MicroRNA Control of Appendage Regeneration Benjamin L. King 1,2, Heather Carlisle 1, Ashley Smith 1,...
-
Upload
randolf-sherman -
Category
Documents
-
view
215 -
download
0
Transcript of MicroRNA Control of Appendage Regeneration Benjamin L. King 1,2, Heather Carlisle 1, Ashley Smith 1,...
MicroRNA Control of Appendage RegenerationBenjamin L. King1,2, Heather Carlisle1, Ashley Smith1, Viravuth P. Yin1,2
1Mount Desert Island Biological Laboratory, Salisbury Cove, Maine 04672 USA2Graduate School of Biomedical Sciences and Engineering, University of Maine, Orono, Maine 04451 USA
Appendage RegenerationThe long-range goal of this proposed research is to dissect
the molecular regulation of vertebrate limb regeneration, and apply this information toward designing therapies that restore regenerative responses in humans. The inability to regrow functional limbs or limb segments lost to trauma or disease is a significant biomedical problem, with substantial associated monetary and quality-of-life implications for the nearly two million US citizens. Development of therapies to restore regenerative capacity first requires an understanding of the basic gene regulatory networks controlling this biology. While this capacity is limited only to the very distal tips of digits in mammals, adult teolost fish and urodele amphibians have championed regeneration of entire appendages, replacing bone, connective tissue, epidermis, nerves, blood vessels and pigment cells. The key feature that underscores appendage regeneration is the formation of the blastema, a highly proliferative progenitor tissue that arises through dedifferentiation of existing cells. Our goal is to identify a core genetic signature that regulates the formation and maintenance of the blastema by comparing high-throughput RNA sequencing (RNA-Seq) datasets from regenerating axolotl forelimbs, bichir pectoral fins and zebrafish caudal fins.
Initiation and progression of appendage regeneration involves modulating multiple genetic programs through regulatory factors. MicroRNAs (miRNAs) are short highly conserved non-coding genes that suppress expression of target genes and thereby control multiple genetic programs. Given the important regulatory roles of miRNAs, and evolutionary conservation, we hypothesize that differentially expressed miRNAs define a conserved genetic regulatory circuit important for appendage regeneration. We found six up-regulated and six down-regulated miRNAs common to all three model systems. The most highly up-regulated miRNA in the three models was miR-21. We are currently analyzing corresponding mRNA-Seq data to find candidate target genes for miR-21 and the other commonly expressed miRNAs. Promising candidate genes include several extracellular matrix and adhesion genes commonly down-regulated in axolotl and bichir.
Abstract microRNAs Regulate Regeneration
miR-133 Regulates Zebrafish Caudal Fin Regeneration
microRNAs Regulate Target Genes
Differentially expressed microRNAs define a conserved genetic regulatory circuit important for appendage regeneration.
Hypothesis
Stages of Regeneration
Models of Appendage Regeneration
Experimental Design
Funding & Acknowledgements
This project was supported by grants from the National Institute of General Medical Sciences (P20 GM103423 and P20 GM104318) from the National Institutes of Health, the Department of Defense (W81XWH-11-1-0425) to VPY. We acknowledge Dr. Jim Vincent and the Vermont Genetics Network (P20 GM103449) for assistance with transcriptome assembly analysis.
Wound HealingBlastema Formation
Yin et al. Genes Dev (2008)
High-Throughput RNA Sequencing (RNA-Seq) of Regenerating Limbs
0 dpa
3 dpa
7 dpa (Polypterus) 14 dpa
6 dpa (Axolotl)
- Study three models of regeneration- Uninjured (0dpa), Wound healing (3dpa), Blastema formation (4/6/7dpa), Outgrowth (14dpa)
- Illumina Small RNA-Seq- miRMiner software to annotate microRNAs
- Illumina mRNA-Seq- de novo transcriptome assembly and annotation using Trinity package
4 dpa (Zebrafish)
MicroRNA Annotation and Expression Analysis mRNA Expression Analysis miR-21 Required for Regeneration
qPCR Validation of miRNA Expression
Appendage regeneration requires the formation of the blastema after wound healing. The blastema is a highly proliferative progenitor tissue through dedifferentiation that is maintained during outgrowth.
0 dpa 1 dpa 3 dpa
Amputation
[]
BrdUDay 1Day 1 3 dpa
Blastema
microRNAs Are Highly Conserved
dre-miR-21-5p TAGCTTATCAGACTGGTGTTGGC |||||||||||||||||||||||pse-miR-21-5p TAGCTTATCAGACTGGTGTTGGC ||||||||||||||| |||||ame-miR-21-5p TAGCTTATCAGACTGATGTTGAC ||||||||||||||||||||||hsa-miR-21-5p TAGCTTATCAGACTGATGTTGA 12345678901234567890123
Day 1 2 3 7
Daily IP injections Amputation
Collect samplesProcedure
Experimental Procedure
control, 4dpa anti-miR-21, 4dpa *1.0
0
4 dpa
Reg
ener
ate
len
gth
(m
m)
0
QP
CR
fo
ld-c
han
ge
in
m
iR-2
1 ex
pre
ssio
n
1.0
0.5
Ct 7 dpa 30 dpa
**
* = t-test p-value <0.001
Axolotl Forelimbs
Zebrafish Caudal Fins
Conclusions
Polypterus Fins
Small & Olson Nat Rev Genetics (2004)
Target recognition governed by conserved 5p “seed” region (positions 2-8).
lungfish Axolotl
sarcopterygians
amniotesPolypterus Amia
actinopterygians
Danio
We seek to define a conserved genetic regulatory circuit for blastema formation by comparing three models of appendage regeneration.
Known Blastema-Associated Genes
Novel Blastema-Associated Genes
MiR-21 is upregulated in all three models.
MiR-21 is required for regeneration in these models.
Ongoing analysis of target genes is required to determine miR-21 mechanisms of action.
MicroRNAs, such as miR-21, appear to constitute a conserved regulatory circuit for appendage regeneration.
Common Predicted miRNA Targete
In zebrafish, 36 of 41 genes previously described to be associated with blastema formation were differentially expressed with all but eight up-regulated.
MicroRNA Target Gene Analysis
Common Differentially Expressed Genes
9,652 (56.2%) of 17,173 zebrafish genes detected in the regenerating caudal fin mapped to Polypterus and axolotl transcriptome assemblies.
1,978 commonly up-regulated, 1,199 commonly down-regulated.
Up-Regulated miRNAs
137 down-regulated targets- pdcd4- tgfbr2
Down-Regulated miRNAs
220 up-regulated targets- stk3- bax
Common Up-Regulated miRNAs Common Down-Regulated miRNAs
miRNA Expression Across Models
miRNA Expression in Zebrafish Caudal Fin