Supplementary Information

Supplementary Methods pp. 2–5

Supplementary References pp. 6–7

Supplementary Figures pp. 8–11

Figure S1. Detection of fusion genes

Figure S2. Detection of MYB-PLEKHO1 in the 293T transfectant

Figure S3. Expression of cell surface molecules

Figure S4. Analysis of publicly available data

Supplementary Tables pp. 12–20

Table S1. Patient characteristics

Table S2. Somatic mutations identified by whole-exome sequencing

Table S3. Somatic mutations identified by targeted sequencing

Table S4. Genes with significant differential expression in 293T cells

Table S5. List of primers

1

Supplementary Methods

Patients

We enrolled 14 patients (five children and nine adults) with BPDCN who were treated in our institutions and

for whom DNA and RNA samples were available. In addition to the assessment of clinical manifestations,

several expert pathologists who had specialized in hematological malignancies reviewed morphology and

immunochemistry, and established BPDCN diagnoses according to the 2008 World Health Organization

classification criteria. Together with the morphologically blastic appearance, the combinations of

immunophenotypic marker expressions were essential: the positive expression of CD4, CD56, and markers

more restricted to plasmacytoid dendritic cells such as interleukin 3 receptor subunit alpha and blood

dendritic cell antigen 2, and negative results for other lineage-specific markers.1 The institutional review

board of Nagoya University Graduate School of Medicine approved this study. Detailed clinicopathological

profiles of subject nos. 1, 4–6, 8, 9, 13, 16, 17, and 18 were separately in preparation in the context of a

larger series by Y. Suzuki.

Samples

We used cryopreserved (subject nos. 1−3, 24, and 25) or formalin-fixed paraffin-embedded (FFPE) (subject

nos. 4−6, 8, 9, 13, 16, 17, and 18) samples that contained tumor cells obtained at the initial diagnosis via

skin biopsy, lymph node biopsy, or bone marrow aspiration. RNA and genomic DNA were extracted using

RNeasy Mini Kits (QIAGEN, Hilden, Germany) and QIAamp DNA Blood Mini Kits (QIAGEN), respectively,

for cryopreserved samples and RNeasy FFPE Kits (QIAGEN) and QIAamp DNA FFPE Tissue Kits

(QIAGEN), respectively, for FFPE samples.

Polymerase chain reaction (PCR)

The amplification of target regions that contained chromosomal rearrangement breakpoints from genomic

DNA was performed using primers (Supplementary Table S5), Mastercycler Pro S (Eppendorf, Hamburg,

Germany), and PrimeSTAR GXL DNA Polymerase (TaKaRa Bio, Otsu, Japan) according to the

manufacturers’ instructions.

RNA sequencing

2

After validating the RNA quality using RNA ScreenTape and a TapeStation 2200 system (Agilent, Santa

Clara, CA), sequencing libraries were prepared using a NEBNext Ultra RNA Prep Kit for Illumina (New

England Biolabs, Ipswich, MA), according to the manufacturer’s instructions. Massively parallel sequencing

was performed using a HiSeq 2500 next-generation sequencing platform (Illumina, San Diego, CA) with a 2

× 75-base pair (bp)-paired end-reads option. The obtained data were analyzed using TopHat-Fusion (gene

fusion detection),2 HTSeq (expression profile calculation),3 DESeq (differential expression analysis),4 and

GFOLD (differential expression analysis).5 Putative gene fusions were validated using both genomic and

complementary DNA prepared with a ThermoScript reverse transcription system (Life Technologies,

Carlsbad, CA).

Whole-exome sequencing

Whole-exome sequencing was essentially performed as described.6 In brief, sequencing libraries were

prepared using a SureSelect XT Target Enrichment System and SureSelect Human All Exon V5 bait

(Agilent) and sequenced using a HiSeq 2500 with a 2 ×150-bp-paired end-reads option, according to the

manufacturer’s instructions. Obtained sequences (100× for germline and 250× for tumor) were aligned to

the hg19 reference genome using the Burrows–Wheeler Aligner with a –mem option (http://bio-

bwa.sourceforge.net/). After removing PCR duplicates using Picard tools

(http://broadinstitute.github.io/picard/), putative germline and somatic variants were called with VarScan2.7

For germline variants, a variant allele frequency (VAF) cut-off of >0.25 was set. Using the ACMG

recommendations,8 all variants were classified according to their pathogenicity. The Human Genome

Mutation Database (http://www.hgmd.cf.ac.uk/) was used to identify pathogenic missense variants. A

genetic diagnosis was considered according to the pathogenic or likely pathogenic variants based on the

mode of inheritance of each disease. For somatic mutations, putative variants with a P value of <0.01

(provided by VarScan2) were further filtered using the mean VAF of identical variants obtained from the

data of 12 unrelated germline samples. If the mean VAF of the reference samples exceeded 0.01, we

considered the variant to be an artifact.

Targeted sequencing

We used a custom-designed SureSelect bait to perform targeted sequencing of genes, including major

hematological malignancy-associated genes.9 We sequenced tumor samples to obtain 500× coverage and

3

detected putative somatic variants supported by 10 or more reads and >0.1 variant allele frequency. Among

them, we removed common SNPs with minor allele frequency >1% defined either by ESP6500

(http://evs.gs.washington.edu/EVS/, accessed at 05/02/2017), ExAC (http://exac.broadinstitute.org/,

accessed at 05/02/2017), Kaviar (http://db.systemsbiology.net/kaviar/, accessed at 05/02/2017), or HGVD

(http://www.genome.med.kyoto-u.ac.jp/SnpDB/, accessed at 05/02/2017).

Exogenous expression

The complete coding sequence of the MYB-PLEKHO1 fusion gene was cloned into the CSIV-CMV-MCS-

IRES2-Venus vector (kindly provided by Dr. Hiroyuki Miyoshi, Riken BioResource Center, Tsukuba, Japan).

293T cells were transfected with this constructed or a mock vector using ScreenFectA transfection reagent

(Wako Pure Chemical Industries, Osaka, Japan). At 48 hours post transfection, cells were subjected to cell

sorting based on green fluorescence expression using a FACSAria II cell sorter (BD Biosciences, San Jose,

CA). Finally, RNA was extracted from the sorted cells.

Western blot analysis

293T cells were transfected with MYB-PLEKHO1 or a mock vector. The detection of MYB-PLEKHO1,

Venus, and α-tubulin was performed using anti-MYB (cat no. 12319S, Cell Signaling Technology, Danvers,

MA), anti-PLEKHO1 (cat no. 24883-1-AP, Proteintech, Rosemont, IL), anti-GFP (cat no. 2956S, Cell

Signaling Technology), and anti-α-tubulin (cat no. T9026-.2ML, Sigma–Aldrich, St. Louis, MO) antibodies

according to the manufacturers’ instructions.

Flow cytometry

Using allophycocyanin-conjugated antibodies to NCAM1 (CD56) (cat no. IM2474U, Beckman Coulter, Brea,

CA), CD68 (cat no. 333809, BioLegend, San Diego, CA), S1PR1 (CD363) (cat no. FAB2016A, R&D

Systems, Minneapolis, MN), CXCR4 (cat no. 306509, BioLegend), and CRTAM (CD355) (cat no. 339108,

BioLegend), we stained cryopreserved bone marrow tumor cells from a patient (subject number 2).

Fluorescence was analyzed using a FACSCalibur flow cytometer and CellQuest software (BD Biosciences,

Franklin Lakes, NJ).

Profiles of mRNA expression in publicly available data

4

We made use of publicly available data deposited by Sapienza et al.10 Normalized gene expression profiles

for the 19 samples were retrieved from Gene Expression Omnibus (GSE62014) using the R package

GEOquery.11 For each sample, genes with a detection P value of ≥0.01 were assigned not-detected status.

We excluded 2462 genes with not-detected status in all samples. A total of 18356 genes remained for the

gene set enrichment analysis (GSEA).

GSEA

To evaluate the differences in expression profiles, we applied a GSEA pre-ranked.12 For the data of 293T

cells, we used the GFOLD algorithm to calculate the rankings of differentially expressed genes. Genes with

a coding length of <200 bp or <10 reads in all samples were excluded. For the data of Sapienza et al., we

used SAM statistics to calculate rankings of differentially expressed genes.13 Enrichment was calculated

with a total of 1000 permutations for several MYB-related gene sets in the MSigDB database v5.1

(http://software.broadinstitute.org/gsea/msigdb/, accessed at 16/08/2016). A P value of <0.05 was

considered significant.

Fluorescence in situ hybridization

Five-micrometer-thick sections of FFPE tumor samples from each patient were investigated using labeled

probes that were designed to identify MYB gene splits (cat no. FS0016, Abnova, Taipei, Taiwan) as

described.14

Statistical analysis

All reported P values are two sided, and P values of <0.05 were considered significant. All statistical

analyses were performed using EZR (Saitama Medical Center, Jichi Medical University, Saitama, Japan), a

graphical user interface for R (The R Foundation for Statistical Computing, Vienna, Austria).15

5

Supplementary References

1. Pagano L, Valentini CG, Grammatico S, Pulsoni A. Blastic plasmacytoid dendritic cell neoplasm:

diagnostic criteria and therapeutical approaches. Br J Haematol 2016 Jul; 174(2): 188-202.

2. Kim D, Salzberg SL. TopHat-Fusion: an algorithm for discovery of novel fusion transcripts. Genome

Biol 2011; 12(8): R72.

3. Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high-throughput sequencing

data. Bioinformatics 2015 Jan 15; 31(2): 166-169.

4. Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol 2010;

11(10): R106.

5. Feng J, Meyer CA, Wang Q, Liu JS, Shirley Liu X, Zhang Y. GFOLD: a generalized fold change for

ranking differentially expressed genes from RNA-seq data. Bioinformatics 2012 Nov 1; 28(21): 2782-

2788.

6. Suzuki K, Okuno Y, Kawashima N, Muramatsu H, Okuno T, Wang X, et al. MEF2D-BCL9 fusion gene

is associated with high-risk acute B-cell precursor lymphoblastic leukemia in adolescents. J Clin

Oncol 2016 Aug 9.

7. Koboldt DC, Zhang Q, Larson DE, Shen D, McLellan MD, Lin L, et al. VarScan 2: somatic mutation

and copy number alteration discovery in cancer by exome sequencing. Genome Res 2012 Mar;

22(3): 568-576.

8. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the

interpretation of sequence variants: a joint consensus recommendation of the American College of

Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015 May;

17(5): 405-424.

9. Menezes J, Acquadro F, Wiseman M, Gomez-Lopez G, Salgado RN, Talavera-Casanas JG, et al.

Exome sequencing reveals novel and recurrent mutations with clinical impact in blastic plasmacytoid

dendritic cell neoplasm. Leukemia 2014 Apr; 28(4): 823-829.

10. Sapienza MR, Fuligni F, Agostinelli C, Tripodo C, Righi S, Laginestra MA, et al. Molecular profiling of

blastic plasmacytoid dendritic cell neoplasm reveals a unique pattern and suggests selective

sensitivity to NF-kB pathway inhibition. Leukemia 2014 Aug; 28(8): 1606-1616.

11. Davis S, Meltzer PS. GEOquery: a bridge between the Gene Expression Omnibus (GEO) and

6

BioConductor. Bioinformatics 2007 Jul 15; 23(14): 1846-1847.

12. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set

enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles.

Proc Natl Acad Sci U S A 2005 Oct 25; 102(43): 15545-15550.

13. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation

response. Proc Natl Acad Sci U S A 2001 Apr 24; 98(9): 5116-5121.

14. Nagasaka T, Gunji M, Hosokai N, Hayashi K, Ikeda H, Ito M, et al. FISH 1p/19q deletion/imbalance for

molecular subclassification of glioblastoma. Brain Tumor Pathol 2007; 24(1): 1-5.

15. Kanda Y. Investigation of the freely available easy-to-use software 'EZR' for medical statistics. Bone

Marrow Transplant 2013 Mar; 48(3): 452-458.

7

Supplementary Figures

Supplementary Figure S1. Detection of fusion genes.Each patient’s results from electrophoresis and Sanger sequencing are presented for both genomic and

complementary DNA. Orange arrows indicate the correct PCR products. Dotted lines indicate breakpoints.

bp, base pair.

8

Supplementary Figure S2. Detection of MYB-PLEKHO1 in the 293T transfectant.MYB-PLEKHO1 protein expression was confirmed by Western blot analysis. Jurkat cells were used as a

positive control for MYB expression.

9

Supplementary Figure S3. Expression of cell surface molecules.Cell surface expression of NCAM1, CD68, S1PR1, CXCR4, and CRTAM in bone marrow tumor cells from a

patient (subject number 2) was measured by flow cytometry. Outlined and orange histograms indicate

isotype controls and expression data, respectively.

10

Supplementary Figure S4. Analysis of publicly available data.(a) Ages of patients in the dataset. Patients were categorized into two groups based on their median age

(young, n = 9; old, n = 10). (b) Gene set enrichment analysis comparing young patients against old

patients. We used two MYB gene sets (LIU_VMYB_TARGETS_UP and LIU_CMYB_TARGETS_UP) for

analysis.

11

Supplementary Tables

Supplementary Table S1. Patient characteristics.

Abbreviations: BM, bone marrow; DOD, dead of disease; F/U, follow-up; HSCT, hematopoietic stem cell transplantation; LN, lymph node; NA, not available; ND, not detected;

TRM, transplantation-related mortality.

12

Supplementary Table S2. Somatic mutations identified by whole-exome sequencing.

Subject Gene Nucleic acid change Amino acid change Allele Reports in 1 AARS c.1347+1G>A (exon 10) 0.43 01 ADAMTS3 c.2443G>A p.D815N 0.06 01 ADGB c.1031C>A p.P344H 0.35 01 ATP2B3 c.3240C>G p.D1080E 0.24 01 CBS c.704C>T p.T235I 0.07 01 CDK14 c.40G>A p.G14S 0.39 01 GLOD5 c.54G>T p.L18F 0.21 01 GPR50 c.1327T>G p.S443A 0.47 01 HUWE1 c.3179G>A p.G1060D 0.13 01 HUWE1 c.3188T>C p.L1063P 0.07 01 IMP4 c.457C>T p.H153Y 0.29 01 KALRN c.1765-4G>A (exon 11) 0.43 01 MORF4L2 c.784T>G p.Y262D 0.14 01 MUC16 c.10819C>T p.P3607S 0.21 01 NCOA6 c.4771C>T p.P1591S 0.06 01 OTOGL c.1036G>A p.D346N 0.21 01 PDE5A c.166G>A p.A56T 0.20 01 PDZD8 c.1444G>T p.A482S 0.12 01 PLA2G4A c.533A>T p.Y178F 0.10 01 PLS1 c.509A>G p.N170S 0.37 01 PSG11 c.511C>T p.P171S 0.35 01 PSG9 c.590A>G p.K197R 0.47 01 RAB4B c.425A>G p.E142G 0.26 01 RIMBP2 c.313G>A p.E105K 0.27 01 SLC16A10 c.980A>G p.N327S 0.27 01 SLC26A7 c.256C>T p.P86S 0.09 01 UGP2 c.230C>T p.P77L 0.24 01 USP29 c.2530G>A p.D844N 0.45 11 ZFHX3 c.7794_7796delCAG p.S2599del 0.14 01 ZNF429 c.793G>T p.A265S 0.06 01 ZNF626 c.1063A>G p.T355A 0.07 11 ZNF626 c.1024A>C p.K342Q 0.07 02 ALG1 c.1292C>A p.A431E 0.12 02 DCP1B c.1304C>T p.P435L 0.06 02 ERICH3 c.3026C>T p.S1009L 0.10 12 LHX6 c.50G>T p.G17V 0.19 02 OR13C8 c.854G>A p.G285E 0.10 02 PPP1R3A c.304G>A p.E102K 0.10 02 SORBS2 c.1813G>A p.V605I 0.05 02 TET3 c.3341C>T p.P1114L 0.09 03 AKR1B15 c.251G>A p.G84E 0.12 03 CDH18 c.976G>A p.E326K 0.05 03 HELZ c.2314T>G p.L772V 0.07 03 PCDHGA8 c.728C>T p.P243L 0.05 03 TCEAL3 c.520G>A p.A174T 0.08 03 TRAP1 c.1063A>G p.S355G 0.09 0

13

24 ABCF1 c.1225C>T p.R409X 0.38 024 ADAM21 c.1201G>A p.G401R 0.20 024 ADGRG4 c.5066C>T p.S1689F 0.22 024 ADGRG4 c.3783G>A p.M1261I 0.39 024 ARFGEF3 c.2588A>G p.Y863C 0.19 024 ASB10 c.172G>A p.D58N 0.23 024 AXIN2 c.1091C>T p.P364L 0.47 024 C1orf94 c.484C>T p.L162F 0.16 024 CACNA1D c.6388G>A p.E2130K 0.34 024 CEP162 c.112delG p.E38RfsX2 0.24 024 CEP76 c.1072C>T p.H358Y 0.31 024 CTNNA3 c.1093C>T p.Q365X 0.17 024 DAB1 c.926C>T p.S309F 0.52 024 ESF1 c.2038+5G>A (exon 11) 0.17 024 GYS2 c.572C>T p.S191F 0.32 024 HAS2 c.299G>A p.R100K 0.21 024 HDX c.58G>A p.E20K 0.41 024 KMT2D c.4207T>G p.C1403G 0.14 024 MAST1 c.3683G>C p.S1228T 0.39 024 MCM3AP c.2528C>T p.A843V 0.39 024 MPEG1 c.683delA p.D228AfsX9 0.20 024 MRE11A c.1594C>T p.Q532X 0.48 024 MTCL1 c.3703C>T p.L1235F 0.19 024 MUC5B c.7930G>A p.G2644S 0.23 024 MYH14 c.4429G>A p.E1477K 0.28 024 NINL c.2705C>T p.P902L 0.51 024 OR12D2 c.157C>T p.L53F 0.41 024 OR1I1 c.517G>A p.E173K 0.39 024 OTOGL c.6511G>A p.D2171N 0.40 124 PCDHB5 c.2299A>G p.K767E 0.48 024 PEX11A c.56+1G>A (exon 1) 0.30 024 PNMAL1 c.363G>A p.W121X 0.19 024 PPP2R4 c.587C>T p.S196L 0.49 024 PSME4 c.1126C>T p.P376S 0.36 024 RABEP2 c.901C>T p.Q301X 0.19 024 RLIM c.656G>A p.R219Q 0.30 024 SPG7 c.797C>T p.A266V 0.42 024 SPTBN5 c.9944A>T p.Q3315L 0.41 024 SUPT20HL2 c.439C>T p.R147C 0.16 024 SYTL5 c.851C>T p.S284F 0.20 024 TECPR2 c.4169C>T p.T1390I 0.40 024 TRIO c.6875G>A p.G2292E 0.50 024 TRMT10A c.398G>C p.R133P 0.22 024 VWA5B2 c.1534-5C>T (exon 11) 0.20 024 ZNF599 c.1478C>T p.S493F 0.36 0

Abbreviations: COSMIC, Catalogue of Somatic Mutations in Cancer (http://cancer.sanger.ac.uk/cosmic).

14

Supplementary Table S3. Somatic mutations identified by targeted sequencing.

Subject number Gene Nucleic acid change Amino acid changeAllele

frequencyReports in COSMIC

4 ASXL1 c.1249C>T p.R417X 0.42 1

4 BCOR c.4586_4589delGTAG p.G1529EfsX4 0.73 0

4 IKZF1 c.1504C>T p.R502W 0.39 0

5 IKZF1 c.658delA p.E221SfsX36 0.31 1

5 TET2 c.3692T>C p.L1231P 0.30 0

5 ZRSR2 c.1064_1068del p.S355FfsX28 0.59 0

6 NRAS c.35G>T p.G12V 0.49 0

8 PHF6 c.61_67delAAGTCAA p.K21IfsX10 0.78 0

8 TET2 c.4244_4249del p.1416_1417del 0.79 0

9 ASXL1 c.1888_1910del p.E635RfsX15 0.26 0

9 PHF6 c.418G>A p.A140T 0.94 0

9 TET2 c.5692delT p.K1898SfsX10 0.40 0

9 TET2 c.680dupA p.M228NfsX3 0.40 0

13 ASXL1 c.1770dupT p.Y591LfsX28 0.48 0

13 NRAS c.491G>A p.R164H 0.53 0

13 SHOC2 c.4A>G p.S2G 0.36 0

13 TET2 c.3336delA p.P1113QfsX14 0.47 1

13 TET2 c.367C>T p.R123C 0.44 0

13 TET2 c.4146C>G p.H1382Q 0.33 0

13 ZRSR2 c.370C>T p.Q124X 0.82 0

16 EZH2 c.2111-3C>G (exon 19) 0.62 1

16 TET2 c.2827C>T p.Q943X 0.44 0

17 ASXL1 c.1888_1910del p.E635RfsX15 0.12 0

17 TET2 c.3500G>A p.R1167K 0.37 0

17 TET2 c.4133G>A p.C1378Y 0.58 0

18 IKZF1 c.487C>T p.H163Y 0.36 0

18 RB1 c.1332+3A>T (exon 13) 0.65 1

18 TET2 c.3954+5G>A (exon 7) 0.55 1

18 TET2 c.2338_2339insC p.P782SfsX8 0.46 1

15

Supplementary Table S4. Genes with significant differential expression in 293T cells.

Gene symbol baseMean (Mock) baseMean (MYB-PLEKHO1) log2FoldChange P value Adjusted P

MT2A 374.71 2387.65 2.67 1.1E-27 7.5E-24CDKN2B 1872.46 6739.91 1.85 6.6E-24 3.4E-20ROPN1L 68.73 837.98 3.61 1.3E-20 5.1E-17BAMBI 1701.73 5566.38 1.71 7.6E-20 2.6E-16PIK3R3 4903.43 13266.94 1.44 4.2E-18 1.3E-14

CA8 4068.64 10796.30 1.41 6.8E-17 1.8E-13RPL7 5761.50 2081.87 -1.47 1.2E-15 2.7E-12CD68 435.69 1748.12 2.00 3.9E-15 8.0E-12

CCNA1 31.04 484.39 3.96 6.5E-15 1.2E-11DHRS2 620.83 2141.40 1.79 3.1E-14 5.4E-11RPRM 1838.09 4921.43 1.42 4.4E-14 6.9E-11NCAM1 2658.47 6653.32 1.32 1.1E-13 1.6E-10S1PR1 170.73 909.24 2.41 6.0E-13 8.3E-10CXCR4 763.84 2340.75 1.62 9.0E-13 1.2E-09ITIH5 86.47 635.02 2.88 1.5E-12 1.8E-09

SLC4A8 369.17 1387.31 1.91 2.7E-12 3.1E-09ZHX2 2077.55 5008.93 1.27 8.4E-12 9.1E-09FGF9 787.12 2291.14 1.54 9.3E-12 9.5E-09

BHLHE41 682.91 2043.08 1.58 1.5E-11 1.5E-08PHLDB2 1247.20 3231.04 1.37 1.9E-11 1.8E-08MYADM 2664.01 6114.81 1.20 2.2E-11 2.0E-08CYTH3 3889.04 8574.62 1.14 2.4E-11 2.0E-08NOL4 483.36 1574.03 1.70 3.4E-11 2.7E-08TGIF1 1049.86 2785.44 1.41 3.5E-11 2.7E-08ETV5 501.10 1609.21 1.68 3.8E-11 2.9E-08EYA2 1142.99 2892.79 1.34 1.6E-10 1.2E-07

RUNX1 593.11 1676.86 1.50 1.3E-09 8.9E-07AHNAK 4443.35 9038.26 1.02 1.3E-09 8.9E-07CRTAM 0.00 147.03 Inf 2.3E-09 1.5E-06SPRY2 3035.40 6316.86 1.06 2.3E-09 1.5E-06NUCB2 5208.30 10311.92 0.99 3.1E-09 1.9E-06SCN4B 229.48 815.43 1.83 3.1E-08 1.9E-05FSTL1 11425.44 20852.95 0.87 3.4E-08 2.0E-05

MAPK15 985.56 2283.92 1.21 3.7E-08 2.0E-05EFR3B 1392.43 3029.89 1.12 3.7E-08 2.0E-05PBLD 410.19 1179.85 1.52 4.5E-08 2.4E-05

GLCCI1 3202.80 6251.92 0.96 4.4E-08 2.4E-05PPM1E 3298.14 6413.38 0.96 4.7E-08 2.4E-05TMTC1 2903.48 5687.25 0.97 5.8E-08 2.9E-05SOX2 1002.19 2284.82 1.19 6.3E-08 3.0E-05LRIG1 6097.41 11288.81 0.89 6.2E-08 3.0E-05MLC1 33.26 300.37 3.17 6.5E-08 3.1E-05

CITED2 4816.95 9028.34 0.91 6.8E-08 3.1E-05SATB2 5403.41 10031.39 0.89 7.6E-08 3.4E-05GALM 2562.02 5017.05 0.97 1.1E-07 4.7E-05FLI1 104.21 493.41 2.24 1.4E-07 5.8E-05

ST8SIA4 284.92 893.00 1.65 1.4E-07 5.8E-05CPM 287.13 889.39 1.63 1.9E-07 7.6E-05

MIR6087 414.62 77.57 -2.42 2.0E-07 7.9E-05PCDH19 369.17 1044.54 1.50 2.4E-07 9.4E-05

MICB 623.04 1524.42 1.29 2.4E-07 9.4E-0516

SPTBN1 23528.24 40596.42 0.79 2.6E-07 1.0E-04KLF5 2695.06 5135.21 0.93 2.9E-07 1.1E-04

LINC01185 124.17 1.80 -6.10 3.7E-07 1.4E-04CXorf21 99.78 0.00 -Inf 5.0E-07 1.8E-04NFATC2 80.93 407.71 2.33 6.2E-07 2.2E-04CYP4X1 18.85 218.29 3.53 6.6E-07 2.3E-04DACH1 6459.93 11309.56 0.81 7.9E-07 2.7E-04RGMB 2402.38 4511.92 0.91 9.0E-07 3.0E-04DUSP6 108.64 466.35 2.10 1.0E-06 3.4E-04SLC51A 13.30 189.42 3.83 1.1E-06 3.5E-04

HES4 8281.39 4726.60 -0.81 1.6E-06 5.2E-04KHDRBS3 1931.22 3648.68 0.92 1.9E-06 6.1E-04RCBTB2 795.99 1734.59 1.12 2.0E-06 6.2E-04ANGPT2 6.65 149.74 4.49 2.1E-06 6.3E-04YPEL1 545.44 1288.09 1.24 2.4E-06 7.3E-04

CCDC170 22.17 211.98 3.26 3.4E-06 9.9E-04GLA 14038.46 23188.29 0.72 3.4E-06 9.9E-04

HOXA11-AS 3532.06 6191.48 0.81 3.8E-06 1.1E-03EDA 1305.95 2554.53 0.97 3.9E-06 1.1E-03

COX7A2 6923.33 4002.27 -0.79 4.4E-06 1.2E-03C14orf37 467.84 1122.12 1.26 5.0E-06 1.4E-03SLC35D3 442.34 113.65 -1.96 5.4E-06 1.5E-03

ID3 7558.57 4421.71 -0.77 5.5E-06 1.5E-03SPSB4 1341.43 2586.10 0.95 5.7E-06 1.5E-03

ADAM12 45.45 275.12 2.60 6.9E-06 1.8E-03KDM5B 8160.55 13470.80 0.72 6.9E-06 1.8E-03SLC1A4 3461.11 5981.31 0.79 7.1E-06 1.8E-03TGFB2 64.30 322.92 2.33 7.7E-06 2.0E-03IRS1 946.76 1911.39 1.01 8.4E-06 2.1E-03ID2 8844.57 5296.67 -0.74 9.5E-06 2.3E-03

DSTN 9975.36 16153.42 0.70 1.2E-05 2.9E-03GRB10 8551.90 13910.09 0.70 1.2E-05 2.9E-03CRYM 63.19 312.10 2.30 1.3E-05 3.0E-03

SLC8A1 902.42 364.42 -1.31 1.3E-05 3.0E-03PLXND1 2673.99 4632.79 0.79 1.5E-05 3.4E-03

AFF1 4813.63 7995.53 0.73 1.5E-05 3.4E-03DDIT4L 291.57 767.62 1.40 1.6E-05 3.6E-03EMILIN2 1074.25 2080.97 0.95 1.6E-05 3.6E-03UNC5B 6989.85 4184.48 -0.74 1.6E-05 3.6E-03ZBED1 75.39 0.00 -Inf 1.8E-05 3.9E-03ISLR2 9.98 145.23 3.86 1.8E-05 3.9E-03

NRXN3 1182.90 534.00 -1.15 1.8E-05 3.9E-03CDC42BPA 12834.49 20427.20 0.67 1.8E-05 3.9E-03

NFATC4 2042.08 3588.24 0.81 2.3E-05 4.9E-033-Mar 834.79 1662.43 0.99 2.7E-05 5.5E-03UTRN 8248.13 13176.74 0.68 2.7E-05 5.5E-03

SLCO3A1 45.45 254.37 2.48 2.7E-05 5.6E-03SLIT2 24535.98 15636.56 -0.65 2.8E-05 5.7E-03

PLEKHA6 104.21 390.58 1.91 2.9E-05 5.8E-03GSG1L 1.11 87.50 6.30 3.6E-05 7.2E-03KIF26B 485.58 1071.60 1.14 3.9E-05 7.6E-03SOX4 11984.18 18760.26 0.65 3.9E-05 7.6E-03

CDK14 1763.81 3102.05 0.81 3.9E-05 7.6E-03

17

ZNF141 0.00 74.87 Inf 4.2E-05 7.9E-03BFSP1 393.56 913.75 1.22 4.2E-05 7.9E-03

COMTD1 3421.20 1974.53 -0.79 4.2E-05 7.9E-03CITED1 1431.23 2577.08 0.85 4.3E-05 8.0E-03GPX4 21846.47 33726.61 0.63 4.3E-05 8.0E-03VIM 38543.39 59086.07 0.62 4.5E-05 8.3E-03

EMP3 1139.66 2107.12 0.89 5.1E-05 9.4E-03COL12A1 104.21 377.95 1.86 5.4E-05 9.7E-03PPM1H 2613.02 4358.57 0.74 6.2E-05 1.1E-02CLEC2D 2044.30 3487.22 0.77 6.4E-05 1.1E-02GSTM3 2880.19 4753.66 0.72 6.8E-05 1.2E-02DNAI1 6.65 116.36 4.13 7.0E-05 1.2E-02CRAT 2801.48 4626.47 0.72 7.2E-05 1.2E-02

LOC646762 1640.76 2854.90 0.80 7.4E-05 1.3E-02EGFLAM 164.08 487.09 1.57 8.0E-05 1.4E-02

HIST1H1C 1176.25 2132.38 0.86 8.1E-05 1.4E-02FUT8 2677.32 4410.89 0.72 8.8E-05 1.5E-02

PRKCA 4588.58 7285.63 0.67 8.9E-05 1.5E-02ZNF704 3342.49 5409.43 0.69 9.1E-05 1.5E-02

NXN 7526.42 11670.36 0.63 9.5E-05 1.6E-02PDE3B 3475.52 5592.54 0.69 1.0E-04 1.6E-02

DCAF15 6934.42 10765.64 0.63 1.0E-04 1.6E-02NT5E 21.06 165.97 2.98 1.1E-04 1.7E-02

TRAF5 1146.31 2066.53 0.85 1.1E-04 1.7E-02PLS3 97102.92 64949.21 -0.58 1.1E-04 1.7E-02CTSB 7165.01 11085.85 0.63 1.1E-04 1.7E-02FMO5 84.26 319.32 1.92 1.2E-04 1.9E-02

ZSCAN31 274.94 673.81 1.29 1.2E-04 1.9E-02ROBO1 20038.31 13215.53 -0.60 1.2E-04 1.9E-02RNF125 2427.88 3989.64 0.72 1.3E-04 1.9E-02

LOX 994.43 1813.97 0.87 1.4E-04 2.1E-02TMCO3 3340.27 5335.46 0.68 1.4E-04 2.1E-02

CHCHD10 2679.53 1565.91 -0.77 1.4E-04 2.1E-02MAP7D3 8038.60 12276.52 0.61 1.5E-04 2.3E-02CAMKK1 4648.44 2887.37 -0.69 1.5E-04 2.3E-02

GLRX 894.66 1652.50 0.89 1.6E-04 2.3E-02SGK1 616.39 1218.63 0.98 1.7E-04 2.4E-02

SLC10A4 136.36 416.73 1.61 1.7E-04 2.4E-02SLC25A35 611.96 1210.51 0.98 1.7E-04 2.4E-02COL15A1 4.43 96.52 4.44 1.7E-04 2.5E-02

NEFM 21289.94 14198.73 -0.58 1.8E-04 2.5E-02LOC101927272 59.87 0.00 -Inf 1.8E-04 2.5E-02

RGS7BP 59.87 0.00 -Inf 1.8E-04 2.5E-02MAP1B 10230.35 15439.01 0.59 1.8E-04 2.5E-02ITGA4 834.79 1552.38 0.89 1.8E-04 2.5E-02

SMARCA2 3927.84 6152.69 0.65 2.0E-04 2.6E-02EDNRB 385.80 841.59 1.13 2.0E-04 2.7E-02TGFBR3 3644.03 5725.14 0.65 2.1E-04 2.7E-02STK26 11234.76 16862.40 0.59 2.1E-04 2.7E-02

CASC10 936.78 1698.51 0.86 2.2E-04 2.9E-02FOXN4 463.40 961.56 1.05 2.3E-04 3.0E-02RAB31 4035.38 6278.08 0.64 2.3E-04 3.0E-02

TTC21A 191.79 508.74 1.41 2.4E-04 3.2E-02

18

RGMA 4576.38 2884.67 -0.67 2.5E-04 3.2E-02CCND1 3594.15 2221.68 -0.69 2.7E-04 3.4E-02PLXNC1 213.96 543.92 1.35 2.8E-04 3.5E-02

KAZALD1 649.65 1243.89 0.94 2.8E-04 3.6E-02NQO1 819.27 1501.87 0.87 2.9E-04 3.7E-02

ALCAM 10187.11 15166.60 0.57 3.0E-04 3.7E-02CCDC85B 5744.87 3705.51 -0.63 3.1E-04 3.8E-02

TRIM24 9044.12 13479.82 0.58 3.2E-04 4.0E-02TNFRSF19 668.50 1265.54 0.92 3.3E-04 4.0E-02

DFNB31 2384.64 3806.53 0.67 3.4E-04 4.1E-02VCAN 6295.85 4096.08 -0.62 3.4E-04 4.1E-02

CACNA1F 2.22 77.57 5.13 3.5E-04 4.2E-02DLX1 3339.16 2069.24 -0.69 3.5E-04 4.2E-02

RASGRP3 23.28 156.95 2.75 3.6E-04 4.3E-02PDLIM1 7897.81 5213.69 -0.60 3.6E-04 4.3E-02CCNO 751.64 1384.60 0.88 3.8E-04 4.4E-02

ARHGEF17 1213.94 2074.65 0.77 3.8E-04 4.5E-02MOXD1 3568.65 2236.11 -0.67 4.0E-04 4.6E-02

TNC 103.10 331.94 1.69 4.3E-04 4.9E-02FAM84B 7835.73 5201.06 -0.59 4.4E-04 5.0E-02THAP6 1729.45 988.62 -0.81 4.4E-04 5.0E-02KLHL7 3464.44 5333.66 0.62 4.4E-04 5.0E-02LZTFL1 3953.34 6028.21 0.61 4.7E-04 5.3E-02HECTD4 9034.14 13319.26 0.56 4.7E-04 5.3E-02LONRF3 1284.89 2159.44 0.75 5.0E-04 5.5E-02LURAP1L 148.56 412.22 1.47 5.1E-04 5.7E-02

TRAF3 7147.27 10584.33 0.57 5.2E-04 5.7E-02HOXA13 2338.08 3683.86 0.66 5.2E-04 5.8E-02BARX2 751.64 1364.76 0.86 5.3E-04 5.8E-02TREM1 0.00 55.93 Inf 5.7E-04 6.1E-02DACT1 1445.64 2384.04 0.72 5.6E-04 6.1E-02DCAF6 3951.12 5989.43 0.60 5.6E-04 6.1E-02IER5 8766.97 12863.74 0.55 5.7E-04 6.1E-02

DEPDC7 1184.01 1995.27 0.75 6.1E-04 6.5E-02RBP1 514.40 996.73 0.95 6.3E-04 6.7E-02JUND 3573.08 2278.51 -0.65 6.3E-04 6.7E-02

THUMPD3 9793.55 6641.59 -0.56 6.4E-04 6.8E-02DUSP4 463.40 916.45 0.98 6.6E-04 6.9E-02LRRC10 51.00 0.00 -Inf 6.7E-04 7.0E-02CRIM1 2955.58 4535.37 0.62 6.8E-04 7.0E-02TKTL2 107.54 10.82 -3.31 7.2E-04 7.4E-02DDIT4 11617.23 7954.93 -0.55 7.3E-04 7.5E-02LIMA1 4073.07 6097.67 0.58 7.9E-04 8.1E-02

TP53INP1 1013.28 1725.57 0.77 8.0E-04 8.2E-02NGLY1 5829.12 8573.72 0.56 8.2E-04 8.3E-02CDR2 4412.31 6561.31 0.57 8.6E-04 8.6E-02

ATP8B3 57.65 226.41 1.97 8.6E-04 8.6E-02LRRC28 1056.51 1778.79 0.75 9.2E-04 9.2E-02PIK3IP1 203.99 490.70 1.27 9.5E-04 9.4E-02MSRB3 2003.28 3132.72 0.65 9.6E-04 9.4E-02

CACNG4 42.13 189.42 2.17 1.0E-03 1.0E-01Abbreviations: Inf, infinite.

19

Supplementary Table S5. List of primers.

Name Template F/R Sequences (5' - 3')

MYB-PLEKHO1

genomic DNA 1forward GTTTCCTGTTTGGGAGAACACCAC

reverse CTCTCAGCACAAGAGGTTGGTT

genomic DNA 2forward GTTTGGGAGAACACCACTCCACT

reverse CAACCCGAAAGCTCTCAGCAC

cDNAforward CACACCAGACCTCATGGAGA

reverse CCGAAAGCTCTCAGCACAAG

MYB-ZFAT

genomic DNAforward CATTGCCGACCACACCAGAC

reverse CAAATTGGTGACTACGTGGAGAG

cDNAforward ACCACACCAGACCTCATGGA

reverse TCTCTGAAGCGGCACTACAAC

MYB-DCPS

genomic DNAforward CTGTTTCCTGTTTGGGAGAACAC

reverse CATCATCAGTGGGCTCAAGG

cDNAforward CACACCAGACCTCATGGAGAC

reverse TAGTCATCTCCCGTCTCTCGG

20