MHC-LINKED GENETIC SUSCEPTIBILITY TO INSULIN …€¦ · The rat MHC (RTl) contains two expressed...
Transcript of MHC-LINKED GENETIC SUSCEPTIBILITY TO INSULIN …€¦ · The rat MHC (RTl) contains two expressed...
MHC-LINKED GENETIC SUSCEPTIBILITY TO INSULIN-DEPENDENT DIABETES MELLITUS
(IDDM) IN THE BB RAT
Rohan Pointer
Deparmient of Physiology
McGiU University, Montreal. Quebec. Canada
A thesis
submitted to the Faculty of Graduate Studies and Research
in partial fu l fhent of the requiremenü for the degree of Master of Science
@Rohan Pointer, 1996
National Library Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Setvices services bibliographiques 395 Wellingîm Street 395, nie Weliington ûtîawaON K 1 A W W O N K 1 A W Canada canada
The author has granted a non- exclusive licence allowing the National Libraty of Canada to reproduce, loan, distribute or seil copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts from it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
Abstract
Genetic predisposition to insulin-dependent diabetes meiiitus (IDDM) involves one or more
loci within the class II region of the major histocompatibility cornplex (MHC). The
strongest MHC-linked determinants of disease susceptibility have k e n associated with polymorphisms in both the a and B chain subunits of HLA-DQ (human) and 1-A (mouse)
class II molecules. Specifically, protection against IDDM developmeni is associated with the presence of aspartic acid at position 57 of the chah while non-aspartic acid residues
are found in diabetogenic B chahs. Ln humans, the greatest risk of disease development is
observed in individuals with Arg 52+ d A s p 57- B heterodimers. The BB rat is a usehl
system in which one c m identify and characterize the genes necessary for the onset of
IDDM. Although sequence data have been reported for various alleles of these class ïI genes, the effect of polymorphisms in the rat MHC is not nearly as well characterized as it is in humans or the NOD mouse. The rat MHC (RTl) contains two expressed class II loci, RT 1.B and RT 1 .D, each encoding two class II molecules: RT I .B a and B. and RT 1 .D a and B. This study detemined the nucleotide sequences of relevant regions from the RTl .B and RTL .D a@ genes in five rat strains (ACI, BB. Buffalo, Lewis, and Wistar-Furth) of
varying susceptibility to IDDM to examine the role of specific polymorphisms in
predisposition to disease. The data show that BB and Wistar-Furth rats (RTP haplotype) have identical class II sequences at al1 of the regions examined. Although no unique a chain
sequences were found to associate with IDDM, we did confirm the association of aspartic acid at position 57 of RT 1 .BP with susceptibility to diabetes. We suggest that the aspartate
observed at position 57 of the RT1 .DP chain - though not associated with IDDM - may influence genetic susceptibility to other autoimmune diseases. Both class 11 P chain loci
were also found to contain pseudogenes which may play a role in the generation and
maintenance of MHC divenity.
Résumé
La prédisposition génétique au diabète insulino-dépendant (DID) implique un ou plusieurs
gènes de classe II du complexe majeur d'histocompatibilité (CMH). La liaison la plus forte
entre cette region et le risque de développer un diabète de type 1 a été associée avec des polymorphismes spécifiques sur les chaînes a et P du CMH classe II chez l'homme (HLA-
DQ) et chez la souris (1-A). Une protection contre le DID est associée avec la présence d'un acide aspartique en position 57 de la chaîne P, tandis qubn trouve d'autres acides aminés à
cette place sur les chaînes qui sont diabétogéniques. Les individus les plus à risque de
développer le Dm sont ceux qui possèdent les hétérodimères Arg 52+ a/Asp 57- p. Dans
notre laboratoire, nous nous servons du rat BB pour identifier et caractériser les gènes de
prédisposition au DID. Malgré le fait que des séquences d'ADN ont été rapportées pour quelques allèles de ces gènes de classe ïI chez le rat. l'effet des polymorphismes dans le
CMH du rat n'est pas aussi bien caractérisé qu'il est pour les humains ou la souris NOD. Le CMH du rat a deux loci. RTI .B et RTI .D, qui contiennent chacun deux molécules de classe II: RT1.B a et B, et RT1.D a et P. Cette étude a déterminé les séquences
nucléotidiques des régions pertinentes des gènes RT1.B et RT 1 .D (a et P) pour cinq
souches de rat (ACI, BB, Buffalo, Lewis, et Wistar-Furth) qui different dans leur degré de
prédisposition au DID. Nous avons étudié le rôle possible des polymorphismes spécifiques
dans la susceptibilité au diabète de type 1. Les résultats montrent que le rat BB et le rat
Wistar-Furth (I'haplotype RTIU) ont des séquences de classe Ii qui sont identiques à toutes les régions examinées. Quoiqu'on ne trouve pas de séquences uniques de la chaîne a qui
s'associe avec le DiD, on a confme l'association de Asp 57+ sur la chaîne P de RT1 .B avec une prédisposition au diabète. On suggère que l'acide aspartique présent à la position 57 sur la chaîne p de RT1.D - même s'il n'est pas associé avec le DID - pourrait influencer
la prédisposition génétique aux autres maladies autoimmunes. De plus, nous avons trouvé des pseudogènes dans les deux loci de classe iI pour les chaînes p qui pourraient peut-être
jouer un rôle dans la production et le maintien de la diversité du CMH.
Table of Contents
Abstract
Résumé
Table of Contents
List of Tables and Figures
Acknowledgements
1 . Introduction
Historical Perspective
The Pancreas
Insulin
Autoimmunity
Animal Models
a. The BB Rat
b. The NOD Mouse
Gene tics
Major Histocompatibility Complex
a. Molecdar Structure
b. Regulation of h u n e Response
c. Association with Type 1 Diabetes
Objectives
2 . Materials and Methods
2.1 Rats
2 2 Preparation of DNA
3.3 Polymeme Chain Reaction
2.4 Sequencing
Table of Contents (continuedl
2.5 PCR Amplification of RTl.DP cDNA
2.6 Southem Blot Analysis
2.7 DNA Probe
2.8 Allele-Specific Oligonucleotide Slot Blots
3 . Results
3.1 Determination of the Partial Nucleotide Sequence for RT 1 .Ba
3.2 Determination of the Partiai Nucleotide Sequence for RT 1 .BP
3 -3 Determination of the Partial Nucleotide Sequence for RT 1 .Da
3.4 Determination of the Partial Nucleotide Sequence for RT 1 .DB
4. Discussion
5 . Conclusion
6. Bibliopphy
List of Finures and Tables:
Figure 1:
Figure 2:
Figure 3:
Table 1:
Figure 4:
Figure 5:
Figure 6:
Figure 7:
Figure 8:
Figure 9:
Figure 10:
Figure 1 1 :
Figure 12:
Figure 13:
Figure 14:
MHC-restricted antigen presentation to T ceils
Schematic diagram of the structure of a class II MHC molecule
Genornic organization of the MHC in humans, mice and rats
Nucleotide sequences of primers
Nucleotide sequences from 1 st domain of RT 1 .Ba
Comparison of 1st domain amino acid sequences for RTl .Ba
Nucleotide sequences from I st domain of RT 1 .BP
Allele-specific oligonucleotide (ASO) slot blots
Cornparison of 1st domain amho acid sequences for RT 1 .BP
Nucleotide sequences from 1 st domain of RT 1 .Da
Comparison of 1st domain amino acid sequences for RT1 .Da
Nucleotide sequences from 1st domain of RTl-DP
Southem blot analysis of ScaI-digested DNA kom AC1 and BB rats
Comparison of 1st domain arnino acid sequences for RT I .DP
The a and gene order within the class II loci of the rat MHC
This Master's thesis is the culrniaatioa of three yeras spent in the McGill Cancer
Centre. DiiRng that timc, 1 have k c n helped by many paoplt within and outsdc the hb
who desem mention. Rachdle Lega patitntly taught m ihc tcchuiques which this pmjeçt
d d e d Aurora Labitan also pas& on som of what she knows and kept me laugbing
during my shm-hed career in tissue culture. 'Ibe dl-impor*int rats (and rat picas) for my
expaimcnts were prwidcd by M m Al-Sa€far whilc Helbe Lacmix gcnaously gave a
geat deal of technid advice. 1 worked in the Cancer C e n a and was aided in innumerable
ways by its staff, but Liada Tracey was my life line to the Physiology Deparment and
madcitapleasuntobeasndaittùerem.
My supcmisor, Dr. A. Fuks, &as taught mt much about science and about life for
which 1 am grateful. His wisdotn, knowledge, and kindness will continue to inspire me
long after 1 have moved on. Unofficially, Dr. G. Rice was my co-supervisor. This entailed
nos ody helping m to analyse data, but also having an open door and empty chair when 1
needed it and he had many otha things to wony about. My supe~sory cornmittee was
comprised of Drs. G. Prud'homme, E. Colle. aad R. Guttmann; their expertise in
immunology bettered my project and ducation.
nie Cancer Center has been hill of fkiends who helpeù me to weather the tough
times of graduate school and celebrate the good ones. However. 1 owe the most to Annie,
h a family, and my own. Their support and encouragement got me here in the k t place.
1. Introduction
1.1 Historical Peitsoective
The earliest recorded description of diabetes mellitus dates back thousands of years
to ancient Egypt (Goodfellow et al., 1994). Diabetes, Literally "through-passer" in Greek,
was coined in the second century BC after one of the disease's charactenstic symptoms. "a
wasting of the flesh and limbs into urine" (Von Engelhardt, 1987). Mellitus, Latin for
"honey", was later added in reference to the diagnostic discovery that urine of diabetics was
sweet to the taste (Kahn et al., 1994). It was not until the close of the 18th century,
however, that this sweetness was Iinked to elevated levels of sugar in the urine (Bliss,
1982). Subsequent clinical studies showed that the degree of glycosuria could be
influenced by diet: under-nourishment on regimens high in fat and protein resulted in the
lowest levels of excreted glucose and, therefore, was prescribed to prolong the lives of
those afflicted (Kahn et al., 1994). These restricted diets remained the best treatment
available to diabetics for more than 100 years.
I .2 The Pancreas
Much controversy surrounded the organ(s) primarily involved in diabetes rnellitus;
candidates included the kidneys. liver, pancreas, and stomach. The first step toward
definitively narrowing this field came in 1875 with the publication of a senes of long-term
studies that identified two foms of the disease. In response to a restricted diet and exercise
the condition of older (usually obese) patients was seen to improve remarkably while the
health of younger patients contùiued to deteriorate despite the same treatment. Post-mortem
examinations revealed pancreatic lesions only in the younger group of patients. Taken
together, these observations suggested that juvenile (type 1) diabetes mellitus was a disease
of the pancreas (Kahn et al., 1994).
2
At the time of this study it was difficult to explain how the pancreas could be
involved in the pathogenesis of a metabolic disease such as diabetes mellitus because
understanding of the organ was limited to its exocrine function. This soon changed when
the association between the pancreas and diabetes mellitus was fomiitously confirmed by a
study designed to determine the exact role of the pancreas in digestion. The experiments
consisted of performing complete pancreatectomies on healthy dogs and subsequently
observing them for theY ability to absorb fats. However, within 24 hours of the operations
every animai had become acutely diabetic (Kahn et al., 1994). This unexpected tum of
evenü convincingly established that the pancreas has two distinct functions - one important
for digestion and the other crucial to metabolism - and thus paved the way for research on
the treatment of diabetes mellitus.
The realization of this dichotomy brought the scientific world's attention back to the
almost-forgotten dissertation of a German medical student by the narne of Paul Langerhans
who, nearly twenty years earlier, had presented his findings on pancreatic histology. In
addition to the organ's acinar cells aiready known to secrete digestive enzymes, Langerhans
had described a new ce11 type distributed throughout the pancreas, localized in clusters, and
histologically distinct from the acinar cells. The function of these "islets of Langerhans"
was not known (Bliss, 1982). With the description of a sudden-onset diabetes in
depancreatized dogs, speculâtion arose that the islets of Langerhans produced a substance
necessary for the regulation of metabolism and absent in the diabetic staie. Logically, the
next step was to isolate this substance and deliver it to diabetics. Efforts to do so began
around 1900 and continued until 1921 when Frederick Banting and Charles Best
successfully extracted the elusive pancreatic hormone which they called insulin (Bliss,
1982). This discovery changed the lives of diabetics around the world.
1.3 Insulin
Insulin acts on various cells of the body to promote the uptake of glucose. In a
healthy individual as blood glucose levels rise there is a correspondhg increase in the
production and release of insulin from the beta cells within the islets of Langerhans.
Together with its antagonist, glucagon (another hormone of the pancreatic islets), insulin
maintains a constant blood sugar level (Guyton. 1991). Insulin deficiency - as seen in
insulin-dependent diabetes mellitus (IDDM - cnpples the regulation of blood glucose levels
with grave consequences. in fact pnor to the availability of insulin replacement therapy,
diagnosis of type I diabetes was effectively a death sentence since most patients died within
one year. No longer able to utilize dieiary glucose, their bodies would allow it to
accumulate in the bloodstream. This hyperglycemia eventually overwhelmed the kidneys
and glycosuna would develop. The sugar (a potent diuretic) resulted in frequent urination
and an insatiable thirst. Despite an increased appetite, the lack of nourishrnent quicldy led to
weight loss and weakness. The body would then attempt to compensate for its inability to
metabolize carbohydrates by switching to fats and proteins as a source of energy, but
because the catabolism of fatty acids is accompanied by a nse in the levels of aciâic ketones
this strategy failed and patients soon developed metabolic acidosis (Bennett et al., 1996).
Diabetics at this stage were often described as lethargic and smeiling of "rotten apples" due
to the volatile ketone bodies which they exhaled (Bliss, 1982). As the metabolic burden
becme intolenble these patients slipped into a coma and died.
With the advent of insulin, effective treatrnent of DDM was fmally possible and the
helpless decline toward death became a thing of the pst . However, patients were now
dependent on multiple daily insulin injections for the rest of their Lives and vulnerable to
long-term complications including retinopathy. nephropathy. and atherosclerosis (Bennett
et al., 1996). Ideally, what diabetics desired was a way to cure their disease or, better yet,
4
prevent it aftogether. With this in muid. reseachers set out to undeatand what goes wrong
to bnng about IDDM and who was at nsk for developing disease.
1.4 Autoirnmunitv
While the lesions fint noted during autopsies of juvenile diabetics in the 19th
cenniry implicated the pancreas in disease progression, a full appreciation of their relevance
to disease pathogenesis could only corne with the discovery of insulin and a better
understanding of the pancreas' endocrine functions. It was thus that a series of studies
beginning in the 1940's provided the fust evidence to suggest that IDDM was autoimmune
in nature. Under rnicroscopic examination. pancreatic sections from patients who had died
of a recent onset of type 1 diabetes repeatedly showed that the characteristic lesion, insulitis,
was due to an infiltration of mononuclear immune cells into the islets. These cells included
macrophages, T lymphocytes. and B lymphocytes (Bach, 1994). An autoimmune
pathogenesis for iDDM was further supported by subsequent discoveries of: islet ce11
antibodies in diabetic patients (Bottauo et al., 1989); specific responses against islet ce11
antigens in vitro with T lymphocytes obtained from diabetic patients (Rossini et al., 1985);
rejection of pancreatic transplants between identical twins discordant for disease (Bach.
1994); and the partially-successful treatrnent of type 1 diabetes with irnmunosuppressive
dmgs such as cyclosporin A (Stiller et al., 1984).
1 -5 Animal Models
Animal models for type 1 diabetes have been invaluable in advancing Our
understanding of the etiology of IDDM. They aiiow for selective breeding of inbred strains,
observation of many generations in a short p e n d of time, complete environmental control,
biochemical and genetic alterations, and testing of experimental therapies to cure or prevent
disease - al1 of which are fundamentdly important to diabetes research but
5
impossible in human studies. While no one animal mode1 perfectly &ors human IDDM,
the non-obese diabetic (NOD) mouse and Bio-Breeding (BB) rat are widely accepted as the
best models avaiiable.
a. The BB Rat
The BB rat was discovered in 1974 at the Bio-Breeding Laboratories of Canada
Ltd. in Ottawa when it was noted that the death rate among weaniings from a commercial
colony of Wistar-derived rats was unusuaily high. Further investigation into this elevated
mortality revealed that diabetes mellitus was the cause (PYfrey et al., 1989). Through daily
injections of insulin, these animals were kept dive and a breeding coiony of diabetic rats
was created. Crossbreeding parents of diabetic animals gave a disease incidence of 10%
which could be increased to 25% by selective father-daughter mating (Crisa et al., 1992).
Breeding colonies descended from these original litters in Ottawa have since k e n
established around the world and Vary in both the incidence (20-80%) and severity of
diabetes (Kahn et al., 1994; Parfrey et al., 1989).
Disease in these rodents shares many characteristics of human IDDM including:
weight loss, hyperglycemia, hypoinsulinemia, glycosuria, and ketonuria. The sudden
appearance of these clinical symptoms in adolescent male and female rats is preceded by
insulitis and. ultimately, destruction of the insulin-producing beta ceiis. Pancreatic biopsies
have shown the infiltrating cells to consist of lymphocytes, macrophages, natural killer
cells, and occasionally eosinophils (Crisa et al., 1992). While the mean age of disease
onset is 85 days, it can range from 55 to 140 days (Colle, 1990) and quickly leads to death
if the animais do not receive insulin injections.
In addition to insulitis, numerous observations in the BB rat support an
autoimune pathogenesis of IDDM. One of the most convincing demonstrations of T cell-
mediated autoimrnunity in type 1 diabetes meiiitus cornes h m passive transfer
6
experiments. When ConA-activated peripheral or splenic lymphocytes from diabetic BB
rats are injected into diabetes-prone BB rats, diabetes can be transferred to a large
percentage of the recipients (who normally have a low disease incidence (Rossini et al.,
1985)). Further evidence of T cells in the pathogenesis of IDDM cornes from studies
showing that neonatal thymectomies of BB rats prevent the development of IDDM in later
life (Crisa et al., 1992). Aiso, as with human disease, islet transplants from disease-
resistant BB rats to syngeneic, diabetic BB rats are rejected (Rossini et al., 1985).
Unlike human IDDM, disease in the rat is sometimes accompanied by an
autoimmune thyroiditis (Colle et al., 1985). The most srriking difference between diabetes
in humans and the BB rat, however, is that the latter bas an immunoregulatory defect which
results in marked T ce11 lymphopenia in peripheral blood, spleen, and lymph nodes
(Parfrey et al., 1989). Breeding studies between lymphopenic rats and other inbred strains
indicate that this T ce11 lymphopenia is an autosomal recessive trait (Colle, 1990). While
there is a global deficiency in T ce11 subsets, the predominant depletion is observed in
cytotoxic/suppressor (CD8+) OX8+ cells (Crisa et al., 1992). Diabetic rats are also devoid
of RT6+ T lymphocytes; RT6 being a T cell-differentiation antigen of unknown function
(Koch et al., 1990). Because IDDM can be induced in diabetes-resistant BB rats by
selectively depleting their RT6+ T lymphocytes. this ce11 population is thought to be
important in the regulation of IDDM susceptibility (Greiner et al., 1987; Kosuda et al.,
1994).
Functionally, the lymphocytes of diabetic BB rats have depressed proliferative
responses to ConA and other mitogens, but these can be improved by the removal of
macrophages from the ce11 suspension (Prud'homme et al., 1984). The histology of the
thymus in BI3 rats prone to diabetes is nomal (Colle, 1990) and thyrnic transplants from
diabetes-resistant rats into irradiated diabetes-prone (DP) rats reconstituted with DP bone
7
marrow cannot correct disease (Parfrey et ai.. 1989) suggesting that the irnmunoregulatory
defect is prethyrnic.
While islet ce11 surface antibodies (ICSA) - which are infrequently found in litters
from low-incidence rat lines - are present in most BB rats from high-incidence colonies,
islet ce11 cytoplasmic antibodies have not been detected in the BB rat. This would seem to
support a role for humoral immunity in pancreatic islet destruction without directly targeting
the beta ceiis (Rossini et al., 1985).
b. The NOD Mouse
The NOD mouse was developed in Iapan in 1980 from a breeding program
intended to establish a cataract-prone line (CTS) of inbred mice from the non-inbred ICR
strain (Jaramillo et al., 1994). 26 generations of selective breeding between a
hyperglycernic subline of the CTS mice gave rise to a female mouse who spontaneously
developed diabetes. and the NOD mouse strain was bom. Disease incidence in NOD
colonies is consistently 80% of females and 20% of males by seven months of age
(Kikutani et al., 1992); a gender bias that is not observed in human diabetic patients. As
with the BB rat, IDDM arises spontaneously in juvede NOD mice (between 12-16 weeks)
and manifests the clinical features associated with human disease.
Insulitis is also observed in NOD mice prior to the onset of diabetes. T cells
constitu te the majority of these mononuclear infiltrates which also include B lymphocytes.
monocytes. and natural killer (NK) cells (Kahn et al., 1994). Evidence supporting T cells
as the mediator in autoimmune destruction is, again, abundant. Neonatal thymectomies
significantly reduce the incidence of IDDM in NOD mice (Bach, 1988). and nude NOD
rnice which are T ce11 irnrnunodeficient never develop diabetes (Kahn et al., 1994).
Monoclonal anti-CD4 antibodies administered in vivo can prevent insulitis and overt
diabetes in NOD mice or block progression to diabetes in mice that have pancreatic lesions
8
(Kikutani et al.. 1992). These findings suggest that CD4+ T lymphocytes are instrumental
in the initiation and progression of IDDM. They do not act alone, though, as shown by cell
transfer experiments: spleen celis of T lymphocytes fiom diabetic mice lose their ability to
transfer diabetes to young irradiated or neonatal NOD mice when the donor cells are
depleted of either CD4+ or CD€!+ T lymphocytes (Kikutani et al., 1992). While islet cell-
specific autoantibodies can be detected in the sera of NOD mice, many researchen believe
these antibodies to be secondary to the T cell-mediated autoimmune destruction of
pancreatic islets (Castano et al.. 1990; Kikutani et al., 1992).
1.6 Genetics
As this research on the pathogenesis of disease advanced, knowledge of the
genetics underlying D D M was also progressing. Epidemiologic studies have shown that
type 1 diabetes occun predominantiy in children and young adults under the age of 20
(Todd et al., 1988). While the incidence of IDDM varies among different ethnic groups.
roughly 0.5% of the Caucasian population is affected (Rossini et al.. 1985). IDDM has
long been recognized as a familial disease but does not follow the classic laws of Mendelian
inheritance: the risk of developing diabetes is approximately 6 9 for a child born to a
diabetic and 7% for the sibling of a diabetic; the concordance rate between monozygotic
twins is 3540% (Bach, 1994).
This non-iinear increase in diabetic risk with increasing genetic-relatedness mles out
the possibility of a single-gene model of disease and instead supports a polygenic mode of
inheritance. The fact that identicai twins have a disease concordance rate weli below 100%
indicates that a non-genetic component is also invoived in susceptibility. Severai multi-gene
models were tested for the observed risk relationships and the best-fittinp model was found
to be that of a single major susceptibility locus requiring many minor genetic/environrnentai
factors which contribute a much srnaiier, additive effect (Rich, 1990). Observations of
9
seasonal variation in the onset of IDDM and associations between virai infections (from
Coxsackie to influenza) and diabetes gave rise to the theory that an environmental insult
such as viral infection triggers disease onset in genetically-susceptible individuals (Rossini
et al., 1985).
Armed with this blueprint of genetic susceptibility to DDM. researchers were
determined to identifj the predisposing genes. Begiming in the 1 9 8 0 s . a number of family
and population studies indicated that the strongest genetic determinani of susceptibility to
IDDM is encoded by one or more genes within the Major Histocompatibility Complex
(MHC).
1 -7 The Major Histocompatibilitv Complex
The MHC was discovered in the 1940's by George Snell during his analysis of the
mxhanisms of skin gr& rejection. By performing transplantations between inbred mice
strains he showed that: 1) grafts between mice of the same inbred strain are always
accepted 2) grafts between mice of different inbred strains are ahnost always rejected and 3)
when two different inbred strains are mated. the resulting offspring will never reject a graft
from either parent but the parents will almost always reject a graft from their offspring
(Abbas et al., 199 1).
These observations led Snell to hypothesize that graft rejection resulted from the
recognition by the host's immune system of CO-dominantly expressed, polymorphic gene
products present in the donor graft. To identify the genes which encoded these target
proteins, he inbred the donor and recipient animals until the genetic differences between the
two had been rninimized to a small region of DNA containing the responsible genes. These
congenic mice showed that although multiple (minor histocompatibility) genes contribute to
rejection, a complex of related genetic loci, the major histocompatibility complex. is
primarily responsible for the success or failure of a transplant (Damell et al.. 1990).
10
Despite the fact that the MHC was discovered through its role in transplant
rejection, it is now clear that the main function of the proteins encoded by this complex is to
regulate the physiological immune response. T lymphocytes are incapable of recognizing
soluble antigen. The T ce11 receptor cm only recognize - and mount a cell-mediated
response against - antigen which has been processed into peptide fragments that are
presented in the context of an MHC molecule. As shown in Figure 1, the T ce11 receptor
recognizes the MHC molecule and antigenic peptide as a single complex.
The genes of the MHC can be grouped into three classes, two of which bind
antigen and are crucial to cell-mediated immunity. Class 1 genes encode the classic
transplantation antigens of Snell's experiments. These glycoproteins are found on the
surface of al1 nucleated cells and are the self molecules recognized in conjunction with
endogenously-synthesized antigen by the CD8+ cytotoxic T cells. The expression of class
II genes is restricted to a srnaller pool of cells (antigen-presenting cells) largely made up of
B lymphocytes, macrophages, and dendritic cells. As with class 1 molecules, these class II
glycoproteins are present on the ce11 surface but function in the presentation of exogenous
antigen to CD4+ helper T cells. The remaining genes of the MHC are grouped into the class
III locus and encode a variety of blood proteins and other ce11 surface proteins (Watson et
al., 1992).
a. Molecular Structure
Class 1 and class 11 MHC molecules have a very similar structure. As seen in Figure
2, class II MHC molecules are composed of two non-covalently associated polypeptide
chains. These a (32-34 kD) and (29-32 kD) chains are encoded by different genes of the
MHC whose exonlintron organization correlates with the protein structure (one exon per
domain). The extracellular region is subdivided into two domains, each approximately 90
amino acids long with the amino termini of both the a and chains (al and P 1,
Figure 1: MHC-restricted antigen presentation to T cells. Class II MHC
heterodimers on the surface of antigen presenting cells (APC) present processed antigen to
T lymphocytes. The T ce11 receptor recognizes the peptide and MHC molecule as a single
cornplex, leading to T ce11 activation and Lymphokine production.
class II MHC \
T ce11 receptor
13
respectively) forming the antigen binding site. Nuclaotide sequencing has shown this
region to be highly plymorphic. In contrast, the membrane-proximal regions (a2 and $2)
are relatively non-polymarphic and contain intemal disulnde bonds which are simüar to
immunoglobuiin domains* Less than om third of each chah is accounted for by the
intraceiluiar carboxy terminus and cransmembrane domain (Abbas et al., 199 1; Kauhnan a
ai., 1984).
When the thra-dimcasiood structure of c h 1 (Bjorkman et al., 1987) and lata.
class II MHC molecules (Brown et al., 1988) was determinecl by X-ray crystallography , it
showed that the a and f!irst extraceliular domah folded to form an eight-stranded, P- pleated sheet supporting two a helices; simply put - a pocket. This pocket f m the
antigen recognition si& within which antige~c peptides are bound for presentation to T
lymphocytes. As previously mentioned, nucleotide sequencing had shown diis region of
die MHC m o l d e to be highly polymorphic. Whai the amino acid substitutions resulting
fiom these nucleutide polymorphisms were mapped to their positions in the mode1 many
of the differences were found to occur at residues located dong the interior face of the cleft
wail which corne into direct contact with the bound antigen.
b. Wlation of Immune Remonse
This stmcturai insight provided a functional basis for immune spefificity.
Polymorphisms within the peptide-anding cleft generate different MHC molecules (alieles)
that Vary in their ab'ility to bind a given antigen and present it a> die cellular immune system
for recognition and response. This has been documentai in peptide elution studies which
show that class II molecules differing by d y one residue in the antigen recognition site
will bind overlapping - but distinct - sets of peptides (Rarnensee et al., 1995; Reich et al.,
1994). Antigen presentation is thus MHC-resaicted as wel as king MHC-dependent.
MHC-nstnction is of fundamental importance to the inmiune ceil interactions which
Figure 2: Schematic Diagram of the Structure of a Class II MHC Molecule.
The class II MHC molecule c m be divided into domains which correspond to the exon-
intron structure of the underlying genes. The membrane-proximal a2 and P2 domains have
structural homology with irnrnunoglobulin constant region domains while the highly
polymorphic a 1 and P 1 domains fold to fom the antigen recognition site.
al P l
peptide binding re --------- --LI-------.
immunoglobulin-like region
membrane
cytoplasm
HOOC COOH
16
determine the T ce11 repertoire during thyrnic education. Positive-selection of self-MHC-
restncted T lymphocytes is Followed by negative selection of potentidiy autoreactive clones
(Abbas et al.. 1991) which, ideally, results in a tolerance to self while creating a mature T
ceIl repertoire capable of responding against foreign antigen. MHC gene products continue
to control the fate of these mature T lymphocytes as discussed above.
In these capacities, class 1 and class II MHC molecules greatly influence the
specificity and degree of immune responsiveness. making them prime candidates as
predisposition genes for an autoimmune disease such as IDDM. Ironically, the inital
association between these molecules and IDDM was made fortuitously in the early 1980's
before the regulatory role of the MHC in cell-mediated irnmunity was fully understood.
When the frequencies of serologically-defined alleles of MHC molecules were compared
among diabetics (both related and non-related) and the general population. a linkage
disequilibrium was observed (Bach, 1994). Certain sets OF MHC alleles (haplotypes) were
positively associated with disease while others displayed a negative association. Similar
linkage disequilibriums have subsequently been observed in both rodent models of disease.
The human MHC, more comrnonly referred to as the human leukocyte antigens
(HLA), is located on chromosome 6 where it spans over 3000 kb. The gene order moving
from centromere to telomere is depicted in Figure 3: class II loci (HLA-DP, -DQ, and
-DR), class III, and class I loci (HLA-B, -C, -A) (Todd et al., 1988). Genomic
organization of the somewhat smaller (approxirnately 2 0 kb) MHC cornplex in rocients
differs from that of the HLA (Figure 3). The class 1 loci of the murine MHC (the
histocompatibility-2 (H-2) complex, located on chromosome 17) are divided to flank the
class II and class III loci, giving a centromere to telomere order of: class 1 (H2-K), class II
(1-A, -E), class III, and class 1 (H2-D, -L) (Abbas et al., 199 1). The rat MHC, or RT1 for
rat transplantation antigens, is located on chromosome 20 and shares the mouse gene
17
mgankation: class I (RT1 A), class II @€Tl-H, .B, and .D), ciass III, and class 1 (RT1 E
and .C) (Srivastava et ai,, 199 1).
c, Association with Twe 1 Di-
Susceptibility to IDDM is m ~ s t closely Wed to the class II region of the MHC. in
humans, the strongest positive disease association is specificaily with the HLA-DR3 and/or
-DR4 haplotypes (95% of Caucasian IDDM patients compared with 50% of the genaal
population) (Field, 1988). Numemus serological and restriction fragment length
polymorphism (RFLP) studies have indicateû that genes of the HLA-DQ locus contribute
more m this association than the -DR genes within these haplotypes (Sterkers et al., 1988;
Todd et al., 1988). Several 0th- HLA haplotypes consistently exhibit a negative
association with type 1 diabetes suggesting that the MHC-Iinked gene(s) can confa both
resistance and susceptibility to disease (Ronningen et al., 1989).
When the expressad class II gene products exhibiting some degrce of
polymorphism in humans were sequenced from the cDNA of diabetics and healthy
conaols, a unique sequence exclusive to the patients was not obsmed. However, many of
the haplotypes which positively associateci with lDDM did correlate dirscdy with a
polymorphism in the amino acid sequence of the HLA-DQB chah: susceptibity to IDDM
stmngly associated with the alleles which encodtd an amino acid orher than aspartic acid at
position 57 (Asp 57.) of this chah whik aspartic acid was present (Asp 5 7 9 in al1 of the
alleles which were negatively associated with disease (Td et al., 1987).
Foliowing extensive sequencing of class II MHC aüeles within the Caucasian
population, it was postuiated that Asp 57- homozygosity is necessary, yet not sufficient,
for fidl HLA-susceptibility in the majority of diabetics. 90% of the Caucasian diabetics
whose EEA-DQp deles were sequenced proved to be Asp 57- homozygotes while
individuals who were hetermygous (Asp 57-/Asp 5 7 9 at the HLA-Da chah
Figure 3: Genomic Organization of the MAC in Humans, Miee and Rats.
Genomic maps of the human, mouse. and rat MHC on chromosomes 6, 17, and 20
respectively. The three maps have been aligned to allow for a cornparison of the order of
the hornologous loci in these three species.
Class II Class 1
HLA-8 HLA-C HLA-A
1 centromere telomere
MOUSE
Class 1 Class 1
1- A 1-E H2-D H2-L
I centromere te tomere
RAT
Class 1 Class III Class 1
RT1 .A RT1.H RT1.B RT1.D RT1.E RT1.C
I ce ntromere telomere
20
demonstrated a much lower ri& of developing IDDM. The presence of two Asp 57+ alleles
provided a h t complete nsistance to IDDM (Todd a al., 1987). Sequencing studies in
d e r ethnic groups ais0 supponed this correlation. 'Ihe incidence of type 1 diabetes in
Japan, for example, is 5-10% of its North American couterpart and h s t ali of the HLA-
DQf3 chab alleles in the Japanese population are Asp 57+ (TOM et al., 1988).
It is known that disease developmnt in the BB rat also requires the expression of
specific ciass II alleles. Susceptibility to IDDM is 8SSOCi8ted with th RTlU haplotype of
the class II loci in these d e n t s (Fuks a al., 1988; Ono et al., 1989). Although the rat
MHC contains three class II loci, expression at the œll surface has been contirnicd for the
RT1.B and RT1.D loci only (Natori et al., 1985; Fujii et al., 1991a). Nucleotide
sequencing of the RT1 .Bp dele (HIA-DQb homologue) in diabetes-susceptible BB rats
detennined that position 57 encodes an Asp 57- amino acid (Figueroa et al., 1985;
Holowachuk et al., 1989; Chao et al., 1989). Similar studies in the IDDM-resistant AC1 rat
(RTla) showed that the RT1.BB chah was Asp 57+ in this strain (Fujii et al., 1991b).
The correlation of position 57 with disease susceptibility has bem confinned in the
NOD mouse mode1 of IDDM as well. The class II MHC repertoire of these mice is unique.
Due to a deletion in the 1-Ea chah gene, they do not express 1-E molecules (Acha-ûrbea a
al., 1991). This leaves them dependent upon the 1-A ciass II MHC ~01ecuies (1-A") for
presentation of antigens to C D ~ + T lymphocytes. Squencing of the I-A~* allele revealed
the B chah to be Asp 57- (Acha-Orbea et al., 1987). Homozygosity of this class II
haplotype appears to be necessary for IDDM development as demonstrated by crosses of
NOD mice with a nomial mouse strain voâà et al., 1987).
Several groups have shown that the transgenic expression of an Asp 57+ chah
(eitha in the form of an Asp 57+ LA chah or a functional 1-E molecule) in NOD mice can
prevent the onset of diabetes (Lund et al., 1990, M i y d et al., 1990, Slattery et al., 1990,
and Singer et al., 1993). However, these same researchm also demoastrated that Asp 57+
21
is not essential for protection against disease. When Asp 57- 1 - ~ k molecules were
expressed in transgenic NOD mice, the animais did no< deveIop IDDM (Miyazalâ et al.,
1990). A compfementaxy approach in proving that Asp 57+ i s not essential to diseasc
resistance consisteù of changing codon 56 of 1-A- h m histidiw to prohe (the ariiino
aciâ found in 1-A~) in transgenic NOD mice. This single substitution conferred dominant
protection against IDDM in Asp 57- chahs (Lund et al., 1990).
While these studies do show ihat Asp 57+ is not sufEcient for IDDM-resistance.
they do not p v e that its presence is not imponant. The coizelation between pndisposition
to IDDM and residue 57 of the chah is tao stmng to be irrelevant. (hie p s i b i l e
explanation for the insuffsciency of position 57 to account for ai l of the MHC-linked
susceptibility or resistance to type 1 diabetes is drat this amino acid is a tnarker for another
closely iinked gene nodd, 1990) presumably also located within the class II loci.
It was hypothesized that this "other gene" c d be found w i h the HIA-DQa
locus. Because the a and chahs are interdependent, it was thought that the a genes could
contribute to discase susceptibility by combining with HLA-Da molecules m generate
unique a,@ he t e m i h m capable of triggering die autoimmune destruction of pancreatic
beta celis (Field, 1988). Indeed, when the a chah deles were tested for linkage
disequiiitnium with IDDM, the results supparted the involvement of HLA-DQa in disease
(Khalil et al., 1990). Specifically , the presence of an arginine at position 52 of the a chab
associateci with susceptibility to IDDM. The greatest nsk of developing type 1 diabetes is,
therefore, obsaved in iadividuals with heterodimers which are Arg 52+ HLA-DQa / Asp
57- HLA-DQp (Khalîl et al., 1992).
22
1.7 Obiectives
Our laboratory has chosen to study IDDM in the BI3 rat. The RTlU class II
haplotype of these animals is associated with the greatest risk of developing IDDM.
Breeding studies have shown that male and female rats of R T P haplotype in
heterozygosity with either RT 1 l or RT 1 readily develop IDDM. However, animals having
one R T P haplotype in combination with an R T P haplotype are rarely diabetic (Fuks et al.,
1990). The sequence data from other species discussed above suggests that this protective
mechanism in the rat could be explained by polyrnorphisms in one or more of the claîs II
alleles, particularly the a and P genes of the RT 1 .B locus. Sequence data for the rat class II
genes have been reported but not studied thoroughly enough to permit the cornparison of a
senes of RT 1 .B and RT 1 .D a and alleles. As a result. assessing the contribution of class
ï I polymorphisms to MHC-encoded IDDM resistance or susceptibility has been difficult.
This study, therefore, determined nucleotide sequences in the relevant regions of a
and p chains at both the RT 1 .B and RT 1 .D loci from five rat sirains of varying disease
susceptibility. We sought to determine whether the relative resistance of heterozygous
RT lu anirnals canying an RT la haplotype - compared with those bearing RT lb or RT 11 -
could be explained by sequence differences of their corresponding class II alleles. It was
hypothesized that the alleles which permit diabetes in heterozygosity with R T P would be
found to have arnino acids other than aspartic acid at position 57 of one or both P chains
while the protective RT la haplotype would have an aspartic acid residue at position 57 of
one or both fi c h a h . Additionally, it was postulated that the increased susceptibility
observed in the RTlu haplotype is due to the presence of an arginine at position 52 of one
or both of the complementary cx chains.
2. Materials and Methods
2.1 Rats
DNA samples from the following 6 rat strains were used in these experiments: AC1
(RTla), BB (RTIU) , Buffalo (RTlb) , DA (RTP) , Lewis ( ~ ~ 1 1 ) , and Wistar-Furth
(RT 1 U) .
2.2 Pre~arationofDNA
High molecular weight DNA was extracted from spleens previously excised from
the rats and stored at -800C. A small piece (approximately 1 cm3) of tissue was placed in 5
ml of phosphate-buffered saline (PBS) and disrupted through a wire sieve using a glass
pestle. 0.5 ml of 5 M NaCl and 0.25 ml of 10% sodium dodecyl sulfate (SDS) were added
to the ce11 suspension and the mixture was incubated on ice for at least 10 min. Nucleic acid
was isolated from contarninating proteins via a series of phenoVchloroform and chloroform
extractions. The DNA, in aqueous phase, was precipitated in 10 ml of ethanol and
resuspended in 1.5 ml of 10 m . Tris-HCI and 0.1 m . EDTA, pH 7.5.
2.3 Polvmerase Chain Reaction
Genomic DNA sarnples prepared from the various rat strains were subjected to
polymerase chah reaction (PCR) amplification using a PTC- 10TM programmable thermal
controller. The reactions were carried out in 50 pl aliquots containing: approxirnately 1p.g
of genomic DNA; 0.5pM of each oligonucleotide primer (see Table 1); 400p.M each of
dATP, dCTP, dGTP, and dTTP; the reaction buffer recommended by the manufacturer
containing 10 rnM KCL, 10 m M (NH4)2SO4, 20 mM Tris-HCI (pH 8.8 at 250C). 2 rnM
MgSOq, and 0.1% Triton X-LOO; and 0.25 Unit of VENT DNA polymerase (New England
Biolabs). After an initial incubation at 94OC for 3 min. 33 cycles of amplification were
24
carried out, each consisting of denaturation for 1 min at 940C, anneaiing at 530C for 1
min, and a 30 sec extension at 720C followed by a final 10 min extension at 720C. The
PCR products were analysed by electrophoresis through a 3% NuSieve GTG agarose low
melting-temperature gel (FMR) in Tris-borateEDTA (TBE) buffer and visuaiized by
ethidium brornide staining. The DNA of desired length was cut out of the gel and extracted
from the agarose. Using the pCR-Script SK(+) cloning kit (Stratagene), each purified,
bluntended fragment was then cloned in preparation for sequencing.
2.4 Seauencing
Dideoxy sequencing was performed using a T7 sequencing kit (Pharmacia) and
3%-labeled dATP (NEN). The products of these reactions were electrophoresed on 8M
urea, polyacrylamide gels. The gels were dried and exposed ovemight. X-ray films were
developed and the target sequence was read from the radioautograph. Sequences were
confirmed by analysis of both DNA stcands from at least two clones.
2.5 PCR Amoli fication of RT 1 .Do cDNA
Total RNA was isolated from a srnail piece of spleen tissue homogenized in a Pro
polytron fitted with a 7 mm X 75 mm generator (Diamed) following the single step method
described by Chomczynski et al. (Chomczynski et ai., 1987) cDNA synthesis was carried
out using approximately 5pg of total RNA incubated at 370C for 1 hour with reverse
transcriptase and random hexarner primers (Gibco) under the recommended reaction
conditions. The products of this reverse transcription were then subjected to PCR
amplification (as previously described) using the appropriate primers €rom Table 1. This
selectively-amplified DNA ffagment was then cloned and sequenced.
25
2.6 Southern Blot Analvsis
IOpg of genomic DNA were digested ovemight with a 2-fold excess (20 units) of
the restriction endonuclease, ScaI (Gibco), in the React 6 buffer specified by the
manufacturer. The following day the digested DNA was ethanol precipitated and
resuspended in 12p1 of TE (pH 7.5). Before loading on a 1 % agarose gel, each sample was
heated at 700C for 10 min. The restriction fragments were separated by electrophoresis at
35 V for 18 hours in a 1X TAE buffer (0.04 M Tris-acetate and 0.001 M EDTA). After
electrophoresis, DNA fragments were transferred to a Hybond-N membrane (Amersham)
by the method of Southem. The membrane was baked at 800C for 20 min and briefly
exposed to UV light to cross-link the DNA. Prehybridization was performed in the
presence of competing, nonspecific salmon sperm DNA at 42OC for at least 4 houn in a
preannealing buffer containing: 50% deionized formamide, 5% SSPE (O. 18M NaCl,
O.OlM Naphosphate pH 7.7. and 0.001M EDTA), 0.5% SDS, 5% Denhardts solution,
and approximately LOO pg/ml of denatured salmon sperm DNA. At the time of
hybndization, this prehybridization buffer was discarded and replaced by a sirnilar solution
containing a 32~-labeled heat-denatured probe. The membrane was incubated with this
probe for 15 hours at 420C. Following hybridization, a series of washes were performed
to remove non-specific hybridization (2 15-min washes in 2 X SSPE and 0.1% SDS at
room temperature; 1 15-min wash in 1 X SSPE and 0.1% SDS at 60°C; and 1 10-min
wash in 0.1% SSPE and 0.1% SDS at 600C) before the membrane was subjected to
radioautography .
2.7 DNA Probe
The Southern blot was probed with a 225 bp fragment derived from a PCR-
amplified RT 1 .DpU clone. 25 ng of the probe was labeled with 50pCi a - [ 3 2 ~ ] dCTP
(NEN) by random hexanucleotide priming (Quick Prime kit, Pharmacia).
26
2.8 Allele-S~ecific Olieonucleotide SJot Blots
Using the PCR conditions previously described and primer pair #2 (see Table 1), a
237 bp fragment within the RT 1 .Bp locus was amplified from genomic DNA of RT la,
RT ln, and RT@ anirnals. Following ethidium brornide fluorescent quantification,
approxirnately lOOpg of each PCR product was blotted ont0 a nylon membrane (Amersham
Life Science) using a vacuum apparatus. This blotting procedure was repeated and the two
duplicate membranes were then baked at 800C and UV cross-linked before
prehybndization for 2 hours at 550C in a buffer containing: 6X SSC10.05% sodium
pyrophosphate (PPi). 0.5% SDS, 5X Denhardts, and LOOpg/ml denatured salmon sperm
DNA. The membranes were probed ovemight with either an RTla-specific (5'-
GTCCGGCCGCCCCAGCTG-3') or UT LU-specific (5'-TGAGGGCCGCCCCAGCTC-
3') y-[32P] dATP-labeled oligonucleotide in a hybridization solution containing: 6X
SSC/O.OS% PPi, LX Denhardts, and 1OOpglml denatured salmon sperm DNA. Non-
specific hybridization was removed by 1 15-minute wash in 6X SSC/O. 1% PPi at room
temperature followed by another wash at 5g°C for 90 minutes. Membranes were then
radioautographed.
Table 1 Nucleotide Seauence of Primers*
Locus Primer Seauence Amino Acid Position
3 . R T L B ~ w i t h
E c o R I site
CAGTATCATGAATCCAAAGGCC
GACAGCTGGGGTTGAATTTG
C(A/T)CCAACGGGACGCAGCGCAT
TCAAGCCGCCGCAGGGAGGTG
AAGAATTCAGA(T/C) ( M G ) C ( A / T ) TCTACAAC (C/A)GGGAG
AAGAATTCCTCGTAGTTGT (G /A) TCTGCA (G/C ) ( M G ) C
TTTGACTTTGACGGCGACGA
CTGGGGTGTTGTTGGAGCG
TCATTTCTACAACGGGACGC
AGGAA (G/T) CTATCA (A/G) A(A/G) ATCTCG
* The fonvard primer is listed first and the reverse primer second, both shown in the 5' to 3' orientation. PCR pnmers were designed from previously published class II RT 1 sequences. The oligonucleotides were generated with an Expedite 8909 DNA synthesizer (Perspective Biosysiems).
3 .O Results
3.1 Determination of the partial nucleotide quence for the 1 st domain of RT 1 .Ba
Sequences determined from the five rat strains are shown in figure 4. While the 2 10
nucleotide-long sequence was identical in anirnals of RTIU haplotype (BB and WF), these
R T P sequences differed from those of the three non-u haplotypes at a number of positions
throughout the first domain. No polymorphism was observed at residue 52 among the five
rat strains; each has a codon for phenylalanine. The predicted arnino acid sequences are
depicted in figure 5 for comparison with their murine (Acha-Orbea et ai., 199 1) and human
(Hom et ai., 1988; Todd et al., 1987) homologs.
3 -2 Determination of the partial nucleotide seauence for the 1 st domain of RT 1 .BP
Alrnost al1 of the 1st domain of RTl.BB was sequenced. BB and WF anirnals
sharing the class iI RT 1 haplotype also shared an identical 237 nucleotide-long RT 1 .BP
sequence (figure 6). In contrast, a high degree of polymorphism exists among the different
haplotypes. Substitutions at codon 57 were of particular interest. RT luvl, and haplotypes
encode serine at this position. Initial difficulties in PCR amplification of RTP genornic
DNA were overcome using a second set of primers interna1 to the original pair. These
nested oligonucletides amplified a sequence which differed drasticaily from the other
haplotypes and had an isoleucine at position 57. To confirm this RTP sequence, the same
pnmers were used to ampli& this region from genomic DNA of the related DA strain and a
rat (C 1232) from our own animal colony whose MHC had previously been typed as R T P
by an independent method. Four such clones were examined and found to be identical in
sequence to the original, five AC1 clones with Ile 57+.
Figure 4: Nucleotide Sequences from the 1st Domain of RT1.Ba in Five
Rat Strains. The predicted amino acid sequence is shown with nurnbers marking their
positions in the mature protein. Dots represent sequence homology and underlined
nucleotides indicate the regions cornplementary to the primers used for sequencing. The
Sprague Dawley nucleotide sequence (Barran et al.. 1987) is also shown for cornparison.
u BE u W F b B u f 1 L e w a AC1
G l n Tyr His G l u S e r L y s G l y G l n Tyr T h r His G l u Phe CAG TAT CAT GAA TCC N4A GGC CAG TAC ACA CAT GAA TTT
. . . . . . TT. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TT. . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . TT.
d SD(Barran et al) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
40 A s p G l y A s p G l u Arg P h e T y r V a l A s p L e u A s p L y s L y s G l u T h r Ile T r p Arg GAT GGT GAC GAG AGA TTC TAT GTG GAC TTG GAT AAG AAG GAG ACC ATC TGG AGG
50 60 I l e P r o G l u Ph0 G l y G i n L e u T h r Ser Phe A s p P r o G l n G l y A l a L e u G l n Ser ATC CCC GAG TTT GGA CAA CTG ACA AGC TTT GAC CCC CAA GGT GCA CTT CAA AGT
70 80 I le A l a T h r Ile L y s Tyr A s n L e u G l u I le L e u T h r L y s Arg Ser A s n Ser T h r ATA GCT ACA ATA AAA TAC AAT TTG GAA ATC CTG ACG AAG AGG TCA AAT TCA ACC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .T. . . . . . . C . . . . . . . . . . . . . . . . . . T . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . C-. . . . . . . . . . . . . . . . .T. . . . . . . . . . . . . . . . . . . . . . . . . .T. . . . . . . C , . . . . . . . . . . . . . . . . .T. . . . . . . . . . . . . . . . . . .
Pro A l a V a l CCA GCT GTC
Figure 5: Cornparison of the 1st domain amino acid sequences for RT1.Ba
alleles and their human (Todd et al., 1987; Horn et al., 1988) and mouse
(Acha-Orbea et al., 1991) homologs. The single-letter amino acid code is used.
Exon 1 of HLA-DQa encodes four arnino acids of the 1st domain (compared with five
residues in RT1.Ba and 1-Aa) so human sequences were shifted one amino acid for
purposes of alignment
20 30 40 u Q Y H E S K G Q Y T H E F D G D E R F Y V D L D K K E T b t l , a . . . . . . . . . . F . . . . . . I . S . . . . . . . N d . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1-AtX NOD S P G D I . . . . . . . . . . . L . . . . . . . . K .
. . . . . . . . . . . . . . 1-ACX NON S P G D I : , . . . F . L . HLA-DQa DR4 . S Y G P S . . . S . . . . . . . E . . . . . E R . . . HLA-DQa DR2 . F Y G P S . . . . . . . . . . . Q . . . . . E R . . .
50 I W R I P E F G Q L T S F D
80 R S N S T P A V
60 70 P Q G A L Q S I A T I K Y N L E I L T K . . . . . . N . . I . . H . . . . . M .
R N . . I H . . . . . M . . . . . . . . G . . N . . A E . H . . G . . * . . . . G . . E . , . G . . * * . . . I . . . .
. . F * . T N . . V L . H . . N . V I . R N M . V A . H . . N . M I . . . . . .
33
However, two observations prompted us to resequence this RTl.BP domain from
splenic cDNA using the original extemal primer set: 1) our RTP sequence disagreed with
that previously reported by Fujii et al (Fujii et al, 1991b) and 2) the existence of a
nucleotide substitution at the 3' end of the 2nd intemal primer. A total of eight clones were
exarnined (five using the external primers and three using the internai set). Al1 eight shared
an identical sequence which was completely different from the original RTla genomic
clones but matched the published RT la sequence of Fujii et al encoding aspartic acid at
residue 57. This Asp 57+ sequence was confirmed from two cDNA clones using the sarne
RT 1" haplotype animais listed above. RT lu cDNA was also isolated and sequenced at this
region to ensure that the nucleotide sequence of RTlU cDNA and genomic clones did not
differ. Figure 7 shows an allele-specific oligonucleotide dot blot which both confirms the
sequence data and provides a rapid rnethod for identifjing the MHC class II haplotype of
animals in our ongoing breeding studies.
As can be seen in figure 8, many differences exist between the predicted amino acid
sequences of these five rat strains. Interestingly, our iie 57+ genomic R T P sequence has
an overall resemblance to that of the Sprague-Dawley rat reported by Fujii et al (Fujii et al.,
199 lb). Homologous munne (Todd et al, 1988; Acha-Orbea et al., 1987) and human
(Todd et al., 1988) protein sequences are also given from iDDM-resistant and -susceptible
haplotypes for comparison.
3.3 Detemination of the partial nucleotide sequence for the 1 st domain of RT 1 .Da
The arnino terminal domain of the RT 1 .Da chah was identicai in the five rat strains
we examined (figure 9). Alanine was present at residue 52 in al1 alleles. Once again, mouse
and human RT1.Da homologs (Holowachuk et ai., 1987) are given for compatison (figure
10).
Figure 6: Nucleotide sequences from the 1st domain of RT1.BB in five rat
strains. Asterisks at codons 65 and 67 indicate deletions. Underlined regions represent
the original set of primers while the second, interna1 primer pair is shown in italics. Primer
degeneracy is not depicted.
haglotype/strain
20 T h r A s n G l y Thr G i n Arg I l e Arg A s n
u BB C ACC AAC GGG ACG CAG CGC ATA CGG AAT u W F . . . . . . . . . . . . . . . . . . . . . . . . . . . . b B u f . . . . . . . . . . . . . . . . . . . .G ... CTC 1 Lew . . . . . . . . . . . . . . . . . . . . . . . . . G , . a AC1 genomic DNA a AC1 cDNA . . . . . . . . . . . . . . . . . . . . . . . . . GG.
3 0 Val Ile Arg Tyr GTG ATC AGA TAC . . . . . . . . . . . .
. C . C . . -.. ...
40 Ile Tyr A s n Arg Glu Glu Tyr Leu Arg Tyr A s p Ser A s p V a l G l y G l u Ty r Arg ATC TAC AAC CGG GAG GAG TAC CTG CGC TAC GAC AGC GAC GTG GGC GAG TAC CGC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . .T. C . . . . . . . . . . . .A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T.. . . . . . . . . . . . . . . . . T . GC. ... .T. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
50 A l a Val GCG GTG
S . . S . .
... C..
. . . C..
. . . . . .
. . . C . .
60 Thr G l u Leu G l y Arg Pro Ser A l a Glu T y r ACC GAG CTG GGG CGG CCC TCA GCC GAG TAC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
AG. AT. ..G . . . . . . . . . . . . . . . . . . . . . ... C . . . . . . . . . . . ..G CIAC . . . . . . . . .
7 0 L e u Glu Arg T h r Arg A l a G l u Leu A s p T h r
* * * CTG GAG CGG ACG CGG GCC GAG CTG GAC ACG * * * . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . * * * . . . S . . .A. . . . . . . . . . . . . . . . . . . .G. * * * . . . . . . . A . . . . . . . . . . . . . . . . . . . . . .
. . . . . . TTC A . . ... .A, G . . . . . . . . .C. G..
. . . . . . . . . . . . . . . * * * . . . . . . .A , C . . G . .
P h e A s n Lys G l n Tyr TTT AAC AAG CAG * * * TAC . . . . . . . . . . . . * * * . 2 .
. . . . . . . . . GG T * * * . . * * * * . . . . . . . . . . . . ...
. . G ... . . A . . . AAG G.G . . . . . . . . A . .A *** . . -
90 L y s Thr G l u Val P r o T h r Ser Leu Arg Arg Leu AAG ACA GAG GTC CCC ACC TCC CTG CGG CGG CTT GA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . GG. C . G . C . CGT . T . GG. T . G . . . . . . .G. . . . . . . . . . . . . . . . . . . . .
80 V a l C y s Arg H i s A s n Tyr G l u GTC TGC AGA CAC AAC TAC GAG
. . . . . . . . . T . . . . . m . . . . .
A . . . . . . . . . . . . . . . . . . . .
G . . . . G . . . . . - . . . - . - . . . - S . . . . . . . . . . . .
Figure 7: Allele-Specific Oligonucleotide (ASO) Slot Blots. An example of
slot blot hybridization between RT P- or RT 1"-specific oligonucleotides and PCR-
amplified genomic DNA from AC1 (slot A), BB (slot B), and FI (slots C and D) anirnals.
Membranes 1 and 2 were hybridized with RT la- and RT I U-specific probes, respectively.
Figure 8: Cornparison of the 1st domain amino acid sequences for RTl.BP
alleles (Sprague Dawley sequence from Fujii et al., 1991b) and their human
(Todd et al., 1988) and mouse (Acha-Orbea et al., 1987; Todd et al., 1988)
homologs.
hapla type
u b 1 b (SD) a genomic a cDNA 1-AP NOD 1-AB NON HLA-DQB DR4 HLA-DQP DR2
20 30 40 T N G T Q R I R N V I R Y I Y N R E E Y L R Y D S D V . . . . . . M . L . T . H . - . . . . . V . F . . . L
. . . . . . . . . . . . . . . . D . . . . Q . . * . . . . . . . . . . . . . . . S . D . R F - . Q . . F . .
C F F A . F e - . . . . . . . . . . . . . . . . . . . . . G . . . . . . . . . . . V .
L . T . F . . . . S . . . . . . . . - . S . . . . . .
. . . . . . . S . T . N . . . . . . . . . . . . - E . V . L . T . - . . . . . . . A . F . . . . . . . . E . V . L . T - . . . . . . . . A . F . . . .
50 60 70 G E Y R A V T E L G R P S A E Y F N K Q * Y f L Q R T R A E L D T V C . . . . . L . . . . . . . . . . W . . . - . . . . Q . . . . . . R . .
. . . . . . . . . . S . . . . L . . . . . . . , . Q . . . . . . . . . . . F . . L . . . . . S W . D D W . S . K E 1 . E Q K . . . M . . . . . . . . . . . . . . . S I . . . L . . . K E F M . Q A . . A V . . I . . . . . L . Q . . . . b . . . Y . . . . . . . . Q . - . Q V . . . . . . . . . . . . . . . H . . . . Y . . . . . . . E . . - . - . . . A .
S D . . E Q . . . A . . . . . . . . . . . . . . . . . . . - . * . . . . . . . . . . . . V . . . . . P . . P . A . . . W . S . K E V . E
. . V . . . P Q . . . D . . . W . S . K E V . E G . . . . . . . . .
80 90 R H N Y E K T E V P T S L R R L
. . . . . . Y . . , G P A R L
. . . . . . . . . . . G S . . R
. . . . . . Y . . . E * . . .
. . . . . E . . . . . . . . * . . . . E . . . . . . . . . .
. . . , Q L E L R T . L Q . .
. . . . . V A F R G I L Q . .
Figure 9: Nucleotide sequences from the 1st domain of RT1.Da in five rat
strains. The nucleotide sequence previously reported for the RTLU haplotype
(Holowachuk et al.. 1987) is shown for cornparison.
u BB U W F
b B u f 1 Lew a AC1
u ( H o l o w a c h u k )
30 P h e Asp P h e A s p Gly Asp Glu Ile P h e His Val A s p Ile TTT GAC TTT GAC GGC GAC GAG ATT TTC CAT GTA GAT ATT
40 50 L y s L y s Ser Glu T h r I l e T r p Arg Leu Glu G l u Phe Ala Gln P h e Ala Ser P h e AAA AAG TCA GAG ACC ATC TGG AGA CTT GAA GAA TTT GCA CAG TTT W C AGC TTT
. . . . . . . . . . . . . . . ..T . . . . . . . . . . . . . . . . . . . . . A.. . . . . o . . . . . . .
60 70 Glu Ala G l n G l y Ala Leu A l a A s n I le A l a Val Asp Lys Ala Asn Leu Asp Ile GAG GCT CAG GGT GCA TTG GCT AAT ATA GCT GTG GAC AAA GCT AAC CTG GAC ATC
80 Met 11e Lys Arg S e r A s n A s n Thr P r o ATG ATA AAG CGC TCC AAC AAC ACC CCA G
Figure 10: Comparison of the 1st domain amino acid sequences for
RT1.Da alleles and their human and mouse homologs (Holowachuk et al.,
1987)
30 40 U, b, 1, a F D F D G D E I F H V D I K K S E T I W R L E E F A u ( Holowachuk) . . . . . . . . . . . . . . . . . . . . . . . . . . I -EC@ . . . . . . . . . . . . . E . . . . . . . . . . . .
. . . . . . . . . . . . . . HLA-DRff M A . K V . . . . . . G
50 60 7 O 80 Q F A S F E A Q G A L A N I A V D K A N L D I M I K R S N N T P L . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . K . . . . . . . . . . . . . . . . . . . . . V . K E . . . . . . R . . . . . . . . . . . . . . . . . . . . E . , T . . . . Y . .
44
3.4 Determination of the ~artial nucleotide seauence for the 1 st domain of RT 1 .D@
RT 1 .DB chain nucleotide sequences were identical for the BB and Wistar-Furth rat
strains (RTP haplotype). The difTerent haplotypes that we examined exhibited a high
degree of allelic polymorphisrn thoughout the 1st domain (figure 1 1). Except for the RT lb
haplotype which is Asp 57+, all alleles code for serine at this position. RTLa genomic DNA
yielded two P chah sequences that differed by only one nucleotide. Of the ten RT La clones
sequenced, four encoded arginine at position 48 whiie the rernaining six clones had a C to
T substitution at the first nucleotide of codon 48 that would predict an arginine to cysteine
substitution in the amino acid sequence. Two clones sequenced from a second AC1 animal
showed the same heterogeneity: one king Cys 48+ and the other, Arg 48+. A further four
clones were sequenced from the related DA strain. They too were split 5050
(Arg48+:Cys48+). These ambiguous results prompted us to obtain sequences from RTla
cDNA. Nine such clones were sequenced from AC1 splenic cDNA dong with three RT lu
cDNA clones from a BB animal. Al1 twelve clones encoded arginine at residue 48.
Because the C to T substitution observed at codon 48 creates a novel ScaI site in
RT l a genomic DNA, the sequencing results were confirmed by a Southern Blot of
genomic RTP and RTP DNA digested with this restriction endonuclease and probed with
a 32~-labeled RT 1 .DPU clone. This blot shows a different restriction pattern for the two rat
strains (figure 12). Figure 13 compares the predicted amino acid sequences of the five rat
strains presented in this paper and mouse ( Acha-Orbea et al., 199 1) and human (Hom et
al., 1988; Todd et al, 1987) RT 1 .DP homologs.
Figure 11: Nucleotide sequences €rom the 1 s t domain of RT1.DP in €ive rat
strains. Primer degeneracy is not shown.
u BB u W F b B u f 1 Lew a AC1
20 H i s P h e T y r A s n G l y T h r G l n Arg V a l Arg L e u L e u A l a
T CAT TTC TAC AAC GGG ACG CAG CGC GTG CGG CTT CTG GCC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A ... A , . TA. ... ,A. . . . . . . . . . . . . . . . . . . . . . . . . A . . C ... T . . . . . . . .
30 40 Arg L e u I le Tyr A s n A r g G l u G l u Tyr A l a Arg P h e A s p Ser A s p V a l G l y G l u AGA TTA ATC TAC AAC AGG GAG GAG TAC GCG CGC TTC GAC AGC GAC GTG GGC GAG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .AC T . . . . . . . . C . . . . . . . . . . . . . . . . . . A . . . . . . . . . . . . . . . . . T . ... .AC . . . . . . . . . C . . . . . . . . . . . A . . . . . . . . . . . . . . . . . . . . . . . . . .
50 60 Tyr A r g A l a V a l T h r G l u L e u G l y Arg P r o Ser A l a G l u T y r Arg A s n L y s G l n TAC CGC GCG GTG ACC GAG CTG GGG CGG CCC TCA GCC GAG TAC AGG AAC AAA CAG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G DM: T . . .GC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . T . TAT . . . . . . . . .
70 80 L y s G l u Phe Met G l u Arg Arg Arg A l a A l a V a l A s p Thr Tyr C y s Arg H i s A s n AAG GAG TTC ATG GAG CGG AGG CGG GCC GCG GTG GAC ACG TAC TGC AGA CAC AAC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . . C.. . . . . . . .A . . . . . . . .A. T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A. . . . . . . .A. TT . . . . . . . A , . . . . . . . . . . GC. ... . A . . . . G . .
90 Tyr Glu I le Ser A s p Ser Phe TAC GAG ATT TCT GAT AGC TTC CT
In R T l a g e n o m i c DNA roughly half of t he sixteen clones sequenced were observed t o have a C a t t h i s pos i t ion while the other half had undergone a C t o T m u t a t i o n . Nine RTla cDNA clones wexe then sequenced and al1 had a C at t h e 1st pos i t ion of codon 48 .
Figure 12: Southern blot analysis of ScaI-digested DNA from AC1 and BB
rat strains. Arrows indicate the sizes in kilobases of the restriction fragments. We
propose that the 7.7 kb fragment seen in the BB rat represents a pseudogene. This
pseudogene is also present in the AC1 rat but is cut into two fragments (5.1 kb and 1.4 kb)
due to a novel ScaI site created by the C to T mutation at codon 48 which was observed in
the genomic sequence. The 900 bp fragment seen in both rat strains is the expressed
RTl.DB gene.
Figure 13: Cornparison of the 1st domain amino acid sequence for RT1.DB
alleles and their human (Todd et al., 1987; Horn et al., 1988) and mouse
(Acha-Orbea et al., 1991) homologs.
U
b 1 a NON 1-EP NOD 1-EP HLA-DR2 ~ w 2 pl HLA-DR~BI
20 H F Y N G T Q R V R L L A R . . . . . . . . . . Y - D . . . S . . . . . . . F . . . . . . . . . . . . . . . . . . . . . . . . . . . F . E . . . . . . . . . . . F . K . . . F . . . E . . . F . H . F . . E . . . F . D .
30 L I Y N R E E Y A R Y F . . . . . . . . Y . . . . . . . T .
40 50 60 F D S D V G E Y R A V T E L G R P S A E Y R N K Q K E F M E Y . . . . . V . . . . . . . . . . D . . . W . S . . . I L .
. . . . . . . . . . . . . . . . . F . , . Y . . . . . Y . . . . . . . . . . * . . . . . . . . . . . . . . . . . . . . .
0 . . . W . S . P . I L . . . . . . . . . . . . . . . . . . . . . . . . . F . . . . . . . . . D . . N W - S . P . I L .
D . . . W . S . . D . L . . . . . . . . . . . . . . . . . . D . . . W . S . . D I L . . . . . . . . . . . . . . . . . .
80 V D T Y C R H N Y E I S D S F L . . . . . . . . . . . . . . * . . A . K . D . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F . N . . . . . . . . . . . . F . N . . . . . . . . . . G V G E . .
G V V E . . . . . . . . . . .
R A A . . E . . T
*1n genomic R T ~ ~ clones this position was heterozygous for cysteine and arginine but when sequenced frorn cDNA it was repeatedly found to encode an arginine
4.0 Discussion
More than a decade after the association of IDDM with the MHC, research aimed at
identibing the diabetes susceptibility gene(s) within this region continues. Sequencing of
human and murine class II MHC alleles from haplotypes positively- and negatively-
associated with IDDM identified oniy one polymorphism in the P chain which consistently
correlates with disease: position 57 in non-diabetogenic d e l e s encodes aspartic acid while
diabetogenic P chains have a codon for a non-aspartic acid, non-charged residue (Acha-
Orbea et al., 1987; Todd et al., 1987). These observations provided a molecular basis for
IDDM susceptibility that, in humans, was extended to encompass the a chah of class LI
antigens. Individuals at the greatest nsk of developing IDDM were found to be those whose
class II heterodimers are Arg 52+ dAsp 57- (Khalil et al., 1992).
Studies in the rat have revealed that sirnilar sequence polymorphisms at position 57
of the RTl.BP chah also seem to mediate susceptibility or resistance to IDDM (Fujii et al.,
1991b). However, because class II MHC sequence data are not as abundant for the rat as
for either the human or mouse, assessing the contribution of other class II RTI
polymorphisms to IDDM susceptibility has been diffïcult. This project expanded upon the
previously published rat class II sequences by generating a complete series of allelic
sequences for this animal mode1 of IDDM. To do so, we determined nucleotide sequences
for the relevant regions of a and chains from both RT 1 .B and RT I .D loci in five
diabetes-susceptible or -resistant nt strains. These aileles were then compared with each
other - and with the hornologous human and rnurine sequences - to identify disease-
associated polymorphisms unique to the rat or cornmon to al1 three species. It was hoped
that this would identib specific class II substitutions or sequences which could account for
the different relative resistances of the haplotypes examined.
52
Sequences of the RT1 .Ba chah have not ken previously reported for any of the rat
strains which we examined. Our results showed that BB and Wistar-Furth strains (of the
R T P haplotype) share an identical a chah sequence. When this sequence was cornpared
with those sequences which we determined for the other alleles and with the aiready-
published Sprague-Dawley sequence (Barran et al., 1987) a low degree of diversity was
observed (Figure 4). No correlation was found to exist between residue 52 of the a chah
and predisposition to disease. Interspecies sequence cornparisons at this locus displayed a
higher degree of divenity but did not reveal any a chah sequences which could be
specificaliy associated with IDDM (Figure 5).
At the other class II locus, RT 1 .D, al1 of the haplotypes which we examined shared
an identical a chah sequence (Figure 9). The RTIU allele had previously been published
for this locus (Holowachuk et al., 1987) and it differed from our a chain sequence at two
nucleotides that predict one substitution in the amino acid sequence. These discrepancies
could represent veritable differences between the nucleotide sequences of the two RT lu rat
strains from our respective laboratories (presumably not of the same immediate origin) or,
alternatively, could be artifacts of sequencing. The absence of polymorphism among the
RT1.Da alleles which we examined supports the sequence data for human and murine
RT1.Da homologues (Figure 10) which are known to be the most invariant of the class II
molecules, demonstrating little or no polymorphism (Field, 1988; Holowachuk et al.,
1987). The lack of polyrnorphism between rat strains pre-empted any correlation between
residue 52 of these a chahs and predisposition to disease.
Nucleotide sequences have already been determined for the RTL .BP haplotypes
which we examined, though the sequences published by different groups for a given
haplotype do not always agree. Consequently, while the sequences reported herein are
identical to some of those previously published (Fujii et al., 199 la; Chao et ai., 1989) they
disagree with others (Holowachuk et al., 1989; Figueroa et al., 1988). Once again, our two
53
RT 1 alleles had an identical sequence despite the fact that, overall, the RTl .BP chah
alleles which we (and othea) sequenced were extrernely polymorphic (Figure 6). This high
degree of diversity suggests that generation and maintenance of polymorphism are
functionally important to this region of the class II rnolecule. It follows that the sequence
discrepancies for a given haplotype as reported by different groups are likely real, resulting
from generations of breeding in separate faciiities.
Our results confirmed the association of Asp 57+ with disease resistance first
reported in the rat by Fujii et al.: the RTl.BB sequences of AC1 rats and two other diabetes-
resistant RT? strains wkch we examined were Asp 57+, compared with the IDDM-
susceptible, Asp 57- haplotypes. A practical application of this difference c m be seen in
Figure 7. Based upon the sequence data, two oligonucleotides that span position 57 and
that are specific for either the RT la or RT 1 LI haplotype were synthesized (see Materials &
Methods section for the oligonucleotide sequences). These aliele-specific oligonucleotides
(ASO) can be used to probe slot blots of PCR-arnplified genomic DNA from rats generated
in our breeding studies. This technique provides an accurate, more efficient alternative to
Southen Blots for the class II typing of rat progeny in our animal colony.
We also report a new RTL .BP sequence which could only be detected in genomic
RT 1 a DNA. This novel sequence differed markedly from both the RT 1 a cDNA sequence
and the other alleles examined in this study, dthough it did resemble the R T L ~ haplotype
(Fujii et ai., 1991b) in its absence of deletions at positions 65 and 67 and its increased
polymorphism between residues 55-70 (Figure 8). We are not the first to report evidence of
multiple chah genes at the RT1.B locus. Southem blot analysis of Wistar-Furth genomic
DNA with an HLA-DQB cDNA probe has suggested the presence of several RTL .BP genes
(Scholler et al., 1985). When these same researchers screened a genomic R T P rat library
with the HLA-DQP chah cDNA probe, a positive clone encoding the complete 2nd domain
of the RTl .BP chah was isolated. This sequence showed a far higher homology (93%)
54
with the mouse 1-AP2 gene than with any other 2nd dornain sequence and, therefore, was
dubbed RTI .BB2.
Genomic rat libraries have also been screened with probes from the 1-Aa, 1-AP, I-
AP2, I-Ea, and LEP genes of mice (Diamond et al., 1989). This work identified a number
of positive clones which - by differential hybridization with each of the probes, and by
restriction digest mapping - could by divided into two clusten (corresponding to the RT 1 .B
and RTL .D loci) each containing three class II sequences: two and one a. At the time of
this discovery, the genornic organization of the RT 1 .B and RT 1 .D loci had already k e n
determined by RFLP analysis of intra-RTI recombinant rats (Blankenhom et al., 1985) but
the gene order which this work established did not account for the existence of multiple fl
genes at either class U locus. It therefore becarne necessary to determine the organization of
these a and B genes. The gene order was axertained from experiments in which rnouse
cells were transfected with different combinations of the RT 1 .B and RT 1 .D a and p genes
and then analyzed for class II expression. The transfectants showed that for the RT 1.B
region, the expressed P gene (RT 1 .BP 1) is adjacent to the a gene whereas for the RT 1 .D
locus, the expressed gene is separated from the a gene by RTl.DB2 (Diamond et al.,
1989). Subsequent experiments examined the genomic organization of the RT 1.H locus
(Fujii et al, 1991b). The map which results from these studies -showing al1 of the class II
loci and genes identified to date - can be seen in Figure 14.
The RT l.Bp2 gene has no known protein product and is thought to be a
pseudogene (Scholler et al., 1985; Diamond et al., 1989). The novel sequence which we
observed in genomic RTP DNA is not homologous to the reported sequence for RTl .BP2
and, therefore, may represent another pseudogene of this locus. Alternatively, it may be the
sequence of a p gene from the upstrearn, non-transcribed RT 1 .H locus. This would only be
possible if there was a high enough degree of homology between the RTl .B and RT 1 .H
Figure 14: The a and P gene order within the class II loci of the rat MHC.
a a
centromere telomere
57
loci to allow the RTl .B P-specific primen to anned to the RT1.H region during PCR
amplification.
Regardiess of its origin and the fact that it is non-transcribed, the pseudogene which
we detected in the RT1.B locus could stiil be an important component of the rat MHC. The
observed preservation of pseudogene nucleotide sequences throughout evolution is thought
to reflect this importance (i.e. - 93% homology between the seqeunces of RTL.BB2 and I-
AP2 (Scholler et d., 1985)). Gene conversion refers to the intra-locus (or inter-loci)
recombination of a short segment of DNA between two alleles and is one of the proposed
rnechanisms in which pseudogenes operate to enhance polymorphism at MHC loci (Erlich
et al., 199 la; Erlich et al., 199 lb; Marx, 1982; Gyllensten et al., 1990). Pseudogenes
permit the MHC to maintain allelic diversity through the conservation of multiple copies of
similar genes. Sequence exchanges between these "dormant" genes and expressed alleles
generate new MHC molecules. Evidence of such sequence exchanges can be seen in
cornparisons of the allelic RTl sequences with their homologues in closely- and distantly-
related species. The observed "patchwork pattern" of polymorphism (Le. - figures 6 and
13), with sequence conservation in certain regions and a high incidence of polymorphism in
others, is characteristic of gene conversion . The final region of the rat MHC which we examined was the RTLDP chain.
Sequences of the RTlU haplotype (BB and Wistar-Furth rats) were identical here, as they
were at every other locus. In contrast to this shared RT l u sequence, a high degree of
polymorphisrn was observed among the RT 1 .Dp chain aileles of different haplotypes
(Figure 1 1). Our RT 1 .DU and RT 1 .DI P chah sequences were not identical to those RT LU
(Chao et al., 1989; Holowachuk et al., 1989; Robertson et al., 1985) and ~ ~ 1 1 (Chao et
al., 1989; Holowachuk et al., 1989) haplotypes previously reported by others and, once
again, these discrepancies probably represent real differences resulting from generations of
breeding in separate colonies.
58
It does not appear that residue 57 in the RTl.DP chah associates with IDDM
resistance since both diabetes-susceptibile and -resistant strains code for serine at this
position. However, it is possible that the presence of Asp 57+ in RT 1 .Db molecules affects
the severity of spontaneous organ-specific autoimrnune diseases in other rat strains. The
only allele which coded for aspartic acid at position 57 of RT I .DP belonged to the RTL
haplotype, and it is known that these inbred Buffalo rats are prone to developing
spontaneous thyroiditis (Colle et al., 1985). In contrast to the protective efTect observed at
RTI .BP, an Asp 57+ P chain at the RTL .D locus could conceivably confer susceptibility to
thyroiditis by preferentially binding a select set of peptides which, when presented to T
lymphocytes, induce an autoimmune response against this organ.
Thus, the sequence data suggest that for both class II loci. residue 57 of the chah
is important to the structure and function of the MHC molecule. Modeling studies have
helped to explain how this single difference in the arnino acid sequence of an MHC
molecule could result in predisposition to an autoimrnune disease. As previously discussed,
the three-dimensional mode1 of a class II molecule places residue 57 on the imer-face of the
antigen binding cleft where it is capable of directly interacting with the bound peptide.
Additionaly, it is believed that amino acid substitutions at ihis position can aCfect a/p chah
pairing. A negatively-charged residue (such as aspartic acid) at position 57 of the HLA-
DQP chain is close enough to the a chain residue, Arg 79, to f o m a salt bridge. Non-
conservative substitutions at position 57 of the P chain disrupt this bond. change the class
II structure, and affect its affiinity for binding certain peptides (Todd, 1990). These models
convincingly demonstrate that substitutions within the antigen binding cleft can alter the
MHC structure with pleiotropic effects (i.e. - positive and negative selection in the thymus.
antigen presentation to mature T cells, etc) capable of inducing autoimmunity.
59
Though substitutions at position 57 of either P chah locus may affect the host's
immune response by altering the conformation of the antigen binding cleft, there are amino
acid changes within class II molecules which do not necessarily have functional
consequences. We observed a non-conservative arginine to cysteine change at amino acid
48 in genornic DNA sequences from RT 1 .DU and RT 1 .Da chains, respectively (Figure
I l ) . The underlying cytosine-to-thymine substitution was not observed in any of the nine
RT la cDNA clones which we subsequently sequenced implying that the novel sequence
represented a pseudogene, but the sirnilarity of this pseudogene to the expressed gene led
us to doubt its validity. Fortunately, the single difference in the nucleotide sequence created
a novel ScaI site in the RTla ailele allowing us to confirm the presence of this pseudogene
by Southern blot analysis (Figure 12).
A search of the literature revealed that the same substitution at position 48 has been
studied in T ce11 hybridomas serologically selected for class II 1-AP mutations (Brown et
al., 1990). These experiments determined that the functional properties of such a class II
molecule would be unaffected. In the rat, because it is a pseudogene this Cys 48+ allele
cannot enhance MHC diversity through expression at the ce11 surface. However, this non-
expressed allele may be a duplicate of the expressed RT 1 a P chain allele and gene
duplication is another mechanism of molecuIar evolution which contribu tes to MHC
diversity (Ohta, 1991). Duplicated genes gradually diverge frorn their template to acquire
different functions and, whether they are expressed or exist as pseudogenes, these new
alleles can enhance sequence diversity by the mechanisrns previously discussed.
While this project focused on the role of the MHC in genetic predisposition to
IDDM in the BB rat, it must be remembered that type 1 diabetes is a multigenic,
multifactorial disease. The genetic contribution of the MHC is necessary but not sufficient
for disease development. Therefore, though the polymorphisms in the chah of class II
60
molecules which we identified rnay be important to IDDM susceptibility, they cannot
explain al1 of the genetic predisposition to this disease. In the BB rat, it is known that at
least three loci are necessary for the occurrence of DDM (Fuks et al., 1995) and the most
recent estimate in the NOD mouse is that fifteen other loci contribute to genetic
predisposition (Tisch et al., 1996). Current and future work in IDDM involves identifying:
the other loci which contribute to disease susceptibility (Vyse et al., 1996; Tisch et al.,
1996), the environmental factor(s) capable of triggenng or modulating disease (Bach,
1994), the autoantigen targeted by the autoimmune response (Aguilar-Diosdado et al.,
1994), and the effector mechanisms employed by the immune system to destroy the
pancreatic beta cells (Katz et al., 1995). It is hoped that a better understanding in one or
more of these areas will lead to an effective immunotherapy or irnrnunoprevention for
insulin-dependent diabetes mellitus.
5 -0 Conclusion
Our sequence anaiysis of the rat class II molecules from five rat strains of varying
susceptibility to IDDM: 1) confirmed at the DNA level the results of numerous other
biochemical techniques (Colle, 1990) which have shown the class II gene products of the
RTlU BB rat to be indistinghuishable from those of the parental RT lu haplotype in the
Wistar-Furth strain and 2) identified coding differences between the different haplotypes in
both the a and P chain sequences. We could not identiQ any a chah sequence features
uniquely associated with diabetogenic alleles. While it is possible that the a chain
contributes to disease susceptibility via sequence differences outside of the first domain
(other exons or regulatory DNA regions) it would appear from Our data that the
polymorphic P chains are more important in MHC-linked IDDM susceptibility. We
confirmed the association of Asp 57+ at RTl.BP with resistance to diabetes. Position 57 of
RT1.DB did not seem to aîsociate with IDDM but rnay affect predisposition to other organ-
specific autoirnmune diseases, such as thyroiditis. The sequence data reported here can also
be applied to ailele-specific oligonucIeotide slot blots as an efficient means of typing rat
progeny in our animal colony.
Our results aiso revealed a number of findings relevant to the mechanisms of class ii
diversity. We detected multiple P chain sequences at both the RT 1 .B and RT 1 .D loci that
were restricted to genomic DNA and could represent alleles of the RT 1 .H locus, or RT I .B
and RT1.D pseudogenes. Though not transcribed, such "dormant" genes are capable of
promoting MHC diversity via sequence exchanges with expressed alleles; a concept
supported by comparisons of the allelic RTL sequences with their homologues in closely-
and distantly-related species. This gene conversion, together with natural selection, results
in the MHC variability that is necessary for effective antigen recognition. Paradoxically,
these sarne mechanisms of diversity also generate a l p chah combinations which lead to the
autoirnmune destruction of pancreatic beta cetls.
Abbas AK, Lichtman AH, Pober JS: Cellular and Molecular Imrnunolow. Montréal: WB
Saunders Company, 199 1.
Acha-Orbea H, McDevitt HO: The first external domain of the nonobese diabetic mouse
class II 1-AB chah is unique. Proc. Natl. Acad. Sci. USA. 84: 2435-2439, 1987.
Acha-Orbea H, Scarpeiiino L: Nonobese diabetic and nonobese nondiabetic mice have
unique MHC class II haplotypes. Immunogenetics 34: 57-59, 199 1.
Aguilo-Diosdado M, Parkinson D, Corbett JA, Kwon G, Marshall CA, Gingerich RL,
Santiago JV, McDaniel ML: Potential autoantigens in IDDM. Diabetes 43: 4 18-425,
1994.
Bach JF: Mechanisms of autoirnmunity in IDDM. Clin. Exp. Immunol. 72: 1-8, 1988.
Bach JF: Insulin-dependent diabetes mellitus as an autoimmune disease. Endocrine
Reviews 15(4): 5 16-542, 1994.
Barran PA. McMaster WR: DNA sequence analysis of the rat RT 1 .B a gene.
lmrnunogenetics 26: 56-62, 1987.
Bennett JC, PIum F: Cecil Textbook of Medicine. 20th edition. Montreal: WB Saunders
Company, 1996.
Bjorkrnan PJ, Saper MA, Samraoui B, Bennett WS, Sirominger JL, Wiley DC: Structure
of the hurnan class [i histocompatibility antigen, HLA-A2. Nature 329(8): 506-
512, 1987.
Blankenhom EP, Cramer DV: Orientation of the loci encoding RTL .B polypeptides in the
major histocompatibility complex of the rat. ùnmunogenetics 2 1 : 135- 142, 1985.
Bliss M: The Discoverv of Insulin. Chicago: The U. of Chicago Press, 1982.
Bottazzo GF, Bosi E, Bonifacio E, Mirakian R, Todd 1, Pujol-Borrel R: Pathogenesis of
type 1 (insulin-dependent) diabetes: possible mechanisms of autoimmune damage.
British Medical Bulletin 45(1): 37-57, 1989.
Brown JH, Jardetzky TT Saper MA: A hypothetical mode1 of foreign antigen binding site
of class II histocompatibility molecules. Nature 332: 845-850, 1988.
Brown MA, Griffith IJ, Glimcher LH: Functional and molecular characterization of E A ~ P
mutants is consistent with the predicted three-dimensional structure of class II MHC
molecules. Molec. Irnmunol. 27(7): 645-650, 1990.
Castano L, Eisenbarth GS: Type 1 diabetes: a chronic autoimmune disease of huamn,
mouse, and rat. A. Rev. Irnmunology 8: 647-679, 1990.
Chao NJ, Timmerrnan L, McDevitt HO, Jacob CO: Molecular characterization of MHC
class II antigens (pl domain) in the BB diabetes-prone and -resistant rat.
Imrnunogene tics 29: 23 1-234, 1989.
Chomczynski P, Sacchi N: Single step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Analytical Biochem. 162: 156- 159,
1987.
Colle E, Guttmann RD, Seemayer TA: Association of spontaneous thyroiditis with the
major histocompatibility complex of the rat. Endocrinology 1 l6(4): 1243- 1247,
1985.
Colle E: Short anaiytical review: genetic susceptibility to the development of spontaneous
insulin-dependent diabetes mellitus in the rat. Clinical Immunology and
Irnrnunopathology 57: 1-9, 1990.
Crisa L, Mordes JP, Rossini AA: Autoimmune diabetes meIlitus in the BB rat.
Diabetes/Metabolism Reviews 8( 1): 9-37, 1992.
Darnell J, Lodish H, Baltimore D: Molecular Ce11 Biolo9y. New York: WH Freeman and
Company, 1990.
Diamond AG, Hood LE, Howard JC, Windle M, Winoto A: The class II genes of the rat
MHC. Journal of Imrnunol. 142(9): 3268-3274, 1989.
Eccles SJ, McMaster R: DNA sequence analysis of a rat RT 1 class II A P gene.
Immunogenetics 22: 653-663, 1985.
Erlich HA, Gyllensten UB: Shared epitopes arnong HLA class II alleles: gene conversion,
comrnon ancestry and balancing selection. Immunology Today 12( 1 1): 4 1 1-4 14,
1991.
Erlich HA, Gyllensten UB: The evolution of allelic diversity at the primate major
histocompatibility complex class II loci. Human Immunology 30: 1 10- 1 18, 199 1.
Field LL: Invited editorial: Insulin-dependent diabetes meilitus: a mode1 for the study of
multifactorial disorders. Am. J. Hum. Genet. 43: 793-798, 1988.
Figueroa F, Ginther E, Klein J: MHC polymorphism pre-dating speciation. Nature 335:
265-267, 1988.
Fujii H, Kakinuma M, Yoshiki TT Natori T: Mapping and transcriptional properties of RT 1
class II region genes. Transplantation 52(2): 369-373, 199 la.
Fujii H, Kakinuma M, Yoshiki TT Natori T: Polyrnorphism of the class II gene of rat major
histocornpatibility complex, RT 1: partial sequence cornparison of the first domain of
the RT 1 .BB 1 alleles. imrnunogenetics 33: 399-403, 199 1 b.
Fuks A, Colle ET Ono SJ, Prud'homme G, Seernayer TT Guttmann RD: "Immunogenetic
studies of insulin-dependent diabetes in the BB rat." in: Frontiers in diabetes
research. Lessons from animal diabetes II. editors Shafrir E and Renold AE
Montreal: John Libbey and Co. Ltd., 29-33, 1988.
Fuks A, Ono SJ, Colle E, Guttmann RD: A single dose of the MHC-linked susceptibility
determinant associated with the RTL haplotype is permissive for insulin-dependent
diabetes mellitus in the BB rat. Expl. Ch. Immunogenet. 7: 162- 169, 1990.
Fuks A, Colle E. Guttmann RD: Recombinant haplotype bearing the lymphopenia gene of
the BB rat. Exp. Clin. Ixnmunogenet. 12: 48-52, 1995.
Goodfellow PN, Schmitt K: From the simple to the complex. Nature 37 1: 104- 105. 1994.
Greiner DL, Mordes JP, Handler ES, Angelülo M, Nakamura N, Rossini AA: Depletion
of RT6.P T lymphocytes induces diabetes in resistant BiobreedingNorcester
(BBIW) rats. J. Exp. Med. 166: 461-474, 1987.
Guyton A: Textbook of Medical Phvsiolow. 8th edition. Philadelphia: W.B. Saunders
Co., 1991.
Gyllenstein UE3, Lashkari D, Erlich H: Allele diversification at the class II DQB locus of
the rnarnrnalian major histocompatibility cornplex. Proc. Natl. Acad. Sci. USA 87:
1835- 1839, 1990.
Holowachuk EW, Greer MK: Unaltered class II histocornpatibility antigens and
pathogenesis of IDDM in BB rats. Diabetes 38: 267-27 1, 1989.
Holowachuk kW, Greer M, Martin DR: The complete sequence of the MHC class II chah
RTl D a u of the diabetic BB rat: mRNA levels of RT 1 .D a in lymphocytes. Nuc.
Acid. Res. 15(24): 1055 1- 10567, 1987.
Hom GT, Bugawan TL. Long CM, Manos MM, Erlich HA: Sequence analysis of HLA
class II genes from insulin-dependent diabetic individuals. Human ïmrnunology 2 1 :
249-263, 1988.
Iaramillo A, Giil BM, Delovitch TL. IDDM in the NOD mouse: a disease mediated by T
ce11 anergy? Science 55(15): 1 163-1 177, 1994.
Kahn RC, Weir GC: Joslinfs Diabetes Mellitus. 13th edition. Philadelphia: Lea and
Febiger, 1994.
Katz JD, Benoist L, Mathis D: T helper subsets in insulin-dependent diabetes. Science
268: 1 185- 1 188, 1995.
Kaufman IF: The class II molecules of the human and murine major histocompatibility
complex. Ce11 36: 1 - 13, 1984.
Khalil 1, d'Auriol L, Gobet M, Morin L, Lepage V, Deschamps 1, Park MS, Degos L,
Gdibert F, Hors J: A combination of HLA-DQP Asp57-negative and HLA-DQa
k g 5 2 confers susceptibility to insulin-dependent diabetes melfitus. Arnerican
Society for Clinical Investigation 85: 13 15- 13 19, L990.
Khalil 1, Deschamps 1, Lepage V, Al-Daccak R, Degos L, Hors J: Dose effect of cis- and
tram-encoded HLA-DQ a P heterodimea in IDDM susceptibility. Diabetes 4 1:
378-384, 1992.
Kikutani H, Makino S: The murine autoirnrnune diabetes model: NOD and related strains.
Advances in Imrnunology 5 1: 285-323, 1992.
Koch F, Hang F, Kashan A, Thiele HG: Primary structure of rat RT6.2, a non-
glycosylated phosphatidylinositol-linked surface marker of postthymic T cells.
Proc. Natl. Acad. Sci. USA 87: 964-967, 1990.
Kosuda LL, Hosseinzadeh H, Greiner DL. Bigazzi PE: Role of RT6+ T lymphocytes in
rnercury-induced rend autoimrnunity: experimental manipulations of "susceptible"
and "resistant" rats. Journal of Toxicology and Environmental Health 42: 303-321,
1994.
Lund T, OtReilly L, Hutchings P, Kanagawa O, Simpson E, Gravely R, Chandler P,
Dyson J, Picard JK, Edwards A, Kioussis D, Cooke A: Prevention of insulin-
dependent diabetes mefitus in non-obese diabetic mice by transgenes encoding
modified 1-A fl-chain or normal LE a-chain. Nature 345: 727-729, 1990.
Marx IL: Cloning the genes of the MHC. Science 2 16: 400-402. 1982.
Miyazaki T, Uno M, Uehira M, Kikutani H, Kishimoto T, Kimoto M, Nishimoto H,
Miyazaki JI, Yamarnura KI: Direct evidence for the contribution of the unique 1-
ANoD to the deveiopment of insulitis in non-obese diabetic mice. Nature 345: 722-
724, 1990.
Natori T, Fujimoto Y, Ikeda H, lshikawa H, Matsuno Y, Tsuchimoto S, Mizaino K,
Niiyama T, Cramer D, Aizawa M: The RT 1 .B/D-region products defined by rat
monoclonal ailoantibodies. [mmunogenetics 22: 5 1 1-5 16, 1985.
Ohta T: Role of diversiQing selection and gene conversion in evolution of major
histocompatibitity complex loci. Proc. Natl. Acad. Sci. USA 88: 67 16-6720, 1991.
Ono SJ, Fuks A, Guttrnann RD, Colle E: Susceptibility and resistance genes to insulin-
dependent diabetes mellitus in the BB rat. Expl. Clin. Immunogent. 6: 169-178,
1989.
Parfrey NA, Prud'homme GJ, Colle ET Fuks A, Seemayer TA, Guttmann RD:
Irnrnunologic and genetic studies of diabetes in the BB rat. Critical Reviews in
Imm. 9(I): 45-65, 1989.
Parham P: A diversity of diabetes. Nature 345: 662-664, 1990.
Prud'homme GJ, Fuks A, Colle E, Seemayer T, Guttmann RD: Immune dysfunction in
diabetes-prone BB rats. J. Exp. Med. 159: 463-478, 1984.
Rarnensee HC, Friede T, Stevanovic S: MHC ligands and peptide motifs: fust listing.
Irnmunogenetics 4 1 : 178-228, 1995.
Reich EP, von Grafenstein H, Barlow A, Swenson KE, Williams K, Janeway CA: Self
peptides isolated from MHC glycoproteins of non-obese diabetic mice. J.
Immunol. 152: 2279-2288, 1994.
Rich S: Mapping genes in diabetes. Diabetes 39: 13 15- 13 19, 1990.
Robertson KA, McMaster WR: Complete structure of a rat RT 1 Ep chah: extensive
conservation of MHC class II p chains. J. Immunol. 135(6): 4095-4099, 1985.
Rossini AA, Mordes JP, Like AA: Imrnunology of Insulin-dependent diabetes mellitus.
Ann. Rev. Immunol. 3: 289-320, 1985.
Schadewaldt H: The history of diabetes rnellitus. In: van Engelhardt D, ed.: Diabetes. Its
Medical and Cultural History. New York: Springer Verlag, 1987.
Scholler J, Lenrnark A: Isolation of a rat immune response gene identical to an alleged
mouse A class II Pchain pseudogene. Immunogenetics 22: 601-608, 1985.
Singer SM, Tisch R, Yang XD, McDevitt HO: An AB^ transgene prevents diabetes in
nonobese diabetic mice by inducing regulatory T cells. Proc. Natl. Acad. Sci. USA
90: 9566-9570, 1993.
Slattery RM, Kjer-Nielsen L, Allison J, Charlton B, Mandel, TE, Miller J: Prevention of
diabetes in non-obese diabetic 1 - A ~ transgenic rnice. Nature 345: 724-726, 1990.
Srivastava R, Ram BP, Tyle P: Irnmuno~enetics of the Maior Histocom~atibilitv Com~lex.
New York: VCH Publishers, hc., 199 1.
Sterkers G, Zeliszewski D, Chaussee AM, Deschamps 1, Font MP, Friedel C, Hors J,
Betuel H, Dausset J, Levy JP: HLA-DQ rather than HLA-DR region might be
involved in dominant nonsusceptibility to diabetes. Proc. Natl. Acad. Sci. USA 85:
6473-6477, 1985.
Stiller CR: Effects of cyclospotin imrnunosuppression in insulin-dependent diabetes
mellitus of recent onset Science 223: 1362- 1367, 1984.
Stryer L: Biochernistrv. 3rd ed. New York: WH Freeman and Company, 1988.
Tisch R, McDevitt HO: Insulin-dependent diabetes meiiitus. Cell85: 29 1-297, 1996.
Todd JA, Bell Ji, McDevitt HO: HLA-DQP gene contributes to susceptibility and
resistance to insulin-dependent diabetes meiiitus. Nature 329( 15): 599-604, 1987.
Todd JA, Bell JI, McDevitt HO: A molecular bais for genetic susceptibility to IDDM.
Trends in Genetics 4(5): 129- 134, 1988.
Todd JA: Genetic control of autoirnmunity in type 1 diabetes. Irnmunology Today 1 l(4):
122-128, 1990.
Todd JA, Acha-Orbea H, Bell JI, Chao N, Fronek Z, Jacob CO, McDermott M, Sinha AA,
Timmerman L, Steinman L, McDevitt HO: A molecular bais for MHC class 11-
associated autoimmunity. Science 240: 1003- 1009, 1988.
Vyse TJ, Todd JA: Genetic analysis of autoimmune disease. Ce11 85: 3 1 1-3 18, 1996.
Watson JD, Gilman M, Witkowski J, Zoller M: Recombinant DNA, 2nd editon. New
York: WH Freeman and Company, 1992.
IMAGE EVALUATION TEST TARGET (QA-3)
APPLIED IMAGE, lnc a 1653 East Main Street
,=-; Rochester, NY 14609 USA -œ .-- Phone: il W#~-O300 =-= Fu: 71 6/288-5989
O 1993, Applied Image. Inc.. All Rights Reserved