microRNA Research Research... · 2007-03-12 · microRNA Research miRCURY™ LNA Products ... 12 in...

www.exiqon.comwww.exiqon.com

microRNA Knockdown

microRNA Expression Profi ling

microRNA Profi ling Services

microRNA Detection

microRNA ResearchmiRCURY™ LNA Products

911851 - microRNA katalog v.1.3.1 1911851 - microRNA katalog v.1.3.1 1 26/01/07 11:34:5726/01/07 11:34:57

www.exiqon.comwww.exiqon.com2

Table of ContentsContact information ........................................................................2

About microRNAs .............................................................................3

Overview of miRCURY™ LNA Products .....................................4

miRCURY™ LNA microRNA Knockdown ...................................5

miRCURY™ LNA microRNA Profi ling ..........................................7

miRCURY™ microRNA labeling kits .....................................9

miRCURY™ LNA microRNA Profi ling Services ......................10

miRCURY™ LNA microRNA Detection

Northern blotting ...................................................................12

in situ hybridisation ................................................................13

General Conditions .......................................................................15

MicroRNA Research with miRCURY™ LNA microRNA Products

Contact Information Outside North America:Business Hours:

0830 – 1630 Central European Time (GMT +100)

Mailing address:

Exiqon A/S

Bygstubben 9

2950 Vedbaek, Denmark

Ordering:

Phone: +45 45 65 09 29

Fax: +45 45 66 18 88

Email: [email protected]

Technical Assistance:

Phone: +45 45 65 09 29

Fax: +45 45 66 18 88


General Inquiries:

Phone: +45 45 65 09 29

Fax: +45 45 66 18 88


Contact Information North America:

Business Hours:

0830 - 1630 Eastern Standard Time

Mailing address:

Exiqon, Inc.

600 West Cummings Park · Suite 1650

Woburn MA 01801

United States

General Enquiries and Technical Assistance:

Phone: +1 781 376 4150

Fax: +1 781 376 4152

Toll free: +1 888 miRCURY


About ExiqonExiqon is a leading supplier of high-value gene expression

analysis products for the life sciences, research and drug

discovery industries. Exiqon’s rapidly growing product

off erings integrate innovative chemistries with webbased

software tools to help scientists achieve rapid and reliable

results. Exiqon markets its products directly on

www.exiqon.com, or through distributors, and partners

its proprietary Locked Nucleic Acids (LNA™) and

Anthraquinone (AQ-Link™) technologies through industry

leaders. Exiqon is located in the Medicon Valley area

of Copenhagen, Denmark and has an offi ce in Boston,

United States.


www.exiqon.comwww.exiqon.com 3

What are microRNAs?MicroRNAs (miRNAs) have rapidly emerged as an

important class of short endogenous RNAs that act as

posttranscriptional regulators of gene expression by

base-pairing with their target messenger RNAs (mRNAs).

In the cytoplasm of the cell, miRNAs are typically found

in the mature form as 19-25 nucleotide (nt) RNAs that

have been processed sequentially from longer hairpin

transcripts by the RNAse III ribonucleases Drosha and

Dicer.

To date more than 4000 miRNAs have been annotated

in vertebrates, invertebrates and plants and many

miRNAs that correspond to putative genes have also

been identifi ed. Some miRNAs have multiple loci in

the genome and occasionally, several miRNA genes

are arranged in tandem clusters. Recent bioinformatic

predictions combined with array analyses, small RNA

cloning and Northern blot validation indicate that the

total number of miRNAs in the diff erent vertebrate

genomes is signifi cantly higher than previously estimated

and maybe as high as 1000.

About microRNAs

A signifi cant role in gene regulationInitial studies indicate that miRNAs may regulate as much

as 30% of all genes in the genome, thus comprising a

totally new level of gene regulation. miRNAs have already

been found to play important roles in several types of

cancers and in tissue diff erentiation.

MicroRNA researchThe study of miRNAs represents a new area for research

of post-transcriptional control. Perturbed expression of

miRNAs has been implicated in cancer and other diseased

states, such as viral infection. An understanding of

miRNAs appears promising as a basis for diagnostics and

provides novel targets for treating disease. There is a clear

need to better understand the role and signifi cance of

miRNA for control of gene expression.

A representation of microRNA biogenesisReprinted by permission of Federation of the European Biochemical

Societies from ”MicroRNA function in animal development“ by Erno

Wienholds and Ronald H.A. Plasterk, FEBS Letters, Vol 579, 5911-5922,

Copyright 2005.



SAMPLE

miRCURY™ LNA

microRNA Knockdown

SAMPLE

miRCURY™ LNA Detection

Data Validation and Refi nement

Exiqon’s miRCURY™ LNA microRNA products provide the

perfect basis for studying short nucleic acid targets. The

key to this is the nucleotide analog Locked Nucleic Acid

(LNA™).

What is a Locked Nucleic Acid?Locked Nucleic Acids

(LNA™) are a class of nucleic

acid analogues in which

the ribose ring is “locked”

by a methylene bridge

connecting the 2’-O atom

with the 4’-C atom (see

structure right).

LNA™ nucleosides contain the six common nucleobases

(T, C, G, A, U and mC) that appear in DNA and RNA and

thus are able to form base-pairs according to standard

Watson-Crick base pairing rules. Oligonucleotides

incorporating LNA™ have increased thermal stability

and improved discriminative power with respect to their

nucleic acid targets.

LNA™ can be mixed with DNA, RNA and other nucleic

acid analogs using standard phosphoramidite synthesis

chemistry. LNA™ oligonucleotides can easily be labeled

with standard oligonucleotide tags such as DIG,

fl uorescent dyes, biotin, amino-linkers, etc. Thus a very

high degree of freedom in the design of primers and

probes exists.

Overview of miRCURY™ LNA Products

The LNATM advantageIt has been known for a long time that LNA-based probes

show particular advantageous properties when used

in the detection of short RNA and DNA targets, or short

sequences within larger targets

Exiqon has been able to exploit the uniquely high

affi nities that LNA-based probes have for miRNAs in our

range of miRCURY™ LNA products for microRNA research.

This technology is the basis for microRNA functional

studies through miRCURY™ LNA Knockdown probes,

microRNA profi ling with miRCURY™ LNA Arrays, and

miRNA detection through miRCURY™ LNA microRNA

in situ hybridisation and Northern blot probes.

LNATM

Tm increase/monomeragainst DNA (°C)

2.0-6.0

Tm increase/monomeragainst RNA (°C)

3.0-8.0

ΔTm at single mismatch against DNA (°C)

LNA>>DNA

Compatible with standard molecular biology

Yes

Water solubility High

SAMPLE

miRCURY™ LNA

microRNA Knockdown

miRCURY™ LNA Real Time PCR

0.8

0.6

0.4

0.2

0

0 10 20 30 40

Figure of hsa-mir-124a expression in human brain kindly contributed

by Dr. Zissimos Mourelatos, UPenn, Philadelphia, USA.



At a glance: Eff ective and sequence-specifi c antisense inhibition

of miRNA

Minimal cytotoxicity

Compatible with standard cell transfection methods

Increased biological stability

Knockdown of microRNAsKnockdown of miRNAs represents one of the most

appropriate methods to determine miRNA function and

the validation of putative miRNA targets. Due to the fact

that miRNAs repress protein expression at the level of

mRNA, knockdown of a miRNA will typically lead to an

increase in target protein expression. This can be a useful

tool in identifying mRNA transcripts predicted to be

miRNA targets by bioinformatics

miRCURY™ LNA microRNA Knockdown

miRCURY™ LNA microRNA Knockdown probes:

Confi rm or determine miRNA function

A: 2-fold decrease in miR-223 levels observed in NB4 cells treated

with a miRCURY™ LNA microRNA Knockdown probe against miR-223

compared to a control probe against miR-126 not expressed in the

cells (U6 loading control). B: Knockdown of miR-223 at 2 diff erent

conditions produce a 30-40% reduction of CD11b expression levels

while maintaining the level of CD14 unaltered. Reprinted from Cell, 123,

Fazi et al, A Minicircuitry Comprised of MicroRNA-223 and Transcription

Factors NFI-A and C/EBPa Regulates Human Granulopoiesis; 819-831,

Copyright 2006 with permission from Elsevier.

Effi cient uptake of fl uorochrome-labelled miRCURY™ microRNA

LNA knockdown probes into human K562 cells. The LNA™

enhanced knockdown antisense oligonucleotides are readily

transfected into cells by any standard transfection method

e.g. electroporation and lipid mediated. The image shows

electroporated cells and is kindly provided by Dr. Jens Eriksen,

Laboratory of Oncology, Herlev University Hospital, Denmark.

Specifi c Knockdown of microRNAKnockdown probes for miRNA need to be highly specifi c,

eff ective at physiological temperatures and non-toxic.

Exiqon’s miRCURY™ LNA microRNA Knockdown

technology enables sequence-specifi c inhibition of

mature miRNAs in vitro and in vivo. LNA-based probes

consistently show improved antisense effi cacy and higher

Tm’s towards their complementary single-stranded RNA

targets compared to 2’-O-methyl oligonucleotides. Using

our expertise in bioinformatics design of LNATM probes,

along with in-house research, we have optimally designed

each miRCURY™ LNA microRNA Knockdown probe to be

as specifi c for its target as possible.

The increased affi nity of miRCURY™ LNA microRNA

Knockdown probes means that they are eff ective at

physiological temperature. Furthermore, they can be

used at a low concentration, thus minimizing potential

cytotoxic eff ects.

Depletion of miRNAs can be judged in a number of ways:

by the decrease in signal of the target miRNA on an array,

specifi c for miRNAs by the absence of binding of an in situ

hybridisation probe, and by the decrease in hybridisation

signals in Northern blots as LNA-miRNA hybrids are

thermally stable in denaturing gels. De-repression of the

cognate target protein expression is another indicator of

successful miRNA knockdown.

25

20

15

10

5

0CD11b+

10-8 MRA 10-6 MRA

- - -CD14+ CD11b+

LNA-126 LNA-223

CD14+

fold

ind

uct

ion

A

B

miR-223

U6

LNA-126 LNA-223



Published Research using miRCURY™ LNA Knockdown ProbesIn one of the fi rst examples of a

publication using miRCURY™ LNA

microRNA Knockdown probes, Fazi

et al. (Cell 123, 819-831), hsa-mir-223

levels were reduced two-fold using

a miRCURY™ LNA microRNA

Knockdown probe. This lead to

reduced expression of CD14+,

demonstrating that hsa-mir-223 is an important

modulator of human myeloid diff erentiation.

Ørum et al. (Gene 372, 137-141) showed that miRCURY™

LNA-based microRNA Knockdown was used to up-

regulate the expression of Hid protein in KC 167 cells from

Drosophila melanogoster. Naguibneva et al. (Nature Cell

Biology 8, 278-284), demonstrated eff ective knockdown

of hsa-mir-181, with a demonstrable eff ect on myoblast

diff erentiation.

Product DescriptionEach miRCURY™ LNA microRNA Knockdown probe is a full

length complementary probe to it’s miRNA target. Every

probe is an LNA-enhanced oligonucleotide, designed

using Exiqon’s in-house design software.

5 nmole of probe is provided in RNAse-free water,

allowing direct application in standard transfection

protocols.

Probes are available with a choice of labels: unlabeled

probes are available, termed ‘Ready to label.’ This means

that the probes can be enzymatically labeled with e.g.,

kinase or ligase.

Effi cient knockdown of hsa-miR-204 - known to be involved in cell proliferation - using a microRNA specifi c miRCURY™ LNA microRNA Knockdown

probe against miR-204 as judged by A: A signifi cant decrease in cell number and in the proliferation rate using Cell Proliferation Reagent WST-1

(Roche) and B: A signifi cant increase in caspase activity using the Homogenous Caspase Assay (Roche). The HeLa cells were transfected using

X-tremeGENE siRNA Transfection Reagent (Roche). Data taken from Watzele et al, Biochemica, 2006. (wo tfx = without transfection reagent)

miRCURY™ LNA microRNA Knockdown

400%350%300%250%200%150%100%

50%0%

wo tfx miR 2045 pmol

scrambled5 pmol

Caspase normalised to WST-1 Caspase normalised to cell number

scrambled11 pmol

miR 20411 pmol

Ca

spa

se n

orm

ali

sed

120%

100%

80%

60%

40%

20%

0%wo tfx miR 204

5 pmolscrambled

5 pmol

WST-1 cell number

scrambled11 pmol

miR 20411 pmol

WS

T-1

or

cell

nu

mb

er

*”Ready to label” means that the miRCURY™ LNA microRNA Knockdown

probe can be enzymatically labeled with the detection moiety of choice.

For example, nucleotides labeled with DIG, radiolabel, biotin or fl uorophores.

Pre-designed miRCURY™ LNA microRNA

Knockdown probes

are available for all known miRNAs as registered and

annotated in the miRNA Registry (miRBase) at The

Wellcome Trust Sanger Institute (http://microrna.sanger.

ac.uk/).

Custom miRCURY™ LNA microRNA Knockdown probes

are available for all other microRNAs and other small

RNAs.

Control miRCURY™ LNA microRNA Knockdown probes

are available. Please go to www.exiqon.com

Ordering: Go to www.exiqon.com/shop. Select your

miRCURY™ LNA microRNA Knockdown product by

Product Number, name of microRNA (must be entered

exactly as given in the Sanger miRNA registry, e.g.

“hsa-mir-1”) or sequence. (For example, ordering a

miRCURY™ LNA microRNA Knockdown probe for hsa-

mir-1 can begin by entering 118008-00, hsa-miR-1 or

UGGAAUGUAAAGAAGUAUGUA into the search window.

Product no. Product Description Label

XXXXXX-00 miRCURYTM LNA microRNA Knockdown, 5 nmole Ready to Label*

XXXXXX-02 miRCURYTM LNA microRNA Knockdown, 5 nmole 5’-amino

XXXXXX-04 miRCURYTM LNA microRNA Knockdown, 5 nmole 5’-fl uorescein

XXXXXX-06 miRCURYTM LNA microRNA Knockdown, 5 nmole 3’-amino

XXXXXX-08 miRCURYTM LNA microRNA Knockdown, 5 nmole 3’-fl uorescein

A B



At a glance Tm-normalized, LNA-enhanced capture probes

Works on just 1μg total RNA

No need for miRNA enrichment

Reduced sample handling

Use less sample, get reliable results and save time

Microarrays represent one of the fastest and most

comprehensive methods for determining the miRNA

profi le of a sample. It has been argued that the miRNA

profi le of a sample can be used as a ‘signature’ that can be

used as a basis for diagnosis. The miRCURY™ LNA Array

provides the ability to conduct genome-wide profi ling of

miRNA in samples. It can be used to identify signatures

associated with cancer, tissue profi ling, drug profi ling,

development up- and down-regulation of miRNAs.

The superior alternative to DNA-based arrays for microRNA profi lingmiRCURY™ LNA Arrays have been designed to address

issues faced when using DNA-based oligonucleotide

capture probes for the profi ling of miRNAs. Specifi cally,

DNA-based methods require miRNA enrichment and

signal amplifi cation methods due to the lower affi nity

of DNA oligonucleotides for short nucleic acid targets.

Furthermore, there is limited fl exibility for producing a

Tm-normalized capture probe set for such short targets as

miRNA with DNA-based oligonucleotides.

Tm-normalized capture probesThe capture probes used in the miRCURY™ LNA Arrays

use Exiqon’s LNA™ design expertise to produce Tm-

normalized, high affi nity capture probes – Tm of 72°C

- ensuring all miRNA targets hybridise to the array

with equal affi nity at the high-stringency hybridisation

temperature of 60°C.

Profi le microRNA with just 1 μg of total RNA - no need for microRNA enrichment:miRCURY™ LNA Arrays require just 1μg of total RNA

to obtain an accurate miRNA profi le without miRNA

enrichment saving time and reducing the possibility of

losing miRNAs during sample prep. Removing the miRNA-

enrichment step allows time-saving and reduces the

possibility of miRNA-enrichment artefacts from aff ecting

your data.

miRCURY™ LNA Array Workfl ow

miRCURY™ LNA Arrays require only 1 μg of total RNA to profi le

microRNAs

Identical miRNA profi les are produced from starting amounts of total RNA

that span the range of 10μg to 1μg, without miRNA enrichment. 17 diff erent

miRNAs, detected in human lung total RNA are represented. Numbers in the

top right hand of each box show the amount of total RNA used to produce

each profi le.

miRCURY™ LNA Array microRNA Expression Profi ling

miRCURY™ LNA Arrays:

the fastest and most accurate way for microRNA profi ling

24

ho

urs

1. Prepare RNA sample

Total RNA sample

(Use 1 – 10 μg, total RNA).

miRNA enrichment is

optional.

2. Label RNA sample with

Hy3TM/Hy5TM dyes.

Uniform and robust

miRNA labeling in

90 minutes

3. Hybridise overnight

4. Obtain the microRNA

profi le of your sampleLo

g2

( F

luo

resc

en

ce in

ten

sity

)

microRNA targets

16

14

12

10

8

6

4

2

0

10μg 5μg 2μg 1μg



Published Research using miRCURY™ LNA ArraysCastoldi et al. (RNA 12, 913-920) demonstrated the

advantages of using LNA-based probes for miRNA

profi ling, when compared with DNA-based arrays. The

paper describes how the biophysical properties of LNA

were exploited to design probe sets for uniform, high-

affi nity hybridisations yielding highly accurate signals able

to discriminate between single nucleotide diff erences and,

hence, between closely related miRNA family members.

The superior detection sensitivity eliminates the need for

RNA size selection and/or amplifi cation.

High sensitivity and dynamic range of miRCURY™ LNA ArrayBy using careful design rules regarding incorporation

of LNA™, the miRCURY™ LNA Array capture probes have

been found to be signifi cantly more sensitive than DNA-

based arrays for miRNA detection. The miRCURY™ LNA

Array is capable of detecting as little as 50 attomole of

miRNA.

Two pools of synthetic miRNAs (2 fmol of each miRNA) were spiked into

a complex background of yeast total RNA (1 μg/μL) with hsa-miR-196a/

hsa-miR-19a in one pool and hsa-miR-196b/hsa-miR-19b in the other pool.

One pool was labeled with Hy3™ and the other pool was labeled with Hy5™

using the miRCURY™ LNA Array Labeling Kit. The labeling reactions were

pooled and hybridized onto miRCURY™ LNA Arrays system.

The perfect-match/mismatch ratios are in the range 32-1110.

Product DescriptionEach miRCURY™ LNA Array consists of LNA-modifi ed

capture probes specifi c for each miRNA target. Capture

probes are Tm-normalized to 72°C. Probes are spotted

onto Corning® Epoxide slides. Each array is delivered in

a (vacuum) sealed package containing dessicant.

miRCURY™ LNA Arrays come in pack sizes of 3, 6 and 24

arrays. Arrays, or ready-to-spot probesets come supplied

with hybridisation and wash buff ers.

miRCURY™ LNA Array Spike-in miRNA Kit: Improve the quality of your data analysisAvailable with all miRCURY™ LNA Array products, the

Spike-in miRNA kit contains 10 synthetic spike-in miRNAs.

The spike-in capture probes can be used

as a control of the labeling reaction and hybridization

as a help in deciding scanner settings between channels

as a control of the data normalization procedure

to estimate the variance of replicated measurements

within arrays

to assess technical variability between diff erent parts of

the array

miRCURY™ LNA Array microRNA Expression Profi ling

Product Number Name Description

All organisms miRCURYTM LNA Array, 3 microarray slides, hyb and wash buff ers



All organisms miRCURYTM LNA Array, ready to spot probe set, 300 pmol, hyb and wash buff ers

208020 Hybridisation buff er miRCURYTM LNA Array, 2X hybridisation buff er (1 mL)

208021 Washing buff er miRCURYTM LNA Array, washing buff er kit /saltbuff er 125 mL; detergent 15 mL)

208040 Spike-in miRNA miRCURY™ LNA Array, Spike-in miRNA Kit

Updated

according to

miRBase

The fi gure shows the distribution of the 10 spike-in miRNAs spiked into a

total RNA sample.

Hy

5T

M S

ign

al

Hy3TM Signal

Normalized signal100000

10000

1000

100

10

10 100 1000 10000 100000

microRNA

Spike-ins

hsa-miR-196a hsa-miR-196b hsa-miR-19bhsa-miR-19a

Sig

na

l

Capture Probe



At a glance: The perfect complement to miRCURY™ LNA Arrays

One-step protocol

Requires just 1 μg of total RNA

Scalable protocol

Uniform labeling method means all target miRNAs are

labeled to the same degree without sequence bias

Matches all common microarray scanning equipment.

Straightforward and fast microRNA labelingThe miRCURY™ LNA Array labeling kit provides a fast and

simple method that allows you to label your total RNA

sample and apply it directly to your microarray. There is

no need for miRNA enrichment, or other time-consuming

sample handling steps. When used with miRCURY™ LNA

Arrays, the labeling kit allows for the labeling of down to

1μg of total RNA for use in miRNA profi ling.

The kits are used for labeling of total RNA samples with

Hy3™ and Hy5™ fl uorophores - dyes spectrally equivalent

to the well-known Cy3™ and Cy5™ fl uorophores, allowing

for miRNA expression patterns to be determined on

standard array scanning instrumentation.

miRCURY™ LNA Array Labeling methodThe miRCURY™ LNA Array Labeling Kit requires just 1 μg

of total RNA with no requirement for miRNA enrichment.

The labeling protocol is 90 minutes and miRNAs are

uniformly labeled.

One fl uorescent label per microRNADue to the method used in the miRCURY™ LNA Array

labeling kits, only one fl uorescent label is incorporated

per miRNA.

The miRCURY™ LNA Array microRNA labeling kit works on

plant miRNAs in addition to animal miRNAs, making it the

most versatile miRNA labeling kit available.

miRCURY™ LNA Array microRNA Labeling

miRCURY™ LNA Array Labeling Kit: Fast and simple miRNA Labeling

Product Number Name Description

208030 Hy5TM labeling kit miRCURYTM LNA Array, Hy5TM labeling kit (24 rxns)

208031 Hy3TM labeling kit miRCURYTM LNA Array, Hy3TM labeling kit (24 rxns)

208031 Hy3TM/Hy5TM labeling kit miRCURYTM LNA Array, Hy3TM /Hy5TM labeling kit (24 rxns)

Flo

we

rF

low

er

100

1000

10000

100000

100 1000 10000 100000

Seedling

20

16

12

8

4

0

Lo

g2

(in

ten

sity

)

miR

-145

miR

-189

miR

-196

a

miR

-10a

miR

-200

c

miR

-320

miR

-106

a

miR

-142

-5p

UU-3’ GU-3’ GG-3’ UG-3’ GG-3’ AA-3’ GC-3’ AC-3’



At a glance: Obtain reliable results fast

Use Exiqon’s time and expertise

Built-in controls

Unique QC feature:

synthetic spike-in miRNAs

Capture probes spotted 4 times, positive and

negative controls

Speed up your microRNA researchExiqon’s miRCURY™ LNA Array miRNA Profi ling Services is

designed to allow you to obtain miRNA profi les for your

samples without doing more than sending us your total

RNA samples and analysing your data when we send it to

you. Following a check for RNA sample quality, Exiqon will

take care of the steps in-between the steps in-between-

sample labeling, hybridisation to miRCURY™ LNA Arrays

and data generation.

Using miRCURY™ LNA Array miRNA Profi ling Services

gives you access to the most advanced miRNA profi ling

arrays available, incorporating LNA™-based capture

probes that provide the following benefi ts:

Use less sample

• Profi ling using 2μg total RNA/sample/array

Obtain results you can rely on

• Tm-normalized capture probes with high

affi nity for miRNA targets

• No miRNA enrichment required

Save time

Use Exiqon’s expertise to keep your research on track

• Obtain results in 2-3 weeks

Use Exiqon’s expertise and advice Each service is customized to your specifi c requirements,

in consultation with Exiqon’s experts, who have broad

experience in miRNA expression analysis

miRCURY™ LNA Array microRNA Profi ling Service



Getting StartedGo to www.exiqon.com/services and fi ll in the request form. We will then contact you very shortly after you submit your

request to further discuss your requirements. After we have agreed on the best way to proceed with the experiments,

we will provide you with a free, no obligation quote.

miRCURY™ LNA Array microRNA Profi ling Service

2 -

3 w

ee

ksEach service project is tailored to your

specifi c requirements in consultation

with Exiqon’s experts, who have broad

experience in microRNA expression

analysis.Consultation

Samplesubmission

RNA QC

Labeling andHybridization

Data collectionand analysis

Final report

We can profi le miRNA expression from

as little as 2μg total RNA. There is no need

for microRNA enrichment.

Prior to initiating the analysis we will

subject your samples to a RNA quality

control to assess the integrity of the

RNA, its content of small RNA, and its

concentration.

Our miRCURYTM LNA Array labeling kit

allows uniform labeling of microRNAs

with no sequence bias. Hybridization

and washing steps are fully automated

for excellent reproducibility.

Arrays will be scanned and image analysis

performed to quantify the signals on

the arrays. The data obtained will be

normalized using methods applicable to

the performed experiment and we will

perform a quality assessment of the data.

Upon completion of the miRNA profi ling

service, we will send you an email with a

link to a secure web-server from which

you may download the fi nal report and

all associated fi les. For further details on

report content, please see overleaf.



At a glance Preserve your precious RNA samples

Superior to DNA probes

Get results in a few hours

Detect miRNA in as little as 2.5 μg total RNA

Improved Northern Blot Detection of microRNAsExiqons miRCURY™ LNA technology enables sensitive

and specifi c detection of miRNAs by Northern blotting.

miRCURY™ LNA microRNA Northern blotting probes

have high binding affi nity and discrimination, enabling

the specifi c and sensitive detection of miRNAs. Due to

the high binding affi nity of the miRCURY™ LNA microRNA

Detection probes less than 1/10 the amount of sample

is needed compared to traditional probes. Furthermore,

the exposure time is reduced to just a few hours.

For researchers who wish to detect miRNAs on Northern

blots by non-radioactive methods, we recommend the

use of DIG-tailing, where multiple DIG moeities are added

to the miRCURY™ probe.

Northern blot showing high specifi city using miRCURY™ LNA Detection

probes. The probe specifi city was assessed using 32P-labeled perfect match,

double mismatch and three single mismatch miRCURY™ LNA microRNA

Detection probes in the detection of miR171 in A. thaliana fl owers (1) and

leaves (2). The fi lters were washed at low stringency and high stringency.

From Válóczi et al. 2004, Nucleic Acids Res. e175; reprinted by permission of

Oxford University Press.

The fi gure shows a Northern analysis of two duplicate dilution series of

A.thaliana total RNA hybridised with 32P-labeled DNA and miRCURY™ LNA

Detection probes, respectively, for A. thaliana miR171 and miR319. From

Válóczi et al. 2004, Nucleic Acids Res. e175; reprinted by permission of Oxford

University Press

Product DescriptionPre-designed miRCURY™ LNA microRNA Northern blot

detection probes for are available for all known miRNAs in

invertebrates, vertebrates and plants, as annotated in the

miRNA Registry (miRBase) at The Welcome Trust Sanger

Institute.

Custom miRCURY™ LNA microRNA Detection probes are

available for your own miRNAs and other small RNAs.

Using miRCURY™ LNA microRNA Detection probes double

and even single mismatches are readily discriminated as

shown left.

miRCURY™ LNA microRNA Detection: Northern blot probes

Low stringency

2xSSC, 45ºC

High stringency

0.1xSSC, 65ºC

EtBr

1 2

Pe

rfe

ct m

atc

h

Do

ub

le m

ism

atc

h

Sin

gle

mis

ma

tch

,

po

siti

on

11

Sin

gle

mis

ma

tch

,

po

siti

on

8

Sin

gle

mis

ma

tch

,

po

siti

on

14

1 2 1 2 1 2 1 2

miR171

miR319

100 50 25 10 5 2.5 100 50 25 10 5 2.5 μg RNA

miRCURY™ LNA probe

6h exp6h exp

6h exp6h exp

12h exp12h exp

12h exp12h exp

DNA probe

EtBr



At a glance Detect low abundance miRNAs

Probes available for all miRNAs

Single- or dual-base discrimination

Probes are ready to be labeled or pre-labeled with

your preferred detection method, e.g. DIG, biotin,

fl uorescence

Fully developed protocols

Truly Enabling TechnologyExiqons miRCURY™ microRNA technology enables

sensitive and specifi c detection of mature miRNAs

by in situ hybridisation. For the detection of miRNAs,

the development of miRCURY™ LNA microRNA in situ

Detection probes has been a truly ground-breaking,

enabling technology.

miRCURY™ LNA microRNA in situ Detection probes

have high binding affi nity and discrimination, enabling

the specifi c and sensitive detection of miRNAs. Specifi c

in situ detection of miRNA is possible in whole mounts,

thin sections, single cells, frozen samples and in formalin-

fi xed, paraffi n-embedded tissue sections (including

archived samples).

Detection of the brain specifi c miRNA-138 (red) in the hippocampus of

mouse cells using miRCURY™ LNA microRNA Detection probes. DNA is

labeled with DAPI (in blue).

The image was kindly provided by Dr. Javier Martinez, IMBA - Institute of

Molecular Biotechnology, Vienna, Austria.

Specifi c detection of miR-122a (top), miR-206 (middle) and miR-124a

(bottom) using miRCURY™ LNA microRNA Detection probes in in situ

hybridisation of whole mount zebrafi sh embryos.

The images were kindly provided by Dr. Ronald Plasterk, Hubrecht

Laboratory, The Netherlands.

miRCURY™ LNA microRNA Detection probes for the in

situ detection of miRNAs have been used successfully

in both animal and plant species. Their importance has

been demonstrated in a number of publications, due to

the expression patterns of miRNAs, which show highly

specifi c tissue- and cell expression patterns. These probes

have truly helped answer the questions of ”when” and

”where” a particular miRNA is expressed.

miRCURY™ LNA microRNA Detection: in situ hybridisation probes

See precisely where your miRNA is expressed with a sensitivity and

specifi city not possible with probes.



miRCURY™ LNA microRNA in situ Detection probes in researchA number of papers have been published using

miRCURY™ LNA microRNA in situ Detection probes.

Wienholds et al. elucidated the temporal and spatial

expression patterns of 115 conserved miRNAs in zebrafi sh

embryos. One important conclusion from this work is that

the role of miRNAs is in the diff erentiation or maintenance

of tissue identity. Sokol and Ambros used miRCURY™

LNA microRNA Detection probes to detect miR-1-1 and

miR-1-2 expression in Drosophila muscle. Nelson et al.

used miRCURY™ LNA microRNA Detection probes to

study the expression patterns of miRNAs in archived

human brain tissue samples. The in situ expression

patterns were able to help refi ne the data obtained from

a microarray. Most recently, Obernosterer et al., have

demonstrated diff erential distribution patterns of mature

and pre-mirs in mouse embryos.

Pre-designed miRCURY™ LNA microRNA Detection probes These probes are available for in situ hybridisation and

northern blotting are available for all known microRNAs

as registered and annotated in the miRNA Registry at The

Wellcome Trust Sanger Institute. Control probes are also

available.


Product Number Product Description Label

XXXXXX-00 miRCURYTM LNA microRNA Detection probe, 250 pmol ready to label*

XXXXXX-01 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-DIG

XXXXXX-02 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-amino

XXXXXX-03 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-biotin

XXXXXX-04 miRCURYTM LNA microRNA Detection probe, 250 pmol 5’-fl uorescein

XXXXXX-05 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-DIG

XXXXXX-06 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-amino

XXXXXX-07 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-biotin

XXXXXX-08 miRCURYTM LNA microRNA Detection probe, 250 pmol 3’-fl uorescein

Custom miRCURY™ LNA microRNA Detection probes For in situ hybridisation and northern blotting are

available for all other microRNAs, including pre-mirs,

please inquire.

The miRCURY™ LNA microRNA Detection probes are

available in a ”ready to label” format (using enzymatic

labeling kits) and in a pre-labeled format e.g. labeled with

DIG, biotin etc.

Control miRCURY™ LNA microRNA Detection probesare available. Please go to www.exiqon.com

Ordering: Go to www.exiqon.com/shop. Select your miRCURY™

LNA microRNA Detection product by Product Number,

name of microRNA (must be entered exactly as given in

the Sanger miRNA registry, e.g. “hsa-mir-1”) or sequence.

For example, ordering a miRCURY™ LNA Detection probe

for hsa-mir-1 can begin by entering 18008-00, hsa-miR-1

or UGGAAUGUAAAGAAGUAUGUA into the search

window.

*”Ready to label” means that the miRCURY™ LNA microRNA Detection probe can be enzymatically

labeled with the detection moiety of choice, for example DIG, radiolabel, biotin or fl uorophores.



General Conditions for Sale and Supply of Goods from Exiqon A/S.

The General Conditions shall apply, unless otherwise agreed in writing

by both parties. In case of discrepancy between the parties on agreed

conditions, the General Conditions given below shall apply.

1. Price, Quotation.

1.1 All orders are received to Exiqon’s acceptance and order

confi rmation in writing. An order is accepted at the price quoted

at the date of the quotation. Quotations are valid for a period of 30

days only and fi xed prices as specifi ed in Exiqon´s Product

Catalogue current at date of order are guaranteed except where

changes in costs, rate of currencies, taxes, or the like may

necessitate a price increase.

1.2 Unless expressly stated otherwise all prices are exclusive of

V.A.T. or similar sales taxes.

1.3 Orders below 350 EURO will be charged a handling fee of

30 EURO.

2. Product Information, Drawings and Descriptions.

2.1 All information and data contained in product brochures and

price lists are binding only to the extend that they are by

references expressly included in Exiqon’s acceptance of an order.

2.2 All drawings and technical documents relating to the Goods

or its manufacture submitted by one party to the other shall

remain the property of the submitting party.

3. Delivery - Passing of Risk.

3.1 If no trade terms is specifi cally agreed delivery shall be Free

Carrier (FCA, Vedbaek) (Incoterms 2000). The risk for accidental

damage to the Goods will pass to the purchaser upon delivery to

the purchaser or third party e.g. a carrier.

3.2 If the purchaser fails to accept delivery the purchaser shall be

charged with the expenses incurred by Exiqon.

3.3 Exiqon will use its best eff orts to deliver the Goods within the

time agreed and if no time is agreed within a reasonable time but

in no circumstances will Exiqon be liable for loss or damage of any

kind caused directly or indirectly by any delay in delivery of the

Goods.

3.4 Exiqon may make delivery by installments.

4. Payment.

4.1 Where no account has been agreed by Exiqon the Goods will

not be delivered until Exiqon is paid the amount shown on the

proforma invoice relating to the Goods.

4.2 Where an account has been agreed the price will become

payable upon delivery and payment will be made by the Buyer

within 30 days of the date on the invoice.

4.3 The Goods shall remain the property of Exiqon until payment

has been made in full. If purchaser does not pay within the time

stipulated Exiqon is entitled to charge interests on overdue

payments at the rate of 2 (two) per cent per month.

5. Warranty.

5.1 Exiqon will repair or at its option replace any Goods

manufactured by Exiqon which are proved to the reasonable

satisfaction of Exiqon to be defective in material or workmanship

provided such defects are notifi ed to the seller within 12 (twelve)

months of the date of despatch.

5.2 No warranty shall be undertaken for damage which is

attributable to the following: Unsuitable or improper use, faulty

assembly or commissioning by purchaser or third parties, faulty

or negligent handling, unsuitable utilities, chemical, electronically

or electrical infl uences provided that they are not attributable to

the fault of Exiqon.

5.3 Purchaser waives all rights to be indemnifi ed for any

consequential damages, e.g. loss of profi t, loss suff ered by third

parties, and claim for damages which is not incurred on the

goods themselves, unless it is established that such loss is due

to gross negligence on Exiqon’s part or other parts for whom

Exiqon is liable. If Exiqon should be liable compensation for

defects is limited to 10 (ten) per cent of the net selling price.

6. Cancellation.

6.1 The purchaser is not entitled to cancel, extend or delay the

contract or part thereof.

6.2 If Exiqon consents to the purchaser cancelling the contract or

part thereof and returning any Goods, the purchaser shall be liable

to pay Exiqon current handling charges.

7. Product Liability.

7.1 Exiqon is not liable for damages to real property or movables

unless it is established that such damage to real property or

movables is due to gross negligence on Exiqon’s part or others for

whom Exiqon is liable.

7.2 Exiqon is under no circumstances liable for personal injury

or damages if such personal injury or damages are due to the

use of the delivered products contrary to Exiqon’s manuals or

technical specifi cations or due to negligent acts on the part of

others than Exiqon, i.e. subsuppliers or independent transporters.

7.3 Exiqon is under no circumstances liable for indirect loss, loss of

profi ts, or any other kind of consequential loss.

7.4 Exiqon is liable for personal injuries and for damages to real

property or movables intended for noncommercial purposes

according to the rules in the Danish Act of Product Liability to

the extend that Exiqon’s liability is not limited pursuant to clause

7.1 through 7.3.

7.5 In the event that Exiqon is held liable according to the rules

concerning “product liability” in relation to a third party, purchaser

is obliged to indemnify Exiqon from all claims to the extend that

Exiqon has limited its liabilities according to clause 7.1 through

7.4. If a third party should claim damages from one of the

contracting parties in respect to the delivery made under these

General Conditions, this party is obliged to inform the other party

with the outmost dispatch.

8. Force Majeure.

8.1 Any delay or failure of performance of either party shall be

considered as cases of relief of responsibility to the extend that

such delay in or failure of performance are caused by occurrences

after the acceptance of the quotation and are beyond the control

of the party aff ected including but not limited to: Industrial

disputes, fi re, war, general mobilisation of unforeseen

military mobilisations, requisition, general shortage of materials,

shortage of transport, civil commotion, import bans or export

bans, restrictions in the use of power, defects on production

facilities or delays in deliveries by subsuppliers.

9. Disputes and Applicable Law.

9.1 Any disputes arising out of the contract regarding the

interpretation and application of the contract shall be governed

by Danish Law.

9.2 The venue for any legal actions instituted by purchaser against

Exiqon shall be The Maritime and Commercial Court in

Copenhagen.

9.3 Legal actions against purchaser can be instituted at Exiqon’s

discretion at The Maritime and Commercial Court in Copenhagen

or at purchasers normal venue.

Latest revision: February, 2004


www.exiqon.comwww.exiqon.com

Outside North America

Exiqon A/S · Bygstubben 9 · DK-2950 Vedbaek · Denmark

Phone: +45 45 660 888 · Fax: +45 45 661 888

[email protected] · www.exiqon.com

miRCURY™ LNA microRNA KnockdownPre-designed knockdown probes for all annotated miRNAs.

Probes available labeled or unlabelled. Control probes and

Custom probes for other small RNAs also available.

The miRCURY™ LNA Product Series

miRCURY™ LNA Arrays for all organisms

Pack sizes: 3, 6 and 24 slides

Ready-to-spot probe set

miRCURYTM LNA Array Labeling Kits

miRCURY™ LNA Array, Hy3™/Hy5™ Labeling kit (24 rxns)

miRCURY™ LNA Array, Hy3™ Labeling kit (24 rxns)

miRCURY™ LNA Array, Hy5™ Labeling kit (24 rxns)


- all microRNAs, all organisms

In situ detection probes, unlabeled or multiple

choice of labels (DIG, fl uorescein, biotin etc.)

Northern blot detection probes, unlabeled or

multiple choice of labels

miRCURY™ LNA microRNA Expression

Profi ling Services

Your biological sample profi led using miRCURY™

LNA Array technology

Patents and Trademarks

Exiqon, AQ-Link, LNA, miRCURY, ProbeLibrary and ProbeFinder are registered trademarks of Exiqon A/S, Vedbaek,

Denmark.

Anthraquinone photochemistry products (AQ products) are covered by patents owned by Exiqon A/S.

Locked Nucleic Acids are covered by the following patents owned by Prof. Imanishi: AU 720472, AU 742476, CA

2,283,509, USP 6,268,490 and USP 6,770,748 and by patents and patent applications owned by Exiqon A/S.

Disclaimers

Exiqon Products: Products are for research use only and not for diagnostic or therapeutic use. The products may

be used only for the buyer’s internal research purposes and not for commercial use. The buyer may not resell

products in their original or any modifi ed form. The purchase of products does not include or carry an implied

right or license for the buyer to use such products in the provision of services to third parties and a license must

be obtained directly from Exiqon A/S for such use.

Prespotted arrays: This product and its use are covered by one or more of the following patents owned by

Oxford Gene Technology Limited or Oxford Gene Technology IP Limited: US 6,054,270, US 5,700,637, EP

0,373,203; Jap. 3,393, 528 and 3,386,391 and pending patents. The purchaser is licensed to practice methods and

processes covered by these patents using this product for its own internal research purposes only but may not:

transfer data derived from the use of this product to third parties for value; use this product in the provision of

services to third parties for value; use this product to make, have made, create or contribute to the creation of

stand alone expression database products for license, sale or other transfer to a third party for value; or use this

product for the identifi cation of antisense reagents or the empirical design of probes or sets of probes for using

or making nucleic acid arrays.

Capture probe oligonucleotide sets: Exiqon A/S is not licensed under any patents owned by Oxford Gene

Technology Limited or related companies (»OGT«) and cannot pass any such license to its customers. A license

under OGT’s patents may be necessary to manufacture or use oligonucleotide arrays. To enquire about a license

under OGT’s oligonucleotide array patents, please contact [email protected].

PCR: PCR is covered by patents owned by Roche Inc. Use of the PCR process requires a license. The use of certain

probes in 5’nuclease assays is covered by European patent EP-B1-0543942 and corresponding patents. The

purchase of this product does not provide a license to use the patented technology described in the above-

mentioned patent. A license to practice this technology for research applications must be obtained by the

end-user from the company entitled to grant licenses under this patent.

DIG: DIG is licensed from Roche Diagnostics GmbH.

Specifi cations in this document are subject to change without notice. miR

CU

RY

TM

LN

A P

rod

uct

Cat

alo

g, v

ers

ion

1.3

- 91

18

51

- ©

ww

w.r

ek

lam

eh

use

t.co

m

Read more about published miRNA research using

miRCURY™ LNA products at www.exiqon.com

North America

Exiqon, Inc. · 600 West Cummings Park · Suite 1650,

Woburn, MA 01801, USA · Phone: +1 781 376 4150

Fax: +1 781 376 4152 · Toll free: +1 888 miRCURY

[email protected] · www.exiqon.com


microRNA Research Research... · 2007-03-12 · microRNA Research miRCURY™ LNA Products ... 12 in...

Documents

Transcript of microRNA Research Research... · 2007-03-12 · microRNA Research miRCURY™ LNA Products ... 12 in...