Microbial Genome Assembly and Finishing Alla Lapidus, Ph.D. Microbial genomics

Advancing Science with DNA Sequence

Microbial Genome Assembly and Finishing

Alla Lapidus, Ph.D.

Microbial genomicsDOE Joint Genome Institute,

Walnut Creek, CA


A typical Microbial project

Sequencing

Contigs

Base calling

Quality screening

Auto-assembly

Vector screening

Gap closureFINISHING

Assembly

Public release

Annotation


Processing Microbial projects (Sequencing)

• Sanger only (yesterday)– 4x coverage in 3kb + 4x in 8kb + fosmids to 1x if possible– Total ~ $50k for 5mb genome draft

• Hybrid Sanger/pyrosequence/Solexa (today) – 4x coverage 8kb Sanger + 20x coverage 454 shotgun + 20x

Solexa (quality improvement)– Total ~ $35k for 5mb genome draft

• 454 + Solexa (tomorrow – starting this week)– 20x coverage 454 standard + 4x coverage 454 paired end (PE)

+ 50x coverage Solexa shotgun (quality improvement; gaps)– Total ~ $10k per 5mb genome draft


Assembly (assembler)

• Sanger reads only (phrap, PGA, Arch, etc) --3kb-- --3kb-- --8kb--

--8kb-- ---------40kb--------

• Hybrid Sanger/pyrosequence/Solexa (no special assemblers; use

PGA and Arachne) 454 contig454 contig

--8kb-- --8kb-- --8kb-- --8kb--

--8kb-- --8kb-- --8kb--

454 shreds454 shreds

• 454/Solexa (Newbler, PCAP) – 454 reads only

Shotgun readsPE reads


Role of Solexa data: “The Polisher”

• Align solexa reads

• Identify errors

• Automatically suggest corrections for manual curation

• Automatically suggest and implement corrections

G T A

List Disc

x1 – Gx2 – Tx3 – A

etc

x1 x2 x3


Errors corrected by Solexa

CCTCTTTGATGGAAATGATA**TCTTCGAGCATCGCCTC**GGGTTTTCCATACAGAGAACCTTTGATGATGAACCGGTTGAAGATCTGCGGGTCAAA CCTCTTTGATGGAAATAATA**TATTCGAGCATC TTAGTGGAAATGATA**TCTTCGAGCATCGCCTC CGAGCNTCGCCTC**GGGCTTTCCCT CGAGCATCGCCTC**GGGTTCTCCATACACAGA GCATCGCCTC**GGGTTTTCAATACAGAGAACCT CAGCGCCTC**GGGTTTTCCATACAGAGAACCTT ATCGCCTC**GGGTTTTCCAGACAGAGAACCTTT GGTTC**GGGTTTTCCATACAGAGAACCTTTGAT GTTTTCCATACAGAGAACATTTGATGATGAAC GTTGTCCATACAGAGAACTTTTGATGATGAAC TATANCATACAGAGAACCTTTGATGATGAACC ATTTCCAGACAGAGAACCNTTGATGATGAACC CAAACAGAGAACCTTTGAGGATGAACCGGTTG ACAGGGAACCTTAGATGATGAACCGGTTGAAG ACAGAGAACCTTAGATGATGAACCGGTTGAAG ACCGTTGATGATGAACCGGTTGAAGATCTGCG GATGGTGAACGGGTTGAAGATCTGCGGGTCAA GGTTTGAAGATCTGCGGGTCAAACCAGTCCTC GGTGGAAGATCTGCGGGTAAAACCAGTCCTCT GGT.GNAGAGCTGCGGGTCAAACCAGTCCTCTG TGAAGATCTGCGGTTCAAACCAGTCCTCTCCC GATCGGCGTGTCAAACCAGTCCTCTGCCTCGT TCTGCGGGTCAAACCAGTACTCTGCCTCGTTC

Frame shift detected (454 contig)

454 contig

Finished consensus

Sanger reads


Assembly: unordered set of contigs

What we get

10 16 21

10 21

Clone walk(Sanger lib)

Ordered sets of contigs (scaffolds)

New technologies: no clones to walk off

16

PCR - sequence

pri1 pri2

PCR product


Why do we have gaps

•Sequencing coverage may not span all regions of the genome, thus producing gaps in the assembly.•Assembly results of the shotgun reads may produce misassembled regions due to repetitive sequences.•A biased base content (this can result in failure to be cloned, poor stability in the chosen host-vector system, or inability of the polymerase to reliably copy the sequence): ~ AT-rich DNA clones poorly in bacteria (cloning bias; promoters like structures )=> uncaptured gaps ~GC rich DNA is difficult to PCR and to sequence and often requires the use of special chemistry => captured gaps

What are gaps (Sanger)?- Genome areas not covered by

random shotgun


Low GC project and 454Thermotoga lettingae TMO (JGI ID 4002278)

Draft assembly: - 55 total contigs; 41 contigs >2kb- 38GC% - biased Sanger libraries

Draft assembly +454- 2 total contigs; 1 contigs >2kb- 454 – no cloning

6810 bases 454 only out of 2,170,737bp

<166bp> - average length of gaps


High GC stops (Sanger and Hybrid)

• The presence of small hairpins (inverted repeat sequences) in the DNA that re anneal ether during sequencing or electrophoresis resulting in failed sequencing reactions or unreadable electrophoresis results. (This can be aided by adding modifiers to the reaction, sequencing smaller clones and running gels at higher temperatures in the presence of stronger denaturants).


High GC project and 454Xylanimonas cellulosilytica DSM 15894 (3.8 MB; 72.1% GC)

PGA assembly - 9x of 8kb PGA assembly - 9x of 8kb +454

Assembly Total contigs Major contigs Scaffolds Misassenblies* N50

PGA-8kb 210 166 4 165 41,048

PGA-8kb+454 33 23 2 14 288,369


What is Finishing?

The process of taking a rough draft assembly composed of

shotgun sequencing reads, identifying and resolving miss

assemblies, sequence gaps and regions of low quality to

produce a highly accurate finished DNA sequence.

1. All low quality areas in consensus (<Q30) should be reviewed and re-

sequenced.

2. No single clone coverage, i.e. minimum of 2X depth everywhere.

3. Final error rate should be less than 1 per 50 Kb.

Current standards:


Genome closure issues

• Resolve repeats and mis-assemblies– Repeats within or in vicinity of other repeats

– Large repetitive regions

– Complex repetitive regions (tandems)

• Fill in gaps– DNA region lethal to E.coli (Sanger libraries)

– Hairpins, GC rich, hard stops or other 2° structure/physical premature termination

– Hard to PCR (new technologies)

• Other issues– Homopolymeric tracts and other

polymorphisms (SNPs, VNTRs, indels)


JGI Microbial FinishingCurrently: >250 individual microbes

“I am all for finished genomes! It will serve us best in the long run.. Unfinished ones are

likely to contribute to some chaos” – Proff. Sallie W. Chisholm. MIT


Metagenomic assembly

• Typically size of metagenomic sequencing project is very large

• Different organisms have different coverage. Non-uniform sequence coverage results in significant under- and over-representation of certain community members

• Low coverage for the majority of organisms in highly complex communities leads to poor (if any) assemblies

• Chimerical contigs produced by co-assembly of sequencing reads originating from different species.

• Genome rearrangements and the presence of mobile genetic elements (phages, transposons) in closely related organisms further complicate assembly.

• No assemblers developed for metagenomic data sets

The whole-genome shotgun sequencing approach was used for a number of

microbial community projects, however useful quality control and assembly

of these data require reassessing methods developed to handle relatively

uniform sequences derived from isolate microbes.


QC: Annotation of poor quality sequence

To avoid this:

make sure you use high quality sequence;

choose proper assembler


Recommendations for metagenomic assembly

- Use Trimmer (Lucy etc) to treat reads PRIOR to assembly

- Do not use PHRAP for metagenomic projects- None of the existing assemblers designed for metagenomic

data but assemblers like PGA work better with paired reads information and produce better assemblies


Metagenomic finishing: projects

Completed Projects:

Candidatus Korarchaeum cryptofilum OPF8 - is the first of this apparently ancient hyperthermophilic phyletic group to be sequenced

Desulforudis audaxviator - isolated from old water in fissures of a South African gold mine at a depth of 3000 meters. Finished with Sanger and 454

Candidatus Accumulibacter phosphatis Type IIA (CAP) - from EBPR sludge community, US

In progress:

Candidatus Endomicrobium trichonymphae - an intracellular symbiont of a flagellate protist, itself part of the hindgut community of a termite host. It is of interest in the pursuit of the efficient breakdown of cellulose and lignin necessary in the hoped-for conversion of bulk plant materials to CO2-neutral fuel


Metagenomic finishing: approach

Binning:Binning: Which DNA fragment

derived from which phylotype?

(BLAST; GC%; read depth)

Non-CAP readsNon-CAP reads

CAP readsCAP reads

++

Complete genome of Complete genome of Candidatus Accumulibacter

phosphatis

Lucy/PGALucy/PGA

Candidatus Accumulibacter phosphatis (CAP)

~ 45%


The end

Microbial Genome Assembly and Finishing Alla Lapidus, Ph.D. Microbial genomics

Documents

Transcript of Microbial Genome Assembly and Finishing Alla Lapidus, Ph.D. Microbial genomics