Michal Ziv-Ukelson Comparative Structural RNAomics (Pattern Matching on Strings,

21
Michal Ziv-Ukelson Comparative Structural RNAomics ( Pattern Matching on Strings , ( nd Graphs Trees

description

Michal Ziv-Ukelson Comparative Structural RNAomics (Pattern Matching on Strings, ( and Graphs Trees. Structure. Function. Context Fold. Context Fold. Applied machine learning algorithms over large datasets of solved structures. RNA Structural Search 1(STRMS). - PowerPoint PPT Presentation

Transcript of Michal Ziv-Ukelson Comparative Structural RNAomics (Pattern Matching on Strings,

Page 1: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

Michal Ziv-Ukelson

Comparative Structural RNAomics (Pattern Matching on Strings ,

(and Graphs Trees

Page 2: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 3: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 4: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 5: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

Context Fold

Page 6: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

Context Fold

• Applied machine learning algorithms over large datasets of solved structures

Page 7: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 8: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 9: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 10: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 11: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 12: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 13: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

ACGCUGACGUAGUCAGUAGACGACAGACAGAUACGUCACCGCAGAUACGCAUAGUAGCAGUAGCAGAUGACGACGCUGACGUAGUCAGUAGACGACAGACAGAUACGUCACCGCAGAUACGCAUAGUAGCAGUAGCAGAUGACG…………………………………………………………………………………………

Genome SequenceQUERY

Are there any appearances of this structure in the genome?

RNA Structural Search 1(STRMS)

Page 14: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 15: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

ACGCUGACGUAGUCAGUAGACGACAGACAGAUACGUCACCGCAGAUACGCAUAGUAGCAGUAGCAGAUGACGACGCUGACGUAGUCAGUAGACGACAGACAGAUACGUCACCGCAGAUACGCAUAGUAGCAGUAGCAGAUGACG…………………………………………………………………………………………

Genome Sequence millions of nucleotidesQUERY

Are there any appearances of sequences that fold similarly to

this sequence in the genome?

RNA Structural Search 2 (Stem Search)

Page 16: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

B

C

Page 17: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

ON CLIC

K

B

C

Page 18: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

Stem Search

Page 19: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,
Page 20: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

Results

Page 21: Michal  Ziv-Ukelson Comparative Structural  RNAomics (Pattern Matching on Strings,

Results

dashed arrows - validated targets

solid green arrows - new regulation patterns discovered in our module