Metagenomics of Microbial Communities

Scott SprouleCam MacMillanDaniel Hann

OutlineContext- A brief history of microbiology- A brief history of genomics- Defining metagenomicsMetagenomics - Transcending genomics- Accurate diversity measurementsTwo approaches of metagenomics- Sequence based approach- Function based approachEnvironmental analysis- Marine- SoilApplications of Metagenomics- Industrial - Agriculture & Renewable Energy- Environmental remediation- Life sciencesConclusion

Context

Date Contributor Contribution

1703 Robert Hooke Observed Cells

1677 Antonie van Veeuwenhoek Observed microbes

1776 Edward Jenner Vaccine

1862 Louis Pasteur Germ Theory

1875 Ferdinand J. Cohn Classification of Bacteria

1881 Robert Koch Bacteria & Disease

1928 Frederick Griffith Transformation

1950’s

Jonas Salk Advances in cell culturing

1963 Jacob & Monod Operon concept

1973 Cohen, Chang, Helling, & Boyer

Plasmids as vectors

1986 Kary Mullis Polymerase chain reaction

Microbiology: Perspective

Main Techniques

Culturing Techniques Microscopic Techniques

- Direct observation- Combine with

- Staining- Isotopes- Flourescence

- Growing- Isolation- Examination- Manipulation- experimentation

Inconsistent estimates of diversity and organisms numbers

Accounting for Inconsistencies

- How much were they missing?

- What were they missing?

- Why were they missing it?

“The Great Plate Count Anomaly”

It was clear that there were many viable cells that could not be cultured

“Unculturability”

Environmental- Nutritional factors- Signaling factors- Essential factors- Artificial reproduction

difficult

Bacteria- Specific requirements- Competition- Community structure- Defense mechanisms

“Can we culture the unculturable?

Genome

- Common all living things on earth

- A universal language

- An instruction manual

- A toolbox

- A record of history

Genomics

the study of whole genomes

Nucleotides DNA Genes Genomes

History of Genomics

Date Contributor Contribution

1858 Darwin Natural selection

1865 Mendel Genetic inheritance

1941 Beagle and Tatum One gene, one enzyme

1944 Avery, MacLeod, & McCarty

DNA genetic material

1946 Lederberg & Tatum Bacterial recombination

1953 Watson & Crick Double helix

1969 Bell laboratories UNIX

1974 Cerg & Kahn TCP protocol

1977 Sanger Sanger sequencing

1982 GenBank Online database

1990 Altshul BLAST

1995 Venter & Celera Corp Shotgun sequencing

Rapid sequencing of whole genomes

The pinnacle of genomics?

Metagenomics transcends genomics

Multiple genome level

Genomics Today

Metagenomics

Meta-analysis – combination of separate analysis

Genomics – analysis of an organisms genetic material

What is metagenomics?Study of the collection of microbial genomes or genome fragments through direct extraction

A culture independent technique that can provide meta-analytic level information about:

- Population structure- Genetic Diversity- Functional elements- Novel genetic material

A synthesis of a number of fields:- Molecular Genetics- Microbiology- Bioinformatics- Population Genetics- Computer science

Applying Metagenomics to Microbial Communities

Traditional methods of quantifying microbial diversity- Sample environments independently- Isolate each species through culturing

techniques- Characterize through biochemical &

sequencing techniques

Realistic?- Very labour intensive- Time estimate: 100’s of years- Incredibly expensive $$$$$$- Most organisms can not currently be be

isolated through culture

Microorganisms

Are Everywhere!

Scratching the surface

Tools of Metagenomics- Cloning techniques- PCR- Cutting edge sequencing techniques- Bioinformatics- Open source databases

- Genbank- Protein Database- TreeBASE

GenBank - “An annotated collection of all publicly available nucleotide and amino acid sequences.” --NCBI

Growth of GenBank

Steep hill to climb!

Doubling every 18 months!

Founded: 1982

Shotgun Sequencing: 1995

Approaches to metagenomics?

Questions for metagenomics

Analysis

Two main approaches

(1) Sequence driven

- What genes are there

(2) Function driven

- What the genes do

Sequence driven approaches- Data collection- Relies on conserved DNA- Phylogenic analysis- Used to measure biological

diversity

Functional driven approaches- Functional screening- Can identify novel genes- Relies on gene expression

- Proteins

Extract DNA

Metagenomic Process

Determine what the genes are

Determine what the genes do

Sequence-Based Approach

Sequencing

• One way to classify metagenomic fragments• Relies on nucleotide diversity analysis

– Discriminate between species

Seq. A GACTACGATCCGTATACGCACA--GGTTCAGAC|| ||||| ||||||||||||| |||||||||

Seq. B. GAATACGAGCCGTATACGCACACAGGTTCAGA

• Requires use of online databases– Ex: BLAST in GenBank

Compares “unknown to known”

Restrictions

Genomics Metagenomics

Whole Genome Sequenced

Know Species of Origination

Many DNA elements Identified

✔ ✖

✔

✔

✖✖

Sequence Metagenomics

• Not necessary to determine species of origin

• Obtain large volume of data ~ Less redundant

• Fragment’s = 20bp – 700bp

• Assembled sequence reads don’t exceed 5000 bp

Random Shotgun Sequencing

1. Library construction

a. isolate DNA

b. fragment DNA

c. clone DNA

2. Random Sequencing Phase

a. Automated pyrosequencing DNA

VECTORACTGTTC...

3. Assembly

a. assemble sequences

b. close gaps

C. edit sequence4. Annotation

AndPublication

Missassemblies?

Random Sequencing

Objective– To estimate bacterial biodiversity ~ Species Richness– Identify 1000’s of prokaryotic, viral & eukaryotic species– Mass amounts of genomic data obtained– Does not depend on PCR– Put sequence in computer BLAST

– Studies in:• Sea water• Soil microbial mats• Dead whale carcass• Feces etc.• Organism level (microbiome)

– Microorganisms are Everywhere!

Sequence Specific: Phylogenic

• Look at evolutionary relationships

Key Challenge

• Analysis based on evolutionarily conserved marker sequences

Want– High conservation across species– Slight & measureable changes over millions of

years

What to look for?

16S rRNA

16S rRNA

Value• Vital for translation

– Essential• Short• Conserved within a species• Different between different species• Very slow mutation rate

Species Concept- Sequence based arbitrary - ~ Consensus: ~97% identity = species- Changing all the time

Screen for 16S rRNA sequence

• Extract DNA• Construct clone

library• Ex BAC cloning

• Screen using sequence specific primers

• When desired fragment is found• Sequence &

compare

Alignment represents a hypothesis

Function Based Approach

Sample

Genomic DNA extraction

DNA sheared

Plasmid vector

Transformation

Functional screening

Functional Approach: Overview

DNA Extraction and Isolation

Removal of contaminants

Aspects of Sample

Blender Centrifugation

Cell purification

Cell lysis

DNA Isolation & Restriction Digest

Cloning & Transformation

Random Fragmentscloned into expressionvectors

Expression vectorstransfected into broad expression hosts

Plasmid Expression vectors

Functional Screening

Treasure Hunting

Looking for novel genes

Biological tool boxes

Detergents- Proteases- Lipases- Esterase’s

Antibiotics- Novel antibiotics- Not synthetic- Mutate the antibiotics

- Microbes = 90% of marine biomass

Marine Metagenomics

- 98% of Primary Producers in Sea

- .001-.1% are cultivable

Craig Venter

Ocean Exploration

• Ocean exploration genome project in aims of assessing the microbial diversity of marine microorganisms

• 7.7 million sequence reads 44 different samples 41 sites

• Surface water at 320km intervals

Sample Collection

• Determine physical characteristics of sample site – Salinity, pH, depth, dissolved O2,

temperature– Filtered & storage

• Characterize Genetic Material– DNA Isolation– Constructing a Library– Automated Sequencing

• Metagenomic Analysis

Discoveries

• First twelve hours in Sargasso Sea– Tripled the number of known prokaryotes on earth

• Six million new genes – 1.3 million new genes + 50 000 species from single site

• Tens of thousands of new protein families

• 782 rhodopsin-like photoreceptors– Previously only found in Archaea

• Unexpected links between genetics & environment– Different rhodopsin proteins in open ocean vs coast line

Better understanding of key biological processes?– New ideas for alternative energy production?– Solutions to deal with climate change?

Components

Soil Metagenomics

Soil is very diverse- Nutrients- Moisture- pH- Organic- Oxygen- Temperature- Surface vs. Subsurface

Elusive- Poor recovery rate- Nuclease- Cell bias to lysis techniques- Different methods yield

dramatically different estimates of diversity and organism number

Soil Diversity

The number of prokaryotic species found in a single soil sample exceeds the number of known cultured prokaryotes

40X more diverse than marine

Soil is very diverse- Nutrients- Moisture- pH- Organic- Oxygen- temperature

Estimates:

Accounting for different extraction methods

Soil Requires more Complicated Approach

Variability in Extraction Methods

How much are we still missing?

Other Metagenomic Hot Spots…

Whale Carcass

Wastewater

Human Gut

Feces

Applications of Metagenomics

“The metagenome provides a potentially inexhaustible genetic resource for biomolecules of potential utility in a variety of industries”

Applications of Metagenomics- Metagenomics offers potential solutions to some of the most complex

medical, environmental, agricultural and economic challenges of today

- Biotechnological potential of uncultivated bacteria might be accessible by directly cloning DNA sequences retrieved from the environment

Information on why certain organisms

are unculturable

Culture these organisms

Discover novel Pathways

Industrial Applications

• Novel enzymes rare through culturing

• Novelty: Avoid infringing on a competitor’s intellectual rights• Bacillus Protease Novo

• Hundreds of variations with a single AA substituted

• Enzymes are vital for many different industries and their sales are estimated at $2.3 billion in 2003.

• Food applications, detergents, textiles, agriculture, pulp/paper and other chemicals

Industrial Applications

- Temperature

- pH

- Pressure

- Speed

- Turnover

Search for the “Ideal” bio-catalyst

Environmental Remediation

Environmental Contamination • Toxic metals• Fossil fuels• Chemicals• Xenobiotics

Microorganisms can interact withcontaminants

• Oxidize• Bind• Transform• Immobilize

Metagenomic searches forgenes & proteins involved

Picking on Alberta: Tar Sands

Agriculture– Detecting diseases in livestock, crops and other

products

– Soils rich in microbial communities.

– Communities very complex, poorly understood and their intimacy with crops means they are of economic importance• nutrient cycling, nitrogen fixation, sequestering

metals– Understanding soil composition Enhanced farming

Renewable Energy

• Typically derived from biomass sources

• Cellulose and other non-edible parts of plants transformed into biofuels

• Transform cellulose into usable ethanol, methanol• Ex: Cellulosic ethanol

• Produce energy sources such as hydrogen and methane

• Capture and store these by-products

• Metagenomics approaches for new, efficient ways of producing energy sources

Renewable Energy

Searching mircobial communities for biomolecules that can be used as energy

Looking in unlikely places

Cow Rumen:

- Cellulose digestion Methane

- Cleaner methane

- Metagenomic analysis for compounds involved in this reaction

Ex: Bio- Alcohols, Bio-Diseases, Oils, etc….

Human Health

– The microbiome: The relationship between the human body and the microbial communities will lead to new methods for diagnosing, treating and preventing diseases

– Being used to sequence the microbial communities from ~18 body sites from 250 individuals to determine if changes to the human microbiome can be correlated with human health.

– Drugs from microbe-derived compounds: Look for function• metagenomics searches

Metagenomic Approach to Microbiome

- Microbiome very influential to human health

- What do know know about the microbiome?

- Metagenomic approach tells us not very much

- Comparing microbiome of healty and non. Healthy

- Microbiome transplants?

Future Directions

• New enzymes, antibiotics, and other reagents identified

• More exotic habitats can be intently studied

• Can only progress as library technology progresses, including sequencing technology

• Improved bioinformatics will quicken library profile analysis

• Investigating ancient DNA remnants

• Discoveries such as phylogenic tags (rRNA genes, etc)

• Learning novel pathways will lead to knowledge about the current nonculturable bacteria to then learning to culture these systems

Conclusion