterau, J. R., Aggerbeck, L. P., Bouma, M. E., Eisenberg, C., Munck, A.,

Hermier, M., Schmitz, J., Gay, G., Rader, D. J., and Gregg, R. E. (1992)Science 258, 999–1001

12. Gordon, D. A., Jamil, H., Sharp, D., Mullaney, D., Yao, Z., Gregg, R. E., andWetterau, J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7628–7632

13. Jamil, H., Gordon, D. A., Eustice, D. C., Brooks, C. M., Dickson, J. K., Jr.,Chen, Y., Ricci, B., Chu, C. H., Harrity, T.W., Ciosek, C. P., Jr., Biller, S. A.,Gregg, R. E., and Wetterau, J. R. (1996) Proc. Natl. Acad. Sci. U. S. A. 93,11991–11995

14. Gretch, D. G., Sturley, S. L., Wang, L., Lipton, B. A., Dunning, A., Grun-wald, K. A., Wetterau, J. R., Yao, Z., Talmud, P., and Attie, A. D. (1996)J. Biol. Chem. 271, 8682–8691

15. Du, E. Z., Wang, S. L., Kayden, H. J., Sokol, R., Curtiss, L. K., and Davis,R. A. (1996) J. Lipid Res. 37, 1309–1315

16. Benoist, F., and Grand-Perret, T. (1997) J. Biol. Chem. 272, 20435–2044217. Gordon, D. A., Jamil, H., Gregg, R. E., Olofsson, S. O., and Boren, J. (1996)

J. Biol. Chem. 271, 33047–3305318. Rustaeus, S., Stillemark, P., Lindberg, K., Gordon, D., and Olofsson, S. O.

(1998) J. Biol. Chem. 273, 5196–520319. Mitchell, D.M., Zhou,M., Pariyarath, R.,Wang, H., Aitchison, J. D., Gins-

berg, H. N., and Fisher, E. A. (1998) Proc. Natl. Acad. Sci. U. S. A. 95,14733–14738

20. Pan,M., Liang, J. S., Fisher, E. A., and Ginsberg, H. N. (2002) J. Biol. Chem.277, 4413–4421

21. Kulinski, A., Rustaeus, S., and Vance, J. E. (2002) J. Biol. Chem. 277,31516–31525

22. Wang, Y., McLeod, R. S., and Yao, Z. (1997) J. Biol. Chem. 272,12272–12278

23. Wang, Y., Tran, K., and Yao, Z. (1999) J. Biol. Chem. 274, 27793–2780024. Raabe, M., Veniant, M. M., Sullivan, M. A., Zlot, C. H., Bjorkegren, J.,

Nielsen, L. B., Wong, J. S., Hamilton, R. L., and Young, S. G. (1999) J. Clin.Investig. 103, 1287–1298

25. Levy, E., Stan, S., Delvin, E.,Menard, D., Shoulders, C., Garofalo, C., Slight,I., Seidman, E., Mayer, G., and Bendayan, M. (2002) J. Biol. Chem. 277,16470–16477

26. Dashti, N., Gandhi, M., Liu, X., Lin, X., and Segrest, J. P. (2002) Biochem-istry 41, 6978–6987

27. Manchekar,M., Richardson, P. E., Forte, T.M., Datta, G., Segrest, J. P., andDashti, N. (2004) J. Biol. Chem. 279, 39757–39766

28. Richardson, P. E., Manchekar, M., Dashti, N., Jones, M. K., Beigneux, A.,Young, S. G., Harvey, S. C., and Segrest, J. P. (2005) Biophys. J. 88,2789–2800

29. Ohlendorf, D. H., Barbarash, G. R., Trout, A., Kent, C., and Banaszak, L. J.(1977) J. Biol. Chem. 252, 7922–8001

30. de Chaffoy de Courcelles, D., and Kondo, M. (1980) J. Biol. Chem. 255,6727–6733

31. Anderson, T. A., Levitt, D. G., and Banaszak, L. J. (1998) Structure (Lond.)6, 895–909

32. Shelness, G. S., Hou, L., Ledford, A. S., Parks, J. S., and Weinberg, R. B.(2003) J. Biol. Chem. 278, 44702–44707

33. Hussain, M. M., Shi, J., and Dreizen, P. (2003) J. Lipid Res. 44, 22–3234. Wetterau, J. R., Gregg, R. E., Harrity, T. W., Arbeeny, C., Cap, M., Con-

nolly, F., Chu, C. H., George, R. J., Gordon, D. A., Jamil, H., Jolibois, K. G.,Kunselman, L. K., Lan, S. J., Maccagnan, T. J., Ricci, B., Yan,M., Young, D.,Chen, Y., Fryszman, O. M., Logan, J. V., Musial, C. L., Poss, M. A., Robl,J. A., Simpkins, L. M., and Biller, S. A. (1998) Science 282, 751–754

35. Yao, Z. M., Blackhart, B. D., Johnson, D. F., Taylor, S. M., Haubold, K. W.,and McCarthy, B. J. (1992) J. Biol. Chem. 267, 1175–1182

36. Miller, A. D., Miller, D. G., Garcia, J. V., and Lynch, C. M. (1993)MethodsEnzymol. 217, 581–599

37. Dashti, N., Datta, G., Manchekar, M., Chaddha,M., and Anantharamaiah,G. M. (2004) J. Lipid Res. 45, 1919–1928

38. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol.Chem. 193, 265–275

39. Dashti, N. (1992) J. Biol. Chem. 267, 7160–716940. Laemmli, U. K. (1970) Nature 227, 680–68541. Burnette, W. N. (1981) Anal. Biochem. 112, 195–20342. Folch, J., Lees, M., and Sloane Stanley, G. H. (1957) J. Biol. Chem. 226,

497–50943. Dashti, N., Feng, Q., Freeman, M. R., Gandhi, M., and Franklin, F. A.

(2002) J. Nutr. 132, 2651–265944. Lin, M. C., Gordon, D., and Wetterau, J. R. (1995) J. Lipid Res. 36,

1073–108145. Tanabe, S., Sherman, H., Smith, L., Yang, L. A., Fleming, R., and Hay, R.

(1989) In Vitro Cell. Dev. Biol. 25, 1129–114046. Yao, Z., Lauer, S. J., Sanan, D. A., and Fazio, S. (1993)Arterioscler. Thromb.

13, 1476–148647. Yao, Z. M., Blackhart, B. D., Linton, M. F., Taylor, S. M., Young, S. G., and

McCarthy, B. J. (1991) J. Biol. Chem. 266, 3300–330848. Tran, K., Thorne-Tjomsland, G., DeLong, C. J., Cui, Z., Shan, J., Burton, L.,

Jamieson, J. C., and Yao, Z. (2002) J. Biol. Chem. 277, 31187–3120049. Stillemark-Billton, P., Beck, C., Boren, J., andOlofsson, S. O. (2005) J. Lipid

Res. 46, 104–11450. Yamaguchi, J., Conlon, D.M., Liang, J. J., Fisher, E. A., and Ginsberg, H. N.




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(2006) J. Biol. Chem. 281, 27063–2707151. Athar, H., Iqbal, J., Jiang, X. C., and Hussain, M.M. (2004) J. Lipid Res. 45,

764–77252. Rava, P., Athar, H., Johnson, C., andHussain,M.M. (2005) J. Lipid Res. 46,

1779–178553. Segrest, J. P., Jones, M. K., De Loof, H., and Dashti, N. (2001) J. Lipid Res.

42, 1346–136754. Segrest, J. P., Jones,M.K., andDashti, N. (1999) J. Lipid Res. 40, 1401–141655. Steyrer, E., Barber, D. L., and Schneider, W. J. (1990) J. Biol. Chem. 265,

19575–1958156. Perez, L. E., Fenton,M. J., andCallard, I. P. (1991)Comp. Biochem. Physiol.

B 100, 821–82657. Mann, C. J., Anderson, T.A., Read, J., Chester, S. A., Harrison,G. B., Kochl,

S., Ritchie, P. J., Bradbury, P., Hussain, F. S., Amey, J., Vanloo, B., Rosseneu,M., Infante, R., Hancock, J. M., Levitt, D. G., Banaszak, L. J., Scott, J., andShoulders, C. C. (1999) J. Mol. Biol. 285, 391–408

58. Atzel, A., and Wetterau, J. R. (1993) Biochemistry 32, 10444–1045059. Jamil,H.,Dickson, J.K., Jr.,Chu,C.H., Lago,M.W.,Rinehart, J.K., Biller, S.A.,

Gregg, R. E., andWetterau, J. R. (1995) J. Biol. Chem. 270, 6549–655460. Rava, P., Ojakian, G. K., Shelness, G. S., and Hussain, M. M. (2006) J. Biol.

Chem. 281, 11019–11027

61. Herscovitz, H., Hadzopoulou-Cladaras, M., Walsh, M. T., Cladaras, C.,Zannis, V. I., and Small, D. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,7313–7317

62. Herscovitz, H., Derksen, A., Walsh, M. T., McKnight, C. J., Gantz, D. L.,Hadzopoulou-Cladaras, M., Zannis, V., Curry, C., and Small, D.M. (2001)J. Lipid Res. 42, 51–59

63. Jiang, Z. G., Gantz, D., Bullitt, E., andMcKnight, C. J. (2006) Biochemistry45, 11799–11808

64. Dixon, J. L., Biddle, J., Lo, C.M., Stoops, J. D., Li, H., Sakata,N., and Phillips,T. E. (2002) J. Histochem. Cytochem. 50, 629–640

65. Rusinol, A. E., Jamil, H., and Vance, J. E. (1997) J. Biol. Chem. 272,8019–8025

66. Nicodeme, E., Benoist, F., McLeod, R., Yao, Z., Scott, J., Shoulders, C. C.,and Grand-Perret, T. (1999) J. Biol. Chem. 274, 1986–1993

67. van Greevenbroek, M. M., Robertus-Teunissen, M. G., Erkelens, D. W.,and de Bruin, T. W. (1998) J. Lipid Res. 39, 173–185

68. Larsson, S. L., Skogsberg, J., and Bjorkegren, J. (2004) J. Biol. Chem. 279,831–836

69. Carraway, M., Herscovitz, H., Zannis, V., and Small, D. M. (2000) Bio-chemistry 39, 9737–9745




ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Nassrin Dashti, Medha Manchekar, Yanwen Liu, Zhihuan Sun and Jere P. SegrestCells

Initiation of Apolipoprotein B-containing Lipoprotein Assembly in McA-RH7777 Microsomal Triglyceride Transfer Protein Activity Is Not Required for the

doi: 10.1074/jbc.M700229200 originally published online August 8, 20072007, 282:28597-28608.J. Biol. Chem.

10.1074/jbc.M700229200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/282/39/28597.full.html#ref-list-1

This article cites 69 references, 49 of which can be accessed free at


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M700229200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;282/39/28597&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/282/39/28597

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=282/39/28597&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/282/39/28597

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/282/39/28597.full.html#ref-list-1

http://www.jbc.org/

MicrosomalTriglycerideTransferProteinActivityIsNot ... · MTP gene expression in stable...

Documents

Transcript of MicrosomalTriglycerideTransferProteinActivityIsNot ... · MTP gene expression in stable...