Marshall UniversityMarshall Digital Scholar

Theses, Dissertations and Capstones

1-1-2005

Mechanisms of Growth Hormone Enhancementof Excitatory Synaptic Transmission inHippocampusGhada Saad Zaglool Ahmed Mahmoud

Follow this and additional works at: http://mds.marshall.edu/etdPart of the Biochemical Phenomena, Metabolism, and Nutrition Commons, and the Biological

Phenomena, Cell Phenomena, and Immunity Commons

This Dissertation is brought to you for free and open access by Marshall Digital Scholar. It has been accepted for inclusion in Theses, Dissertations andCapstones by an authorized administrator of Marshall Digital Scholar. For more information, please contact zhangj@marshall.edu.

Recommended CitationMahmoud, Ghada Saad Zaglool Ahmed, "Mechanisms of Growth Hormone Enhancement of Excitatory Synaptic Transmission inHippocampus" (2005). Theses, Dissertations and Capstones. Paper 718.

MECHANISMS OF GROWTH HORMONE ENHANCEMENT OF EXCITATORY SYNAPTIC TRANSMISSION IN HIPPOCAMPUS

By Ghada Saad Zaglool Ahmed Mahmoud

Dissertation submitted to

The Graduate College Of

Marshall University In partial fulfillment of the requirements

For the degree of

Doctor of Philosophy In

Biomedical Sciences

Approved by Lawrence M. Grover, Ph.D., Committee Chairperson

Beverly C. Delidow, Ph.D. Todd L. Green, Ph.D.

William D. McCumbee, Ph.D. Gary L. Wright, Ph.D.

Department of Physiology,

Marshall University, Joan C. Edwards School of Medicine Huntington, West Virginia, USA

Spring 2005

ABSTRACT

Growth hormone (GH) deficiency is associated with impaired learning and

memory. One possible target for GH effects on memory is the hippocampus, a

brain region containing GH receptors (GHRs). To determine if GH acutely alters

hippocampal function, recombinant human GH (rhGH) was applied to in vitro rat

hippocampal brain slices. Extracellular recordings were used to assess effects of

GH on the field EPSP (fEPSP) and long-term potentiation (LTP) of the fEPSP.

GHR expression was measured in GH-treated and control rat hippocampal slices

using RT-PCR. The GH signaling pathway was investigated by studying the

effect of GH on the fEPSP after block of Janus kinase (JAK) by tyrphostin AG

490, phosphoinositide-3-kinase (PI3-kinase) by wortmanin, and mitogen-

activated/extracellular response protein kinase kinase (MEK) by U0126. To

determine if protein synthesis is required, hippocampal slices were perfused with

cycloheximide, a protein synthesis inhibitor. I examined the effects of GH on

pharmacologically isolated N-methyl-D-aspartate receptor (NMDAR)-and α-

amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (AMPAR)-mediated

fEPSPs. Using western blotting, total and phosphorylated STAT5A/B, and

NMDAR subunits NR1, NR2A, and NR2B were measured in GH-treated and

control slices.

GH caused a gradual (2 hr) increase in fEPSP amplitude during

application that was maintained for more than 4 hours. Prior GH treatment (3hr)

prevented additional potentiation by tetanus (100Hz, 1s), indicating that similar

mechanisms contribute to both. GH caused equivalent enhancement of isolated

ii

NMDAR-fEPSPs and dual component fEPSP, indicating that GH effects are

mediated in part by NMDARs. GH enhancement of fEPSPs was blocked by

inhibitors of protein synthesis, JAK, PI3-kinase, and MEK, implicating all of these

signaling mechanisms in GH enhancement of synaptic transmission. In vitro GH

treatment of hippocampal brain slices for 15-30 min failed to alter either total or

phosphorylated STAT 5a/b. In vitro GH treatment of hippocampal brain slices

(3 hr) increased GHR mRNA, decreased NR2B protein, and increased

NR2A/NR2B ratio. My results clearly demonstrate a previously unknown role for

GH as a short-term modulator of hippocampal synaptic function.

iii

DEDICATION

To my loving dearest Husband and kids for their constant

encouragement and support

In memory of my loving dearest father

Mr. Saad Zaglool A. Mahmoud

To my loving dearest mother

To my loving dearest brother Mr. Ahmed and his family

To my loving dearest sisters and their families

iv

ACKNOWLEDGEMENTS

First and foremost, I want to thank ALLAH, the God, for giving me the

ability and fortitude over the course of this work.

I would like to express my sincere gratitude to Dr. Lawrence M. Grover,

my advisor, who taught me not only how to do scientific research, but also how to

develop independent analytical thinking. His guidance and encouragement

constantly helped me to achieve my goals throughout my doctoral work. I would

like also to show my great thanks to the members of my committee: Dr Gary

Wright, Dr. Todd Green, Dr. William McCumbee and Dr. Beverly Delidow for their

continual support, encouragement, and valuable input during my doctoral

studies. Special thanks are to Dr. Green who kindly taught me and supervised

me in conducting the Western blotting and PCR techniques in his laboratory. I

am very thankful to Dr. Grover for teaching me all the electrophysiology

techniques and for his advice in preparing the electrophysiological protocols. I

would like to extend my thanks to all the faculty and staff in the Department of

Physiology at Marshall University – Joan C. Edwards School of Medicine for their

kind assistance.

v

TABLE OF CONTENTS

ABSTRACT....…………………………………………..…………..………………... ii

DEDICATION …………………………………………………………………...……. iv

ACKNOWLEDGEMENTS.………...…………...………………….…………...……..v

LIST OF FIGURES.…...………………………………..……………………....…... viii

LIST OF ABBREVIATIONS/SYMBOLS …….…………….………….…………… x

INTRODUCTION.…...….………………………………………………..……………. 1

Neural growth hormone………………………………..............................................2

Therapeutic applications of growth hormone ............................................................6

Growth hormone and memory function …………….............................................9

LTP is a model system for mechanisms of memory …………......................... 10

Glutamate receptors ……………………………..…............................................ 11

GluRs, LTP, and memory …………………………..…..........................................12

SECTION 1

GH Enhances Excitatory Synaptic Transmission in Area CA1 of Rat

Hippocampus ..….. 15

INTRODUCTION …………………………………………………………………….. 16

MATERIALS AND METHODS..…..………………………………………………… 21

RESULTS ………..…………………………………………………………………… 29

DISCUSSION..…..…………………………………………………………………… 38

vi

SECTION 2

Growth Hormone Signaling Pathways in Area CA1 of Rat Hippocampus . 42

INTRODUCTION .……………………………………………….……………………43

MATERIALS AND METHODS .……….………………….………………………….54

RESULTS …………..………………………………………………………………… 58

DISCUSSION .…….……………………….………………………………………… 77

CHAPTER 3

NMDA Receptor-Mediated Effects of Growth Hormone…..…………………. 89

INTRODUCTION ….……………………………………………….………… 90

MATERIALS AND METHODS ….…………………………..……………… 98

RESULTS…...…………………………………………………………..……101

DISCUSSION…...………………………………………………………...... 108

CONCLUSIONS …………….……………………………………………..………. 115

REFERENCES ……………………………………………………………..............118

vii

LIST OF FIGURES

FIGURE 1. Control of GH secretion…………………………………………...…. …2

FIGURE 2. Variations in human GH secretion throughout the day…………...…..3

FIGURE 3. Preparation of rat hippocampal slices………………………….....…..22

FIGURE 4. The interface holding chamber….……..…….…….…....…..……….. 23

FIGURE 5. The recording chamber……..…………...….……...…………………..25

FIGURE 6. Schematic illustration of hippocampal synaptic organization…....... 26

FIGURE 7. GH Enhanced Excitatory Synaptic Transmission in Area CA1 of Rat

Hippocampus……………………………..…….…………………….. 31

FIGURE 8. GH did not alter the paired-pulse facilitation (PPF) ratio…..…..….. 34

FIGURE 9. GH pretreatment prevented LTP in area CA1 of rat hippocampus.. 36

FIGURE 10. GH treatment of in vitro hippocampal brain slices increased the

expression of GHR mRNA…..…………………………….………....61

FIGURE 11. GH treatment of in vitro hippocampal brain slices did not affect

protein levels of either total or phospho-STAT5a/b………………..63

FIGURE 12. GH-induced potentiation of the fEPSP was blocked by inhibition of

PI3 kinase, MAPK kinase and JAK2 tyrosine kinase………….......65

FIGURE 13. PI3-kinase and MAPK kinase inhibitors had no effect on the

maintained expression of GH enhancement of fEPSPs ……….....68

FIGURE 14. Protein synthesis was required for the induction of GH

enhancement of synaptic transmission …...…………………..…....71

FIGURE 15. Protein synthesis was not required for maintained enhancement of

EPSPs by GH…………..……..…………………………….………....74

viii

FIGURE 16. Diagrammatic illustration of the proposed signaling pathway for GH

in the hippocampus……………...……………………...………….....85

FIGURE 17. GH enhanced isolated NMDAR-mediated fEPSPs (fEPSPNs)...103

FIGURE 18. GH enhanced isolated AMPAR-mediated fEPSPs (fEPSPAs).…104

FIGURE 19. Summary comparison of effects of GH alone, GH+DNQX+BMI,

GH+AP5 and control ACSF………………………...…………........105

FIGURE 20. GH decreased NR2B, but not NR1 or NR2A protein ……….……106

FIGURE 21. Diagrammatic illustration of the proposed mechanism of interaction

between GH, PI3-kinase, MAPK, and NMDARs ……….………...110

FIGURE 22. Model representing the relative contribution of AMPARs and

NMDARs to LTP as function of degree of NMDARs activation....113

ix

LIST OF ABBREVIATION/SYMBOLS

AIDS Acquired immune deficiency syndrome

Akt Protein kinase activated by PDK

AMPAR Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor

APV or AP5 5-Amino-phosphovaleric acid or 5-amino-phosphopentanoic acid

BA Bone age

BDNF Brain derived neurotrophic factor

BMI Bicuculline methiodide

CA1 Cornu Ammonis 1 of the hippocampus

CaMKII Ca2+- calmodulin-dependent protein kinase II

cAMP Cyclic adenosine monophosphate

CSF Cerebro-spinal fluid

DNQX 6,7-Dinitroquinoxalline-2,3-dione

dNTPs Deoxy-nucleotide-triphophate

DTT Dithiothreitol

ECL Enhanced chemiluminescnce

Elk-1 Transcription factor that recognizes serum response element (SRE)

E-LTP Early long term potentiation

EPSC Excitatory post synaptic current

EPSP Excitatory post synaptic potential

x

ERK Extra-cellular signal regulated kinase

ERP Event related potential

fEPSP Field excitatory postsynaptic potential

fEPSPAs AMPAR-mediated fEPSPs

fEPSPNs NMDAR-mediated fEPSPs

GH Growth hormone

GHBP Growth hormone binding protein

GHD Growth hormone deficiency

GHRs Growth hormone receptors

GHRH Growth Hormone releasing hormone

GHRP-2 Growth hormone-releasing peptide-2

GluRs Glutamate receptors

GHRT Growth hormone replacement therapy

Grb2 Growth factor receptor binding protein-2 (Src Homology-2-containing

protein associated with SOS)

HD Head circumference

HFS High frequency stimulation

HIV Human-Immunodeficiency-Virus

HRP Horseradish peroxidase

5-HT 5 Hydroxy tryptamine

IGF-I Insulin-like growth factor-I

IRS Insulin receptor substrate

xi

ISS Idiopathic short stature

JAK-2 Janus kinase-2 non-receptor protein tyrosine kinase

KP-102 D-alanyl-3-(2-naphthyl)-D-alanyl-L-alanyl-L-tryptophyl-D-phenylalany-

L-lysinamide dihydrochloride

LFS Low frequency stimulation

L-LTP Long-lasting long term potentiation

LTP Long term potentiation

LTD Long term depression

MAPK Mitogen activated protein kinase

MEK Mitogen activated protein kinase kinase

MEK-I Mitogen activated protein kinase-kinase inhibitor

NF1 Neurofibromin-1

NMDARs N-methyl-D-aspartate receptors

NT-3 Neurotrophic factor-3

NSE Neuron specific enolase

PCR Polymerase chain reaction

P300 ERP P300 event-related potential

PDK-1 Phosphoinositide-3-kinase-dependent kinase-1

PKCζ Atypical protein kinase C isoform ζ

PI3-K Phosphoinositide-3-kinase

PPF Paired pulse facilitation

PSD 95 Post synaptic density protein of 95 kD

xii

PWS Prader-Willi syndrome

QoL Quality of life

Raf Protein serine/ threonine kinase that activates MEK

Ras Rat sarcoma virus oncogene, member of GTP binding protein family

activated by SOS

rhGH Recombinant human growth hormone

SBS Short bowel syndrome

SGA Small for gestational age

SH2 Src homology 2 domain

SOCS Suppressors of cytokine signaling

SOS Son-of-sevenless, guanine nucleotide exchange factor leading to

activation of Ras

Sp-cAMPS Membrane-permeable analog of cyclic AMP

STAT Signal transducer and activator of transcription

TGM Transgenic mice over-expressing growth hormone

TPS Theta pulse stimulation

TS Turner syndrome

TTS Tris Tween Saline

Tyr AG490 [Tyrphostin B42] [N-Benzyl-3,4-dihydroxy-

benzylidenecyanoacetamide]

U-0126 [1, 4-Diamino-2,3-dicyano-1,4-bis(2-aminopheylthyo)-butadiene]

WORT Wortmanin

xiii

INTRODUCTION

11

Neural growth hormone

Growth hormone (GH) is a polypeptide hormone formed of 191 amino

acids in a single chain (Corpas et al., 1993). It is secreted mainly by the

somatotropic cells of the anterior pituitary gland under the control of two main

factors secreted from the hypothalamus, GH releasing hormone (GHRH) and GH

inhibiting hormone or somatostatin (Corpas et al., 1993; Tannenbaum, 1990;

Vance et al., 1985; Reichlin, 1983). GH secretion is pulsatile (Wajnrajch, 2005;

Vance et al., 1985). GH secretion is increased during deep sleep ((Wajnrajch,

2005), by exercise (Berg and Bang, 2004), during starvation (Tanaka et al.,

2004). GH secretion is decreased during aging, and by obesity (Iranmanesh et

al., 1991).

Figure 1. Control of GH secretion. GH is secreted under the control of GHRH

and GH inhibiting hormone or somatostatin. GH secretion has a feed back

regulatory effect on the hypothalamus, inhibiting the secretion of GHRH and

increasing the secretion of somatostatin. The main stimuli increasing GH

secretion are deep sleep and exercise.

22

8am 12 4pm 8pm 12 4am 8amNoon Midnight

Hum

an p

lasm

a G

H n

g/m

l

0

10

20

30

Strenuous exercise

Sleep

Figure 2. Variations in human GH secretion throughout the day.

Major pulses of GH secretion occur in response to strenuous exercise

and deep sleep. The secretory profile for GH in rats is also pulsatile, ranging up

to several hundred ng/ml.

33

It has recently become well established that GH gene expression is not

restricted to the pituitary gland but also occurs in many extra-pituitary tissues

including both the central and peripheral nervous system (Harvey and Hull,

2003). GH immunoreactivity is detected in the brains of human embryos at 8

weeks of development, before its appearance in the pituitary at the end of the

first trimester (Costa et al., 1993). On the tenth day of the 22 days gestational

period, GH starts to appear in rat brain: two days before its appearance in the

pituitary gland (Hojvat et al., 1982). GH is found in the midbrain, hippocampus,

cortex, striatum, olfactory bulb and cerebellum, at higher concentration in female

rats compared to male rats (Mustafa et al., 1994b). In the chicken high GH levels

are detected in the spinal cord as early as the second day of embryonic

development, before its appearance in the pituitary at mid-late incubation

(Harvey and Hull, 2003).

GH is present in hypothalamic as well as extra-hypothalamic areas of

chicken brain (Render et al., 1995). GH immunoreactivity has been detected in

the spinal cord, hippocampus, hypothalamus, otic and optic vesicles of chicken

embryonic brain (Murphy and Harvey, 2001). GH immunoreactivity has been

detected in the peripheral nervous system of chick embryos, particularly in the

trigeminal and vagal nerves (Murphy and Harvey, 2001). GH immunoreactivity

has also been detected in the hippocampus, periventricular, paraventricular,

inferior and infundibular hypothalamic nuclei, in the medial and lateral septal

44

area, and in the median eminence of turkey brain and ringdove brain (Ramesh et

al., 2000).

Cerebrospinal GH could reflect either GH synthesized in the CNS or

sequestration of GH from systemic circulation (Harvey and Hull, 2003). In support

of the first hypothesis, trace amounts of GH have been detected in serum

following hypophysectomy (Lazarus and Scanes, 1988). Also the presence of

higher concentration of GH in the hypothalamic hypophyseal blood compared to

the peripheral blood indicates central secretion of GH into the systemic

circulation (Paradisi et al., 1993).

The abundance and wide spread presence of GHRs in the brain supports

the possibility that neural tissues are target sites for GH action (Harvey et al.,

1993). Hippocampal GHRs have been identified in both humans and rats (Lai et

al., 1993; Zhai et al., 1994). Recently the GHR cDNA nucleotide sequence has

been described in rat hippocampus (Thornwall et al., 2001).

Cerebrospinal fluid (CSF) levels of GH are much lower compared to that

of the systemic circulation, reflecting the poor permeability of cerebral

microvessels (Prahalada et al., 1999). Cerebrovascular permeability is greatest

during fetal development and decreases with age (Mustafa et al., 1995).

Increased cerebrovascular permeability after CNS injury leads to rapid

upregulation of GHRs in the endothelium of cerebral blood vessels (Scheepens

et al., 1999), suggesting the possibility of receptor mediated sequestration of GH

55

from the systemic circulation (Harvey and Hull, 2003). GHRs are also abundant

in choroid plexus, supporting the peripheral origin of CSF GH (Harvey and Hull,

2003). CSF GH level is increased following its peripheral administration in

humans (Nyberg and Burman, 1996), with a dose-dependent increase in CSF

GH concentration in patients who received s.c. injections of GH (Burman et al.,

1996). Peripheral origin of central GH is also supported by the higher CSF level

of GH in patients suffering from acromegaly (Schaub et al., 1977). Additional

support for the peripheral origin of central GH is seen in the correlated decline in

CSF and plasma GH levels with age (Heinze et al., 1998).

Therapeutic applications of growth hormone

Growth hormone (GH) is considered a successful therapeutic drug for

children and adults with GH deficiency, as well as for growth retardation due to

chronic renal disease, Turner syndrome, and in children born small for

gestational age (Kappelgaard et al., 2004). Short children born small for

gestational age (SGA) have reduced serum leptin levels which are inversely

correlated with their chronological age (Boguszewski et al., 1997). Serum leptin

levels correlate with the growth response to GH treatment and may be used as a

marker for predicting the growth response to GH treatment (Boguszewski et al.,

1997). Hyperlipidemia, diabetes mellitus type 2, and coronary heart disease are

commonly associated with being born SGA (Pareren et al., 2003). GH treatment

has a positive effect for up to 6 years on body composition, blood pressure (BP),

and lipid metabolism (Sas et al., 2000). Therefore, GH treatment might

66

counteract the reported higher risk of cardiovascular diseases in later life for

children born SGA (Sas et al., 2000).

It is well established that GH therapy has beneficial effects on statural

growth in children (Darendeliler et al., 2005). High dose GH therapy starting

before puberty accelerates bone age and induces an earlier onset of puberty

(Kamp et al., 2002). In short children born SGA, three years of GH treatment

normalized their height during childhood and increased bone maturation

proportionately to the height gain (Arends et al., 2003). Thus, it is better to start

GH treatment at an early age in order to achieve a normal height before puberty

starts (Arends et al., 2003). Serious GH deficiency and short stature can be

treated by KP-102 (D-alanyl-3-(2-naphthyl)-D-alanyl-L-alanyl-L-tryptophyl-D-

phenylalanyl-L-lysinamide dihydrochloride, growth hormone-releasing peptide-2,

GHRP-2), which potently promotes growth hormone (GH) release by acting at

both hypothalamic and pituitary sites (Furuta et al., 2004). There are dose-

dependent increases in final height in children with idiopathic short stature

treated with GH (Wit et al., 2005).

One year of GH treatment in pre-pubertal children with idiopathic GH

deficiency (GHD), Turner syndrome (TS) or idiopathic short stature (ISS), and

short pre-pubertal children born SGA, normalized progression of bone age (BA)

(Darendeliler et al., 2005). GH treatment for three years induced proportionate

growth resulting in a normalization of height and other anthropometric

77

measurements, including head circumference, in contrast to untreated SGA

control subjects (Arends et al., 2004). Lowered intelligence, poor academic

performance, low social competence, and behavioral problems are also

associated with being born SGA (Pareren et al., 2003). In adolescents born SGA,

GH therapy produced marked improvement over time in behavior and self-

perception parallel to GH-induced catch-up growth (Pareren et al., 2004).

Prader-Willi syndrome (PWS) is a genetic disease that is caused by an

alteration in the molecular composition of a critical region of chromosome 15

(Whitman et al., 2002). PWS is characterized by obesity, hyperphagia, hypotonia,

short stature, hypogonadism, and a neurobehavioral profile that includes

cognitive deficits, learning problems, and behavioral difficulties that increase in

both quantity and severity over time (Whitman et al., 2002). In addition to

hyperphagia, which has proven refractory to all psychopharmocologic

intervention, decreased energy expenditure and reduced physical activity often

lead to morbid obesity in patients with PWS (Whitman et al., 2002). GH treatment

produced significant reduction of depressive symptoms and improvements in

physical parameters in children over 11 years old with PWS (Whitman et al.,

2002).

Human growth hormone has become a popular ergogenic aid, improving

exercise performance among athletes (Stacy et al., 2004). GH has

supraphysiologic effects leading to lipolysis, with increased muscle volume

88

(Stacy et al., 2004). In addition, GH is considered an anti-aging drug and has

improved athletic performance in isolated studies (reviewed in Stacy et al., 2004).

Both recombinant human growth hormone (rhGH) and insulin-like growth

factor-I (IGF-I), have been considered beneficial for diseases associated with

increased catabolism such as acquired immune deficiency syndrome (AIDS)

(Laurence, 1995). It has now been confirmed that GH as well as IGF-I produce

increases in body weight, lean body mass, and sense of well-being among HIV+

individuals because of their ability to promote nitrogen retention, protein

synthesis, and lipolysis (Laurence, 1995). GH also augments cellular immune

function and modulates T lymphocyte trafficking in animal models of immune

suppression, suggesting benefit for any immune suppressive disorders, including

HIV infection (Laurence, 1995).

Growth hormone and memory function

Recent studies have shown that GH affects many functions of the central

nervous system, with beneficial effects on memory, alertness and motivation

(Fargo et al., 2002). GH deficiency (GHD) has well known detrimental effects on

cognition and memory in humans. General fatigue, lack of concentration,

memory disabilities and a diminished subjective sense of wellbeing are all

problems detected in untreated adult GHD patients (Bjork et al., 1989; McGauley

et al., 1990). Sleep disturbances and psychologically immaturity are problems of

young GHD patients (Hayashi et al., 1992). Animal studies support these human

99

observations. In a passive avoidance task in young rats (3 months old), GH

administration facilitated long-term memory and delayed extinction (Schneider-

Rivas et al., 1995). In this study, old rats (24 months old) did not benefit from GH

treatment. However, in other studies using a different learning task, the Morris

water maze, learning in old rats was improved by treatment with GHRH

(Thornton et al., 2000) or GH itself (Ramsey et al., 2004).

Long Term Potentiation (LTP) is a Model System for Mechanisms of

Memory

Physiologically, memories are caused by changes in the strength of

synaptic transmission between neurons resulting in the formation of new

pathways or facilitated pathways for transmission of nerve signals following

previous neural activity (Guyton and Hall, 2000). Long term potentiation (LTP) is

a long-lasting increase in the strength of synaptic transmission between nerve

cells, induced in response to high frequency afferent stimulation (Bliss and Lomo,

1973). LTP has been most extensively studied in the hippocampus, a brain

region known to be involved in memory functions (Bliss and Collingridge, 1993).

LTP is considered the best available model for studying the synaptic

modifications that underlie memory formation and storage (Bliss and

Collingridge, 1993), and for this reason interest in LTP has steadily increased.

A novel form of synaptic plasticity, homosynaptic long-term depression

(LTD), has also recently been documented. LTD, like LTP, requires Ca2+ entry

1010

through NMDARs (Bear and Malenka, 1994). Recent studies suggest that LTD

and LTP are functionally inverse processes, and that the mechanisms of LTP

and LTD may converge at the level of specific phosphoproteins (Bear and

Malenka, 1994). Although the induction of both LTD and LTP require Ca2+ influx,

a stronger depolarization and a greater increase in [Ca2+]i are required to induce

LTP than to initiate LTD (Artola and Singer, 1993).

Glutamate receptors (GluRs)

Glutamate is the major excitatory neurotransmitter in the central nervous

system, and GluRs are widely expressed throughout all major division of the

central nervous system (McBain and Mayer, 1994). Ionotropic GluRs are

classified into three major classes: alpha-amino-3-hydroxy-5-methyl-4-isoxazole

proprionate (AMPA), kainate and N-methyl-D-aspartate (NMDA), based on their

electrophysiological and pharmacological properties (McBain and Mayer, 1994).

Although the first recognized glutamate receptors were ligand-gated ion

channels, a large number of G protein-coupled GluRs are also expressed

throughout the CNS (Nakanishi, 1992).

N-methyl-D-aspartate receptors (NMDARs) are selectively activated by

NMDA, a synthetic analogue of aspartic acid, which does not occur naturally in

the brain (Watkins and Evans, 1981). The NMDAR response to NMDA is potently

blocked by aminophosphovalerate (AP5) (McBain and Mayer, 1994). Responses

at NMDARs are strongly voltage-dependent and show high Ca2+ permeability

1111

(McBain and Mayer, 1994). The AMPA/ kainate subtypes of GluRs are also

ligand-gated ion channels for which AMPA and kainate act, respectively, as

preferential agonists. Both AMPA and kainate responses are blocked by a

related set of quinoxaline diones (CNQX, DNQX, NBQX), but not by AP5

(McBain and Mayer, 1994). Non NMDARs (AMPA and kainate receptors) in

general have only weak voltage dependence and low Ca2+ permeability (McBain

and Mayer, 1994).

Four genes (GluR A-D/GluR1-4) code for the AMPA glutamate receptor

subunits (Schoepfer et al., 1994). NMDARs are formed by coexpression of the

NR1 and one or more members of the NR2 family (NR2A-D) of genes (Schoepfer

et al., 1994). The NR1 subunit is expressed throughout the brain and serves as a

general partner for association with NR2 subunits (Monyer et al., 1992). The

kinetic and pharmacological properties of NMDARs are dependent on the

specific NR2 subunit expressed (Schoepfer et al., 1994).

GluRs, LTP, and memory

GH affects expression of NMDARs, which are required for normal memory

function (Le Greves et al., 2002). Insertion of new GluRs into the postsynaptic

membrane (Nayak et al., 1998; Shi et al., 1999) and the phosphorylation of the

existing GluRs (Soderling and Derkach, 2000) are putative mechanisms

underlying memory formation. NMDARs have an important role in synaptic

plasticity, synaptogenesis, and excitotoxicity (Mallon et al., 2004). In cultured

1212

neurons, insertion of GluR1-containing AMPARs into neuron membranes was

induced by NMDAR activation, highlighting the role of NMDARs in synaptic

plasticity (Passafaro et al., 2001).

These findings demonstrate a mechanistic long-term relationship between

GH, memory function, NMDARs and LTP. Although the beneficial therapeutic

effects of GH on memory and cognition are well known, the underlying synaptic

mechanisms and their relation to GluRs in general and NMDARs in particular, as

well as the GH signaling pathway, have not been well investigated in the

hippocampus, or for that matter, any other brain region. The purpose of my

dissertation is to investigate possible short term effects of GH on synaptic

transmission in the CA1 area of rat hippocampus, and the mechanisms

underlying those effects. In assessing the potential role of GH as a short-term

regulator of hippocampal function, I addressed three related questions.

First, does GH alter synaptic function in hippocampal area CA1, and if so, how?

To answer this question I applied GH to rat hippocampal brain slices and

examined excitatory synaptic transmission for any GH-induced changes. A

paired-pulse stimulation protocol was used to determine whether any change in

synaptic strength was accompanied by an alteration in the presynaptic release of

glutamate. I also examined the effect of brief tetanization (100 Hz, 1 s) following

3 hr of GH pretreatment, to determine if both GH and brief tetanus act through

common mechamisms to regulate hippocampal synaptic transmission. The first

section of my dissertation includes these experiments.

1313

Second, what signaling pathway(s) are responsible for short-term effects of GH

on hippocampal synaptic function, and is synthesis of new proteins required for

these effects? I hypothesized that GHR signaling in hippocampus would use

signaling pathways previously described in other tissues. This hypothesis was

tested by examining the effects of pharmacological inhibition of specific

components of the hypothesized hippocampal GHR signaling pathway. These

experiments form the basis of the second section of my dissertation.

Third, I asked whether GH effects on hippocampal synaptic function are

mediated by NMDARs or AMPARs. I also asked if short-term treatment with GH

has similar consequences on NMDAR expression as long-term, chronic

treatment with GH. To answer the first of these questions, I used specific

neurotransmitter receptor antagonists to pharmacologically isolate NMDAR and

AMPAR components of synaptic transmission, tested GH for effect on these

isolated, components and compared the isolated NMDAR-mediated fEPSPs

(fEPSPNs) and isolated AMPAR-mediated fEPSPs (fEPSPAs) to the dual

component fEPSPs. To answer the second question I used western blotting to

measure NMDA-NR1, NR2A, and NR2B expression levels in GH treated and

control rat hippocampal slices. The third section of my dissertation contains the

results of these experiments.

1414

Section I

GH Enhances Excitatory Synaptic Transmission in Area CA1 of

Rat Hippocampus

1515

Introduction

Growth hormone and cognitive function

Age-related reductions in growth hormone secretion and cognitive

impairments associated with aging are well documented. Carlson et al. (1972)

reported a loss of nocturnal surges of GH in elderly individuals.

In adult hypopituitary patients with GH deficiency, rhGH treatment for 3

months had a beneficial effect on attentional performance (Oertel et al., 2004).

The P300 event-related potential (ERP) is a positive deflection in the EEG which

occurs with a 300 ms latency following a novel or surprising event. The P300

ERP is thought to reflect cognitive and memory processing in frontal and

temporal lobes, and it is altered in neurological patients with various cognitive

impairments (Golgeli et al., 2004). P300 ERP latencies were prolonged in GHD

patients with Sheehan's syndrome, indicating cognitive impairment. Six months

of GH replacement therapy (GHRT) significantly elevated serum IGF-I levels, and

improved P300 latencies, indicating normalization of cognitive function by GHRT

(Golgeli et al., 2004).

Aging is associated with both declining activity of the growth hormone-

insulin-like growth factor-I (GH-IGF-I) axis and with a decrease in cognitive

function (Arwert et al., 2003). An oral mixture of glycine, glutamine and niacin

can enhance GH secretion and improve mood and cognition in healthy middle-

1616

aged and elderly subjects (Arwert et al., 2003). In a two year study, Stouthart et

al (2003) examined psychological and cognitive consequences of discontinuation

and restoration of GH treatment in young adults with childhood-onset growth

hormone deficiency. Discontinuation of GH treatment led to a decrease in quality

of life (QoL) within 6 months, and this effect was counteracted within 6 months

after restarting GH treatment (Stouthart et al., 2003). A significant decrease in

IGF-I level and an increase in the number of psychological complaints and

depression were observed in the first 6 months of the GH discontinuation period

(Stouthart et al., 2003). Increased IGF-I level, decreased anxiety and improved

QoL were observed in the first 6 months of GH restoration (Stouthart et al.,

2003). Depression scores tended to decrease across the 12 month treatment

period. The intra-subject IGF-I level was negatively correlated with depression,

fatigue, tension and anxiety, and was positively correlated with vigor and memory

during the 2-year discontinuation and treatment period (Stouthart et al., 2003).

Both GH and IGF-1 affect the hippocampus. Hippocampal IGF-1 mRNA

levels were increased by 1 week of treatment with either GH or GH-releasing

peptide-6 (Fargo et al., 2002). The same effect was seen in the hypothalamus

and cerebellum, but not the cerebral cortex (Fargo et al., 2002). Trace

conditioning, a variant of Pavlovian conditioning, requires a learned association

between two stimuli that are discontiguous in time, and the correct differentiation

between the interstimulus interval, which is stable, and the intertrial interval,

which is variable. Hippocampal GH mRNA, assessed by microarray, real-time

1717

PCR and in situ hybridization, was dramatically up-regulated following 200 trials

of trace conditioning (Donahue et al., 2002). In addition, somatostatin mRNA

which encodes a direct antagonist of GH secretion was reduced during trace

conditioning (Donahue et al., 2002).

Lemon et al. (2003) examined learning on an 8 arm radial maze in

transgenic mice which over-expressed growth hormone (TGM). TGM had

elevated and progressively increasing free radicals (reactive oxygen and nitrogen

species) in brain that strongly correlated with reduced survivorship. Compared to

controls, TGM mice showed enhanced learning during early adulthood, but

accelerated decline of learning during aging. The cognitive decline of TGM was

abolished by a complex "anti-aging" dietary supplement formulated to promote

membrane and mitochondrial integrity, increase insulin sensitivity, reduce free

radicals, and ameliorate inflammation.

Long Term Potentiation (LTP) is a Model System for Mechanisms of

Memory

Long term potentiation (LTP), a long lasting enhancement of synaptic

transmission in response to high frequency stimulation (HFS) (Bliss and Lomo,

1973), represents a good model for studying the synaptic modifications that

underlie memory formation and storage (Bliss and Collingridge, 1993). In the

CA1 area of the hippocampus, LTP is triggered by calcium influx into

postsynaptic neurons. NMDARs are a major route for this calcium entry (Bliss

1818

and Collingridge, 1993). Under some circumstances, metabotropic GluRs and

voltage-gated calcium channels also contribute to postsynaptic calcium increase.

The postsynaptic Ca2+ signal triggering LTP is transient; sustained enhancement

of synaptic transmission depends on Ca2+-activated, postsynaptic signaling

pathways. These pathways lead to the insertion of new GluRs into the

postsynaptic membrane (Nayak et al., 1998; Shi et al., 1999) and the

phosphorylation of existing GluRs (Soderling and Derkach, 2000). Enhanced

glutamate release from the presynaptic terminals also contributes to the

maintenance of LTP (Bekkers and Stevens. 1990; Schulz et al., 1994; Kullman et

al., 1996). These mechanisms support LTP during the first few hours Longer

lasting synaptic enhancement requires gene expression and synthesis of new

proteins (Stanton and Sarvey, 1984; Huang and Kandel, 1994; Nguyen et al.,

1994; Frey et al., 1996), and is accompanied by structural alterations of the

synapse (Desmond and Levy, 1988; Trommald et al., 1996; Toni et al., 1999).

The use of LTP as a model for studying memory is supported by the

importance of hippocampus in memory (Squire and Zola-Morgan, 1992). In

addition, behavioral experiments in animals have shown that pharmacological

and genetic manipulations which prevent normal NMDAR function cause parallel

disruption of LTP and memory (Morris et al., 1986; Davis et al., 1992; Tsien et

al., 1996). Although most experiments have been conducted on rats, mice and

nonhuman primates, normal human memory performance is also dependent on

hippocampal NMDARs (Grunwald et al., 1999). In addition to NMDARs, other

1919

components of the signaling pathways responsible for LTP have been implicated

in learning and memory, including metabotropic GluRs (Riedel et al., 1994; Kaba

et al., 1994) and protein kinases (Mathis et al., 1992; Silva et al 1992). These

findings demonstrate that a common set of cellular mechanisms underlies both

LTP and memory.

The purpose of this study was to determine if short-term treatment with

GH would alter synaptic transmission in the CA1 area of rat hippocampus. To

achieve this goal, I examined the effects of GH application on excitatory synaptic

transmission and on paired-pulse facilitation of excitatory synaptic transmission

(a presynaptic, very short-duration form of plasticity). In addition I examined the

effect of brief high frequency stimulation (HFS, 100 Hz, 1 s) following 3 hr of GH

pretreatment, to determine if both LTP and GH act through common regulatory

mechanisms. Electrophysiological recordings from area CA1 of rat hippocampal

brain slices were used in these experiments.

2020

Materials and Methods

Slice preparation

Hippocampal slices were prepared from 1.5 to 3 month old male Sprague-

Dawley rats (Hilltop Laboratory Animals). Animals were sedated by inhalation of

a CO2/air mixture and decapitated. The skull was opened and the brain was

removed and submerged in chilled, oxygenated (95% O2/5% CO2), low Ca2+/high

Mg2+ artificial cerebrospinal fluid (ACSF), pH 7.35 and composed of: 124 mM

NaCl, 26 mM NaHCO3, 1.2 mM NaH2Po4, 3 mM KCl, 0.5 mM CaCl2, 5 mM

MgSO4 and 10 mM glucose.

While submerged in chilled low Ca2+/high Mg2+ ACSF the brain was

trimmed to a block containing both hippocampi. The block was glued to the

stage of a vibrating microtome (Campden Instruments), immersed in a bath of

chilled, oxygenated, low Ca2+/high Mg2+ ACSF, and 400 µm coronal sections

were cut. Sections containing the hippocampus in transverse profile were

selected and transferred to a small petri dish, where they were further dissected

to free the hippocampus from surrounding tissue (Figure 3). After dissection,

hippocampal slices were transferred to a holding chamber, where they were

stored for later use (Figure 4).

2121

Figure 3. Preparation of rat hippocampal slices. Rat brains were blocked and

glued to the stage of a microtome (top, left to right). Sections were cut, collected

and dissected to isolate individual hippocamal slices (bottom, left to right).

Slices were maintained in a holding chamber at room temperature (20-22

ºC) at the ACSF/atmosphere (95% O2/5% CO2) interface. The holding chamber

was filled with standard ACSF, pH 7.35 and composed of 124mM NaCl, 26mM

NaHCO3, 3.4 mM KCl, 1.2 mM NaH2PO4, 2.0 mM CaCl2, 2.0 mM MgSO4, and 10

mM glucose. Slices were incubated in the holding chamber for a minimum of

one hr prior to use.

2222

interface holding chamber used for preincubation of

dividual hippocampal brain slices. The chamber was composed of a small

ith a

g

Figure 4. The

in

glass beaker with nylon netting stretched over the opening and covered w

piece of lancet paper. The small beaker was placed inside larger beaker and

both beakers were filled with ACSF up to a level matching the height of the

smaller beaker. A line supplying a gas mixture (95% O2/ 5% CO2) was placed

inside the holding chamber. The chamber was covered and kept at room

tempreture. Hippocampal slices were incubated for at least an hour before bein

transferred to the recording chamber.

2323

Slices were withdrawn from the holding chamber as needed and placed in

a low v

ield potential recording

olume (approximately 200 µl) interface recording chamber, where they

were continuously perfused at a rate of 1-1.5 ml/min with standard ACSF. The

recording chamber was kept at a temperature of 25±0.5 °C. A minimum 30 min

period was allowed for recovery after transferring slices from the holding to the

recording chamber.

F

tials were recorded through low impedance (3-4 MΩ)

a

ynaptic stimulation

Extracellular poten

glass micropipettes filled with ACSF and placed into the stratum radiatum of are

CA1 (Figure 5 and 6). Signals were amplified (gain 1000) and filtered (0.1 -

3,000 Hz) using a WPI DAM50 amplifier, then digitized (10 kHz; National

Instruments) and stored on a personal computer.

S

otentials were evoked by delivery of constant voltage

,

Postsynaptic p

stimuli through a bipolar stimulating electrode placed into stratum radiatum.

Stimuli were delivered at a 15 sec interval. In some field potential recordings

paired stimuli (50 ms interstimulus interval) were delivered in order to measure

paired-pulse facilitation. Paired-pulse facilitation was quantified as the ratio of

the second response divided by first response.

2424

Postsynaptic potentials evoked in standard ACSF were quantified by

measuring the slope of the linear portion of the initial response. Changes in

synaptic response caused by GH treatment or LTP induction were expressed as

percentage of baseline prior to treatment or tetanization.

Figure 5. The recording chamber (left) and typical placement of recording

and stimulating electrodes (right). The recording chamber used in the study

was Stoelting company model 51430 tissue chamber (left). A bipolar metal

stimulating electrode and a glass recording electrode were placed into

hippocampal area CA1.

2525

Figure 6. Schematic illustration of hippocampal synaptic organization.

Transverse section of rat hippocampus showing the three major afferent

pathways that form the trisynaptic circuit in hippocampus and the typical

placement of recording and stimulating electrodes in stratum radiatum of area

CA1. The arrows indicate the direction of information flow through the trisynaptic

circuit.

2626

LTP induction

LTP was examined in standard ACSF. LTP was induced by a single high

frequency stimulus train (100 Hz, 1 s). The stimulus intensity used for tetanic

stimulation was set at the population spike threshold. LTP was assessed in

slices pretreated with GH (22 ng/ml, dissolved in standard ACSF) for 3 hr and in

control slices exposed to standard ACSF only for an equivalent time period.

Slices were pretreated in the interface holding chamber, then transferred to the

recording chamber where they were perfused with standard ACSF for recording

and assessment of LTP.

Reagents

I used rhGH (Bachem). The doses used in these recordings ranged from

0.5 to 1 nM or (11-22 ng/ml) which is within the physiological range; GH serum

level ranged between few ng/ml and several hundred ng/ml in rats (Kimura and

Tsai 1984; Everson and Crowley, 2004). Human GH is a potent, relatively

selective agonist of GHRs in male rats. Mustafa et al. (1994a) reported the

presence of specific binding sites for hGH in rat brain which were moderately

high in hippocampus, hypothalamus and striatum. Moreover, those binding sites

for hGH were almost exclusively somatogenic in male rat brains (Mustafa et al.,

1994b). However in female rat brain these sites display somatogenic and

lactogenic characteristics (Mustafa et al., 1994b). This is also supported by the

finding of Ranke et al. (1973) who studied the sex differences in binding of hGH

to isolated rat hepatocytes. They reported that hGH binds only to somatogenic

2727

receptor in hepatocytes of male rats. However in female rats and estrogen

treated males hGH has both somatogenic and lactogenic properties (Ranke et

al., 1973). In summary, in male rats (used in this study) hGH has less potential to

bind non specifically to lactogenic receptors.

Data analysis

Field potentials were collected and analyzed using The WinWCP program

(John Dempster, University of Strathclyde). Additional analysis was completed

using Excel (Microsoft) and Origin (OriginLab). All statistics are presented as

mean ± one standard error of the mean. Statistical significance was assessed

using paired and unpaired t-test, as appropriate, with p<0.05 considered

significant.

2828

Results

Growth hormone enhanced excitatory synaptic transmission

I used field potential recordings (fEPSP) to determine if GH application

affects excitatory synaptic transmission. Application of GH (11-22 ng/ml) caused

a slow increase in fEPSP slope (Figure 7). Although fEPSPs began to increase

within minutes of starting GH application, the maximal increase required 60-120

min. GH enhancement of fEPSP persisted for more than 4 hours Control slices,

exposed to ACSF for the same duration, did not show any increase in fEPSP

slope (p<0.01, control vs GH after 60 min of application).

Growth hormone did not affect paired pulse facilitation

The GH-induced increase in fEPSP slope could be due to enhanced

postsynaptic response to glutamate, or increased presynaptic release of

glutamate. Increased probability of transmitter release is accompanied by

decreased paired-pulse facilitation (PPF) (Dobrunz and Stevens, 1997).

Therefore, to determine if increased probability of glutamate release might

underlie the GH enhancement, I examined PPF during GH application. Neither

GH treated nor control slices showed a change in PPF ratio (Figure 8). This lack

of change in PPF argues against an increase in glutamate release as a

mechanism for the GH enhancement of excitatory synaptic transmission.

2929

Growth hormone inhibits LTP in area CA1 of rat hippocampus

A single train of high frequency stimuli (HFS, 100 Hz, 1 s) failed to

potentiate synaptic responses in slices pretreated with GH (22 ng/ml; p > 0.4).

However, HFS with the same 100 Hz protocol caused significant enhancement of

fEPSPs in control slices pretreated with standard ACSF (p < 0.02; Figure 9).

3030

Figure 7.

A

3131

B

3232

Figure 7. GH Enhanced Excitatory Synaptic Transmission in Area CA1 of

Rat Hippocampus.

A. GH application (11-22 ng/ml) caused a slow enhancement of fEPSPs

(squares) in comparison to control slices treated with ACSF only (diamonds). GH

application began after 15 min of recording and continued for >5 hours The inset

at top shows fEPSPs changes during the baseline and after 3 hr of GH and

control treatment.

B. Summary of GH effects on fEPSPs. fEPSPs were averaged over 15 min

baseline period and 1 hr period during GH application. fEPSPs from GH treated

slices were significantly enhanced compared to controls at all time points:

*P<0.05, **P<0.01, ***P<0.005. These data represent the average of 10 slices

treated with GH and 4 control slices.

3333

Figure 8.

A

3434

B

0

0.5

1

1.5

2

2.5

baseline GH 1st hr GH 2nd hr

PPF

Rat

io

Figure 8. GH did not alter the paired-pulse facilitation (PPF) ratio.

A. Paired stimuli (50 ms interstimulus interval) were delivered at 15 sec intervals.

There was no change in PPF ratio during GH application. The inset at top shows

fEPSPs during baseline and the second hr of GH application. Substantial paired-

pulse facilitation is seen at all times (the second response is bigger than the first

response), but the application of GH did not alter the PPF ratio.

B. Summary of all recordings in which PPF was examined during GH

application. PPF was not significantly different during either the first or the

second hr of GH treatment compared to the baseline (p < 0.2, n = 9)

3535

Figure 9.

A

3636

B

0

50

100

150

200

250

300

350

control GH pretreated

fEPS

P s

lope

(%ba

selin

e)

*

Figure 9. GH pretreatment prevented LTP in area CA1 of rat hippocampus.

A. Stable baseline responses were recoded for a 15 min period preceding tetanic

stimulation (100 Hz 1s). Control slices showed enhancement of fEPSPs after

tetanus (diamonds), but LTP was completely prevented in GH pretreated slices

(squares). The inset at top shows baseline responses and responses after

tetanus (control upper left and GH treated upper right).

B. Summary of LTP results in GH pretreated and control slices. Control slices (n

= 8) showed significant potentiation of the fEPSP (*p<0.02), but GH pretreated

slices (n=8) failed to show any significant change in fEPSP (ns p<0.44).

3737

Discussion

Short term, minutes to hours, application of GH to in vitro rat hippocampal

brain slices enhanced excitatory synaptic transmission and also inhibited further

potentiation by tetanus. In a recent study Fargo et al. (2002) have shown that GH

affects many functions of the central nervous system, with beneficial effects on

memory, alertness and motivation. Le Greves et al. (2002) observed dose

dependent improvement in memory and learning after 1 week of daily injections

of rhGH in hypophysectomized male rats. Memory deficiency including both short

and long term memory is a well known syndrome in GHD patients (Deijen et al.,

1996; Aleman et al., 2000). In addition, adult patients suffering from

hypopituitarism with GH deficiency showed improvement of attentional

performance when treated with GH for at least 3 months (Oertel et al., 2004). An

age-related decrease of GH is associated with defects in spatial memory in

animals (van Dam et al., 2000), and it is well established that the decline in the

cognitive function with aging is paralleled with decreased circulating levels of GH

(Le Greves et al., 2002).

This raises the question, how does GH treatment improve memory,

alertness, and cognition? The process of memory storage in the brain certainly

involves some form of synaptic modification (Rosenzwing and Barnes, 2003).

Recent investigations have suggested a role for GH in memory, which may be

mediated by the influence of GH on neuronal plasticity in the hippocampus. Since

3838

the hippocampus is critically important in memory and learning processes (Le

Greves et al., 2002), I applied GH to in vitro hippocampal brain slices of rats to

determine if it affects synaptic transmission. GH substantially enhanced synaptic

transmission in area CA1 of rat hippocampal slices, exerting a maximum effect

within 2 hr (Figure 7). Taken together, this suggests that GH may improve

memory by enhancement of synaptic transmission between hippocampal

neurons. However, prior treatment with GH for 3 hr also blocked synaptic

enhancement induced by brief tetanus (100 Hz, 1 s), (Figure 9). How can this

dual effect of GH be explained?

Although LTP was originally described as synaptic enhancement resulting

from high frequency electrical stimulation (Bliss and Collingridge, 1993), similar

synaptic potentiaton may result from application of several different chemical

compounds, including neutrophins, second messenger analogs, and

conventional neurotransmitters. Although the term LTP typically refers to

electrically-induced synaptic enhancement, we could say that LTP is of 2 types:

drug-induced and electrically-induced. Drug-induced LTP has been

demonstrated following treatment with the neurotrophins, BDNF and NT-3,

forskolin and the membrane-permeable cAMP analog Sp-cAMPS, and also

dopamine receptor agonists (D1 and D2) (Frey et al., 1993; Huang et al., 1994.,

Huang and Kandel, 1995; Kang and Schuman, 1995).

3939

Previous studies in hippocampal slice preparations have distinguished two

major temporal phases of LTP, early and late, based on their sensitivities to

inhibitors of mRNA and protein synthesis (Krug et al., 1984; Huang and Kandel,

1994). In contrast to the early phase of LTP (E-LTP), the late phase of LTP (L-

LTP) is of greater amplitude and longer duration, lasting more than 3 hr (Kelleher

et al., 2004a). In contrast to the L-LTP produced by repeated tetanization, L-LTP

produced by drugs develops gradually, requiring 1 to 2 hr to reach its maximal

level. Both drug- and electrically-induced L-LTP are abolished completely by

protein synthesis inhibitors (Kelleher et al., 2004a). Previous studies indicated

that L-LTP produced by repeated tetanization and L-LTP produced by elevation

of intracellular cAMP share a common protein synthesis-dependent mechanism

(Kelleher et al., 2004a). Establishment of cAMP-induced LTP prior to repeated

tetanization blocks L-LTP (Frey et al., 1993; Huang and Kandel, 1994). The idea

that drug-induced L-LTP can block electrically-induced L-LTP is also supported

by the finding of Martin et al. (1997) that MAPK may be a general mechanism for

long-term plasticity in all kinds of LTP. They found that MAPK translocates into

the nucleus of the presynaptic but not the postsynaptic cell during 5-HT-induced

long-term facilitation, suggesting that MAPK may play a similar role in

hippocampal long-term potentiation. PKCζ may also play essential roles in both

drug-induced and electrically-induced LTP, since treatment of hippocampal CA1

pyramidal neurons with PKC ζ activators produces robust potentiation of synaptic

transmission that occludes subsequent electrically-induced LTP (Ling et al.,

2002).

4040

I found that a brief tetanus (100 Hz, 1 s), which normally induces LTP had

no effect in slices pretreated with GH for 3 hours This effect of GH on

hippocampal synaptic function raises another question; does GH act through a

similar signaling pathway to that of LTP? If so, then prior saturation of this

pathway by pretreatment with GH should prevent subsequent electrically-induced

LTP. In order to answer the questions raised by my first set of experiments, the

GH signaling pathway in hippocampus must first be defined. It will then be

possible to compare the GH signaling pathway with the LTP signaling pathway

which is already well described in the literature.

4141

Section II

Growth Hormone Signaling Pathways in Area CA1 of Rat

Hippocampus

4242

Introduction

Pretreatment with GH blocked the effect of a brief tetanus (100 Hz, 1 s)

which normally induces LTP. This effect of GH on hippocampal synaptic function

raises another question; does GH act through a similar signaling pathway to that

of LTP? If so, then prior saturation of this pathway by pretreatment with GH

should prevent subsequent electrically-induced LTP. In order to answer this

question tetanization-induced-LTP signaling pathway(s) and GH signaling

pathway(s) in other tisssues which are already well described in the experimental

literature will be reviewed.

Tetanization-induced L-LTP signaling pathway

LTP induction is disrupted by pharmacological inhibitors of the Ras

effectors PI3-kinase (Kelly and Lynch, 2000; Lin et al., 2001; Kelleher et al.,

2004a; Sanna et al., 2002) and p44/42 MAPK (Sweatt, 2001; Adams and Sweatt,

2002). LTP is also inhibited in hippocampal pyramidal cells expressing a

dominant negative form of Ras (Zhu et al., 2002). Furthermore, MEK inhibitors

strongly reduce the induction of LTP by theta pulse stimulation (TPS) (Winder et

al., 1999; Watabe et al., 2000). There are at least two possible roles for ERK

activation in LTP. First, MAPK activation has an important role in the mRNA and

protein synthesis stages of LTP maintenance (Impey et al., 1998; Davis et al.,

2000). Second, MAPK activation contributes to LTP induction through

downregulation of dendritic A-type K+ channels (Sweatt, 2001). Downregulation

4343

of dendritic A-channels allows greater postsynaptic depolarization during

tetanization, leading to greater voltage-dependent calcium influx, and enhanced

downstream activation of calcium-dependent processes.

LTP induced by short trains of TPS is almost completely blocked by the

PI3-kinase inhibitors LY294002 and wortmannin (Opazo et al., 2003). PI3-kinase

is important for the induction of LTP, but not for the maintenance of LTP, as PI3-

kinase inhibitors applied after LTP induction do not block LTP (Opazo et al.,

2003). Several possible roles for PI3-kinase in LTP induction have been

suggested. LTP-inducing patterns of synaptic stimulation activate the atypical

PKC isoform PKCζ (Sacktor et al., 1993), and inhibitors of PKCζ inhibit LTP in

hippocampal area CA1 (Ling et al., 2002). PI3-kinase contributes to the early

activation of PKCζ during LTP induction (Opazo et al., 2003), perhaps via

activation of PDK-1 (Chou et al., 1998; Le Good et al., 1998). In addition, PI3-

kinase is important for the trafficking and insertion of some membrane proteins

during LTP induction (Corvera and Czech, 1998; Wu et al., 1998; Rameh and

Cantly, 1999; Lhuillier and Dryer, 2002). Finally, PI3-kinase might have a role in

the dendritic spine changes associated with LTP and induced by either

organizational changes of actin cytoskeleton (Rodgers and Theibert, 2002) or

activation of synaptic NMDA receptors (Yuste and Bonhoeffer, 2001).

4444

Growth hormone signaling pathway

Tissue sensitivity to GH. Growth hormone (GH) differs from other

pituitary hormones in its wide spectrum of cellular activities in several different

tissues which are all mediated by a common receptor, suggesting tissue-specific

differences in the post-receptor mechanisms (Hull and Harvey, 1998). One of the

mechanisms that confers specificity is tissue sensitivity to GH stimulation. Tissue

sensitivity depends upon the abundance of GH receptors (GHRs), the amplitude

and pulsatility of GH secretion and the presence of non-signal transducing GH-

binding proteins (GHBPs), which result from alternate splicing of GHR gene

transcripts (Hull and Harvey, 1998). Additional diversity stems from tissue-

specific autoregulation of GHRs and GHBPs. Hypophysectomy decreased both

GHR and GHBP transcripts in the hypothalamus of rats by 20%; however,

neither transcript was affected in the liver, spleen, cortex/neocortex or brainstem

(Hull and Harvey, 1998). On the other hand, a single bolus GH injection

increased circulating GH concentrations, GHR and GHBP mRNA content by 25-

30 % in all brain regions and in the spleen of hypophysectomized rats (Hull and

Harvey, 1998).

GH regulation of GHRs. GHR mRNA levels were increased within 1 hr

of a single injection of human GH (100 µg/ rat), and maximal levels were reached

between 3-12 hr after the injection (Vikman et al., 1991). The increase in GHR

mRNA levels was dose dependent and also was observed after prolonged

treatment (1 or 5 mg/kg/day for 6 days) with bovine GH. Furthermore, there was

4545

a rapid and GH-dependent regulation of GHR mRNA levels in adipose tissue

(Vikman et al., 1991). Using PCR, GH treatment by s.c. injection for 10 days

increased expression of GHR transcripts in the hippocampus of young adult rats,

reflecting the ability of the hormone to reach the brain and stimulate hippocampal

cells (Le Greves et al., 2002).

Overview of GHR signaling. The receptors for GH, prolactin,

erythropoietin, and interleukin 2 all belong to the same large family of single

chain transmembrane receptors (Xiaowei et al., 1995), the cytokine receptor

superfamily. The receptors in this family have similar extracellular domains which

are rich in cysteine, a motif that has been shown to be important in protein-

protein interaction as well as in cell-cell interaction (Bazan, 1989; Patty, 1990).

Activation of the GHR, like other members of the cytokine receptor family,

stimulates Janus kinase 2 (JAK2) association with the GHR, followed by tyrosine

phosphorylation of both proteins (Argetsinger et al., 1993; Sotiropoulos et al.,

1994). The activated GHR-JAK2 couple stimulates several signaling cascade,

including the Ras/Raf/MEK1/MAPK pathway, the insulin receptor substrate-

1(IRS-1)/PI3kinase pathway and the STAT pathway (Liang et al., 2000).

MAPK pathway. Binding of GH and prolactin (PRL) to their receptors

activates JAK2 tyrosine kinase, the initial step in all biological actions of GH

(Yamauchi et al., 1998). The activated GH/JAK2 complex in turn activates STATs

as well as ERK/MAPKs (Winston and Hunter, 1995). The GHR/JAK2-mediated

4646

activation of ERK2/MAPK is through both Ras and Raf (Winston and Hunter,

1995). GH promoted the rapid, transient association of SHC with the Grb2-SOS

complex. This correlated with the time course of Ras, Raf, and MEK activation

with Ras, Raf, and MEK returning to near basal activity by 15 or 30 min despite

the continuous presence of GH (Vanderkuur et al., 1997).

Phosphorylation of the JAK2-GHR complex, through activation of MAPK,

leads to increased IGF-1 mRNA expression in liver (Xu et al., 1995). The

GHR/JAK2-MAPK stimulation of IGF-1 production shows an age-related decline.

In 17-month-old female C57BL/6 mice IGF-1 gene expression is decreased, but

this is not directly associated with decreased GHR complex phosphorylation or

MAPK activity (Xu et al., 1995). However, by the age of 31 months the decrease

in IGF-1 gene expression is associated with a marked decline in GHR and JAK2

phosphorylation and decreased MAPK activity (Xu et al., 1995).

GH stimulation leads to phosphorylation of Elk-1 and transcriptional

activation (Hodge et al., 1998). Overexpression of dominant-negative Ras or the

ERK-specific phosphatase, mitogen-activated protein kinase phosphatase-1, or

addition of the MEK inhibitor PD098059, blocked GH-stimulated activation of

Ras/MEK/ERK pathway and abrogated GH-induced activation of Jun N-terminal

kinase and phosphorylation of Elk-1 in 3T3-F442A cells (Hodge et al., 1998). GH

also activates MAPK in a less direct manner, via tyrosine phosphorylation of the

epidermal growth factor receptor, stimulating its association with Grb2, and

4747

resulting in activation of the MAPK signaling pathway in liver tissue (Yamauchi et

al., 1998).

PI3- kinase pathway. GH induces tyrosine phosphorylation of insulin

receptor substrate (IRS)-1/IRS-2 in liver (Yamauchi et al., 1998). IRS-1, -2, and -

3 are phosphorylated by JAK2 providing docking sites for p85 PI3-kinase and

activating PI3-kinase leading to downstream biological effects (Yamauchi et al.,

1998). Wortmannin, a specific PI3-kinase inhibitor completely, blocked the anti-

lipolytic effect of GH in 3T3 L1 adipocytes (Yamauchi et al., 1998).

STAT pathway. GH activates JAK2 tyrosine kinase and members of the

STAT family of transcription factors, including STATs 1, 3, and 5 (Smit et al.,

1997). At least two STAT5 proteins (STAT5A and STAT5B) exist in mouse and

human (Smit et al., 1997). GH activates both STAT5A and STAT5B in several

cell types (Smit et al., 1997). GH-dependent tyrosyl phosphorylation of both

STAT5A and STAT5B requires the same specific regions of the GHR and

activation of JAK2 kinase (Smit et al., 1997). GH plays an important role in

specific gene transcription through transient activation of STAT proteins (Rico-

Bautista et al., 2004). GH activates STAT5 by a rapid but transient mechanism

that involves tyrosine phosphorylation and nuclear translocation (Fernandez et

al., 1998). GH-induced STAT5 DNA-binding activity was detected after 2 min,

reached a maximum at 10 min, decreased rapidly up to 1 hr of GH treatment,

and the remaining activity declined slowly thereafter (Fernandez et al., 1998).

4848

Termination of GH signaling at the GHR/ JAK complex occurs through

GH-induced ubiquitination/internalization of the GHR and also by the action of

SOCS (suppressor of cytokine signaling) (Rico-Bautista et al., 2004). Greenhalgh

and Alexander (2004) reported that SOCS are a family of proteins that are

produced in response to signals from cytokines and growth factors and which act

to attenuate cytokine signal transduction. Members of the SOCS family (SOCS-1

to SOCS-7 and CIS) share a central SH2 domain and a C-terminal SOCS box

and form a classical negative feedback loop that inhibit JAK/STAT signalling

cascade (Larsen and Ropke, 2002). Recent studies indicated that SOCS bind to

phosphotyrosines on the target protein through their SH2 domain, leading to

inhibition of signal transduction by N-terminal inactivation of JAK resulting in

blocking of access of STAT to the receptor sites (Larsen and Ropke, 2002). In

addition, SOCS through their SOCS box-targeting bound proteins to proteasomal

degradation (Larsen and Ropke, 2002).The expression of CIS, SOCS1, SOCS2

and SOCS3 proteins is induced in cells stimulated with GH and their over-

expression in cell lines blocks aspects of GH signalling (Greenhalgh and

Alexander, 2004). On the other hand, mice lacking SOCS2 display gigantism

accompanied by evidence of lack of regulation of GH signaling (Greenhalgh et

al., 2005).

GH signaling is also affected by the integrity of cellular cytoskeleton. The

GHR/JAK2/STAT5 signaling pathway is negatively regulated by the integrity of

the actin cytoskeleton network, which facilitates GHR ubiquitination and

4949

degradation (Rico-Bautista et al., 2004). Rico-Bautista et al. (2004) investigated

the effects of actin cytoskeleton disruption on the kinetics of GH-activated

GHR/JAK2/STAT5 signaling pathway. They found that disruption of the actin-

based cytoskeleton with cytochalasin D (CytoD) prolonged both JAK2/STAT5

tyrosine phosphorylation and STAT5 DNA binding activity. In addition, they

demonstrated that although CytoD treatment did not affect the synthesis of

SOCS proteins (SOCS-1, -2, and -3), the inhibitory actions of SOCS1, 2, and -3

on GH-induced STAT5 reporter activity were partially blocked by disruption of the

cytoskeleton. They also reported that the disassembly of actin filaments by

CytoD was accompanied by accumulation of ubiquitinated forms of GHR, but it

did not affect GHR internalization.

Although GH-induced JAK2/STAT5 activation was independent of protein

synthesis, a rapid decrease in STAT5 DNA-binding activity within 1 hour is

dependent on protein synthesis (Fernandez et al., 1998). JAK2 tyrosine

phosphorylation and STAT5 DNA-binding activity were prolonged for at least 4

hours in the presence of cycloheximide, a protein synthesis inhibitor, indicating

that maintenance of desensitization requires ongoing protein synthesis

(Fernandez et al., 1998). Termination of GH-induced STAT5b signaling involves

down-regulation of JAK2 signaling to STAT5b by phosphotyrosine phosphatase

(Gebert et al., 1999).

5050

Cellular stress may modulate transcription through the JAK/STAT

pathway. Flores-Morales et al. (2001) reported that endoplasmic reticulum stress

prevents the inactivation of STAT5 DNA binding activity by modulating the rate of

JAK2/STAT5 dephosphorylation. They found that endoplasmic reticulum

stressors dithiothreitol, calcimycin (A23187) and 1,2-bis(o-aminophenoxy)ethane-

N,N,N,N-tetraacetic acid (acetoxymethyl) ester (BAPTA-AM) prolong GH-induced

phosphorylation of JAK2 and STAT5.

STAT5 pathway versus MAPK and PI3-kinase pathways in mediating

GH action. GH induces tyrosine phosphorylation of IRS-1/IRS-2 in liver

(Yamauchi et al., 1998). IRS-1 expression augments the Ras/Raf/ MEK1

/MAPK and PI3K pathways more than the tyrosine phosphorylation of STAT5

(Liang et al., 2000). The level of GHR is rapidly reduced by short exposure to

GH, which resulted in an equal desensitization of the JAK2/STAT5 pathway and

time dependent recovery in the absence of GH (Ji et al., 2002). Unlike the

JAK2/STAT5 pathway, the activating effect of GH on the MEK/ERK and PI 3-

kinase/Akt pathways did not recover following prolonged incubation in the

absence of GH (Ji et al., 2002). This result indicates the presence of an

additional post-receptor mechanism causing the prolonged refractoriness of the

MEK/ERK and PI 3-kinase/Akt pathways in response to a second GH stimulation

(Ji et al., 2002). The JAK2/STAT5 signaling pathway is required for GH/PRL-

induced pancreatic beta-cell proliferation; however, MAPK, PI3K, and PKC

signaling pathways are not required (Friedrichsen et al., 2001).

5151

Protein synthesis, synaptic plasticity, and GH

GH is well known for its ability to stimulate protein synthesis through both

transcription and translation. GH/ IGF-1/insulin/ and p38 MAPK signaling

pathways have important roles in the regulation of protein synthesis. Inhibition of

the activity of these pathways plays an important role in the reduced rate of

protein synthesis in aged rodents (Hsieh and Papaconstantinou, 2004). GHD has

well known detrimental effects on cognition and memory in humans. Memory

formation in mammals requires protein synthesis (Flexner et al., 1963; Davis and

Squire, 1984). Studies in hippocampal slice preparations have distinguished two

phases of LTP, an early phase (E-LTP) lasting for 2 hr and a late phase (L-LTP)

which is greater in amplitude and longer in duration (> 3 hr) based on the

differential sensitivities to mRNA and protein synthesis inhibitors (Nguyen et al.,

1994). Distinct temporal phases of memory and synaptic plasticity have been

delineated in rodent hippocampus with long lasting forms distinguished by their

dependence on macromolecular synthesis (Kelleher et al., 2004b). The

regulation of protein synthesis underlying long-lasting synaptic plasticity might

occur at the transcriptional or translational level (Kelleher et al., 2004b).

The effect of protein synthesis inhibition on long lasting synaptic plasticity

is a specific consequence of translational blockade and not due to non-specific

effects or toxicity (Kelleher et al., 2004b). Several observations support this

claim. First, the action of protein synthesis inhibitors is specific to long lasting

forms of synaptic plasticity with no effect on the transient forms. Second, protein

5252

synthesis inhibitors typically interfere with the maintenance, not the initial

induction of long lasting synaptic plasticity. Third, both L-LTP and L-LTD are

blocked by protein synthesis inhibitors (Kelleher et al., 2004b). Fourth, calcium

influx induced by depolarization or metabotropic GluR activation is not affected

by the widely used protein synthesis inhibitor, anisomycin (Linden, 1996).

Finally, several agonists such as BDNF and NT4, forskolin and memberane-

permeable cAMP analog Sp-cAMP, and dopamine receptor type D1/D5 agonists

can induce the long lasting protein-dependent forms of LTP (Kang and Schuman,

1995). The L-LTP induced by all those agents differs from L-LTP induced by

repeated tetanization in that it develops gradually, requiring 1-2 hr to reach a

maximum level and is abolished completely by pretreatment with protein

synthesis inhibitors (Kelleher et al., 2004a).

In order to answer the following questions, what signaling pathway(s) are

responsible for short-term effects of GH on hippocampal synaptic function, and is

synthesis of new proteins required for these effects? I hypothesized that GHR

signaling in hippocampus would use signaling pathways previously described in

other tissues. This hypothesis was tested by examining the effects of

pharmacological inhibition of specific components of the hypothesized

hippocampal GHR signaling pathway. The following set of experiments was

conducted to assess the possible contributions of JAK2, STAT5, MAPK, and PI3-

kinase pathways, and protein synthesis to the GH-induced enhancement of

excitatory synaptic transmission.

5353

Materials and methods

The methods used for hippocampal slice preparation, field potential

recording and data analysis were as discussed in the previous section.

To examine the effect of in vitro GH treatment on the expression of GH

receptors and STAT5a/b, hippocampal slices were prepared and allowed to

recover for 1 hr before use in experiments. For each experiment, slices obtained

from the same animal were placed into 2 separate interface holding chambers.

The slices in one chamber were exposed to ACSF alone to serve as a control,

and in the other chamber slices were exposed to ACSF + 2 nM GH. For

detection of GHR mRNA, hippocampal slices were treated with GH (2 nM) or

ACSF alone for 3 hr, then collected, rapidly frozen on dry ice, and stored at

-80 °C until used for RNA isolation. For detection of total and phosphorylated

STAT5a/b, hippocampal slices were treated with GH (2 nM) or ACSF alone for

15-30 min, then were collected and rapidly frozen on dry ice, and stored at -80 °C

until used for protein analysis.

Western Blotting

Hippocampal slices were homogenized in protein lysis buffer [1% Nonidet

P-40 (NP-40), 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS),

0.15 M NaCl, 0.01 M sodium phosphate, pH 7.2, 2 mM ethylenediamine

tetraacetic acid (EDTA), and 1% protease inhibitor cocktail]. Then, burst

5454

sonication was done (< 10 sec), and samples were centrifuged at 14,000 × g for

20 min. at 4 °C. The supernatant solution was obtained and total protein

estimated using the Bradford method (Bradford, 1976). Equal amounts of total

protein from GH treated slices and control slices (200 µg) were separated on 8%

polyacrylamide gels. The separated proteins were transferred to nitrocellulose

membranes (Micron Separations, Inc., Westboro, MA). The membranes were

blocked (1 hr at room temperature) in 5% nonfat dry milk in T-T-S (0.5% Tween-

20, 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.2 mM EDTA). The membranes

were then incubated with primary antibody diluted in 5% non-fat dry milk in T-T-S

either at room temperature for 1 hr or overnight at 4 °C. Next, membranes were

then washed and incubated with horseradish peroxidase (HRP)-conjugated

secondary antibodies, diluted 1:10,000 in 5% non-fat dry milk in T-T-S (1 hr at

room temperature or 4 °C overnight). Blots were washed again and proteins

were detected on X-ray film (Fuji Medical System USA, Inc., Stamford, CT) using

the ECL system (Amersham-Pharmacia), following the manufacturer’s

instructions. To correct for possible loading differences, blots were probed with

an antibody to neuron-specific enolase (NSE). The following primary antibodies

were used: anti-NSE (AB951, Chemicon International, 1:6000 to 1:8000), anti-

total STAT5 (Clone 89, Catalog Number # 610192, BD Bioscience, 1:250), anti-

phospho-STAT5 A/B (Y694/Y699) (mouse monoclonal IgG, clone 8-5-2; catalog

# 05-495, Upstate Biotechnology, 1:250).

5555

RT-PCR

Total RNA from hippocampal slices was prepared using TRI Reagent

(Sigma). cDNA was synthesized from 2.5 µg total RNA using 100µM random

hexamer as primers. The mixture was heated to 65 °C for 5 min, and quickly

chilled on ice. I added 4 µl of 5X First Strand Buffer (Invitrogen, Carlsbad, Ca),

0.02 M DTT, and 40 U of Ribonuclease Inhibitor (Invitrogen), the reaction was

placed in a PTC-100 thermal cycler and incubated at 25 °C for 10 min and then

at 37 °C for 2 min. 200 U of M-MLVRT (Invitrogen) was added, and the mixture

was incubated at 37 °C for 50 min and then at 70 °C for 15 min. For the PCR

reactions the following primers were used: GHR right 5´ (acttctgcggctgagcaaac)

3´ and GHR left 5´ (ccttggagcaaaggatgacg) 3´. The protocol for amplification

was 95 °C for 1 min, 60 °C for 30 s and 72 °C for 1 min, for 35 cycles. Using the

cDNA prepared by RT-PCR, the following reaction was prepared: 50 µl total

reaction volume; 33.5 µl of H2O, 0.5 µl of the right primer and 0.5 µl of the left

primer, 0.5 µl of taq polymerase, 6 µl of 25 µM MgCL2, 1 µl of 10 µM dNTPs, 5 µl

of 10X PCR buffer, and 2 µl of either samples or controls.

Reagents

Reagents used in this study were rhGH (Bachem); 1,4-diamino-2,3-

dicyano-1,4-bis(2-aminophenylthio)-butadiene (U-0126); tyrphostin AG 490 (LC

Labs); wortmanin (WORT) (Sigma); cycloheximide (3-[2-(3,5-Dimethyle-2-

oxocyclohexyl)-2-hydrxyethyl]glutarimide) (Sigma). The last three reagents were

5656

dissolved in Dimethyle sulfoxide (DMSO). Salts and other compounds were from

Sigma or Fisher.

Data analysis

Field potentials were collected and analyzed using WinWCP program

(John Dempster, University of Strathclyde). Densitometric analysis was

conducted using ImageJ (Wayne Rasband, NIMH). Additional analysis was

completed using Excel (Microsoft) and Origin (OriginLab). All statistics are

presented as mean ± one standard error of the mean. Statistical significance was

assessed using paired and unpaired t-test, as appropriate, with p<0.05

considered significant.

5757

Results

GH treatment of in vitro hippocampal brain slices increased the expression

of GHR message

To determine the effect of GH treatment on the expression pattern of GH

receptors, I used RT-PCR of hippocampal brain slices treated with GH (2 nM) for

3 hours GH treatment significantly increased (p< 0.002) the expression of GHR

mRNA compared to control treated with ACSF alone (Figure 10).

GH treatment of in vitro hippocampal brain slices did not alter total or

phospho-STAT5A/B proteins

To examine the effect of GH treatment on the expression pattern of total

and phospho-STAT5a,b, I used western blot analysis of hippocampal brain slices

treated with GH (2 nM) for 15-30 min. GH treatment did not affect the protein

levels of either total or phospho-STAT5a,b compared to control tissue treated

with ACSF alone (Figure 11).

GH-induced potentiation of fEPSPs was blocked by inhibitors of PI3 kinase,

MAPK kinase, and JAK2 tyrosine kinase

To investigate the role JAK2, PI3-kinase and MAPK in mediating the

effects of GH on hippocampal synaptic transmission, I pretreated (30 min),

hippocampal brain slices with tyrphostin AG 490 (10 µM) to block JAK2 protein

tyrosine kinase, wortmannin (50 nM) to block the PI3-kinase signaling pathway,

5858

and U0126 (20 µM) to block the MAPK pathway. GH (1 nM) was then applied.

Each of these three inhibitors significantly reduced the effect of GH on excitatory

synaptic transmission in CA1 region of rat hippocampus. These results indicate

that activation of JAK2, PI3-kinase and MAPK signaling pathways are all

important for the induction of GH effect on hippocampal synapses (Figure 12).

PI3-kinase and MAPK inhibitors had no effect on the maintenance of GH

enhanced excitatory synaptic transmission in the hippocampus

I conducted an additional experiment to determine if PI3-kinase and

MAPK signaling pathways are important for the maintained effects of GH on

hippocampal synaptic transmission. Hippocampal slices were treated with GH (1

nM) for 30 min, to allow the initial enhancement by GH of synaptic transmission,

then WORT (50 nM) or U-0126 (20 µM) were added along with GH for another

30 min. Neither WORT nor U-0126 had any effect on the maintenance of GH

enhancement of hippocampal synaptic transmission (Figure 13), suggesting that

while PI3-kinase and MAPK are required for the initiation of GH-induced

enhancement, neither is required for the maintained expression of GH-dependent

synaptic enhancement.

5959

Protein synthesis is required for the induction of GH enhancement of

synaptic transmission

To investigate the role of protein synthesis in the induction of GH-

dependent synaptic enhancement, I pretreated hippocampal brain slices with 60

µM cycloheximide for 30 min before GH (1 nM) treatment. Cycloheximide

application was maintained during GH application for 1 hour Pretreatment with 60

µM cycloheximide for 30 min completely blocked the GH effect on excitatory

synaptic transmission of rat hippocampus. This result indicates that synthesis of

new proteins is required for the induction of GH-dependent synaptic

enhancement (Figure 14).

Protein synthesis is not important for maintained expression of GH

enhancement of synaptic transmission

To determine the possible role of continued protein synthesis in the

maintained expression of GH-dependent synaptic enhancement, I applied

cycloheximide (60 µM) beginning 30 min after the start of GH (1 nM) treatment.

Cycloheximide applied 30 min after initial treatment with GH had no effect on the

maintained expression of GH enhancement of excitatory synaptic (Figure 15).

6060

Figure 10 A.

GH + - + -

GHR

NSE

100

125

150

175

200

GH treated control

GH

R m

RN

A (a

rbitr

ary

units

)

***

6161

expressio

nM) for 3 h

nd contr

. Denistometric analysis of GHR mRNA. GH treatment caused a significant

l slices.

Figure 10. GH treatment of in vitro hippocampal brain slices increased the

n of GHR mRNA.

A. Total RNA was prepared from hippocampal brain slices treated with GH (2

r (+) and from control slices treated with ACSF alone (-). cDNA was

prepared from total RNA as described in the materials and methods. GH

treatment increased the expression of GH receptor mRNA compared to control

treated with ACSF alone. The upper panel shows GHR mRNA for GH treated

ol slices. The lower panel shows the NSE mRNA. a

B

upregulation of GHR message (***p=.002). The data represent the average of 8

pairs of GH and ACSF contro

6262

Figure 11

A

B

0

0.5

1

1.5

2

2.5

3

Total STAT5 Phopho-STAT5 A/B

Mea

n gr

ey (a

rbitr

ary

units

)

GHTcontrol

P-STAT5/A,B

Total STAT5

NSE

+ - + - (GH)

6363

6464

C.

Figure 11. GH treatment of in vitro hippocampal brain slices did not affect

rotein levels of either total or phospho-STAT5a/b.

Total protein was prepared from hippocampal brain slices treated with GH (2

nM) for 15-30 min (+) and from control slices treated with ACSF alone (-).

blot probed with anti-phospho- ddle panel shows a blot

probed wit

probed with anti-NSE

levels of either total or Densitometric analysis of

total or phospho-STAT

signific

ignificant change in the ratio of phospho-STAT5a/b to Total STAT5a/b in GH

average of 8 pairs of slices. The bars show the mean ± SE of the mean.

0

0.2

0.4

0.6

0.8

1

GHT control

P S

tat 5

/ Tot

al S

tat 5

p

A.

Western blot analysis was done as described in the materials and methods using

antibodies directed against either total or phospho-STAT5. Upper panel shows a

STAT5 A/B (1:250). The mi

h anti-STAT5 (1:250). Both the upper and middle panels are from the

same hippocampal samples. The lower panel shows a blot

(1:8000), again from the same samples. GH treatment did not affect protein

phospho-STAT5a/b, or NSE. B.

5a/b. In vitro treatment with GH (2 nM, 15-30 min) had no

ant effects on total or phospho-STAT5a/b (all p's >0.05). C. There was no

s

treated slices compared to control ACSF alone. Data shown represent the

6565

Figure 12.

A

6666

6666

B

Figure 12. GH-induced potentiation of the fEPSP was blocked by inhibition

f PI3 kinase, MAPK kinase and JAK2 tyrosine kinase.

A. Slices were pretreated for 30 min with 50 nM WORT (up-triangle, n=8), 20 µM

U0126 (circle, n=7), or 10 µM Tyrphostin AG490 (down-triangle, n=8) before the

application of GH (1 nM). The application of these inhibitors completely blocked

the normal enhancing effect of GH on excitatory synaptic transmission. In the

sample fEPSPs shown in the insets at the top, baseline responses are indicated

by thin lines and responses after GH application by thick lines.

B. Summary of effects of GH in slices pretreated with WORT, U-0126, and,

Tyrphostin AG-490. There was no change in fEPSP following GH application in

slices pretreated with WORT or U-0126 or Tyrphostin AG490 compared to

baseline (p>.05). The increase in fEPSP slope following treatment with GH alone

was significantly greater than slices pretreated with WORT, U-0126 and

Tyrphostin AG 490 (p<0.05). *p<.05 vs GH, **p<.01 vs GH.

o

6767

68

Figure 13.

A

68

6969

B

Figure 13. PI3-kinase and MAPK kinase inhibitors had no effect on the

maintained expression of GH enhancement of fEPSPs.

A. WORT (50 nM) or U-0126 (20 µM) was applied 30 min after the initial

application of GH (1 nM). Neither of these two inhibitors affected GH-dependent

enhancement of excitatory synaptic transmission when inhibitor treatment

followed initial GH application by 30 min. The insets at top illustrate the effects of

GH alone or GH with WORT or with U-0126 applied 30 min after beginning GH

treatment.

B. Neither WORT nor U0126 inhibited maintenance of GH-induced enhancement

of EPSPs. There was no significant difference between GH application alone or

GH followed 30 min later with WORT or U0126 (p>0.1). The increases in EPSP

slope following treatment with GH alone or GH followed by WORT or U0126

were all significant when compared with pre-GH baseline (**p<0.01, ***p<.001).

7070

71

Figure 14.

A

71

72

B

72

Figure 14. Protein synthesis was required for the induction of GH

enhancement of synaptic transmission.

A. Pretreatment of hippocampal brain slices with 60 µM cycloheximide for 30 min

before GH treatment (1 nM) completely blocked the normal GH enhancement of

excitatory synaptic transmission. The insets at top show example recordings from

individual slices (N= 6).

B. Summary comparison of the effects of GH alone, GH in slices pretreated with

cycloheximide, and cycloheximide alone. There was no significant difference

between GH application in slices pretreated with cycloheximide and control

treated with ACSF or cycloheximide alone (p>0.1). GH alone caused a

significantly greater increase in EPSP slope than GH+cycloheximide (p< 0.004).

7373

74

Figure 15.

A

74

7575

B

Figure 15. Protein synthesis was not required for maintained enhancement

of EPSPs by GH.

A. The application of cycloheximide (60 µM) beginning 30 min after the start of

GH treatment (1 nM) had no effect on GH-dependent EPSP enhancement. Slices

were treated with GH alone (squares), or with cycloheximide beginning 30 min

after initial application of GH (up-triangles). Control slices were treated with

cycloheximide alone (circles). The insets at the top show fEPSPs from individual

slices, (n = 7).

B. Summary comparison of the effects of GH, GH + cycloheximide,

cycloheximide alone, and ACSF alone. There was no significant difference

between GH alone and GH followed by cycloheximide (p>0.1). The increases in

EPSP slope following treatment with either GH or GH followed by cycloheximide

were significantly greater compared to both ACSF (p<0.005) and cycloheximide

(p<0.007) controls.

7676

Discussion

In vitro GH treatment increased the expression of GH receptor message in

hippocampus

One of the factors that contributes to differential tissue responsiveness to

GH is tissue-specific autoregulation of GHRs and GHBPs. I used RT-PCR to

determine the effect of GH treatment on the expression of GHRs in hippocampal

brain slices trea

ted with GH for 3 hours GH treatment increased the expression

re 10). This

also supported by the finding of Vikman et al. (1991) that

HR mRNA levels increased within 1 hr of a single injection of human GH (100

g/rat), with maximal levels being reached 3-12 hr after the injection. In the

ikman et al. (1991) study, the increase in GHR mRNA levels was dose

ependent, and also was observed after prolonged treatment (1 or 5 mg/kg/day

r 6 days) with bovine GH. Furthermore, there was a rapid GH-dependent

pregulation of GHR mRNA in adipose tissue (Vikman et al., 1991). Also, Le

reves et al. (2002) reported an increase in the expression of GHR gene

anscripts in young adult rats following GH treatment by s.c. injection for 10

ays.

of GHR mRNA compared to control treatment with ACSF alone (Figu

result is consistent with the previous findings of Hull and Harvey (1998), who

reported a 25-50% increase in GHR and GHBP mRNA in all brain regions of

hypophysectomized rats following a single bolus GH injection.

My results are

G

µ

V

d

fo

u

G

tr

d

7777

PI3 kinase, MAPK kinase, and JA kinase are necessary only for

e induction but not for the maintained expression of GH enhancement of

cts with cell-surface GHRs resulting in activation of the GHR-

associ

e

y

ic transmission

igure12). These data indicate that activation of JAK2, PI3-kinase and MAPK

signali

(1993)

x

are

998)

lso found that JAK2 activation by GH triggered various pathways including

K-2 tyrosine

th

excitatory synaptic transmission

GH intera

ated tyrosine kinase, JAK2, and triggering signaling cascades involving

STAT, Ras/Raf/MEK1/MAPK, and IRS-1/PI3-kinase pathways (Liang et al.,

2000). To investigate the role of JAK2, PI3-kinase and MAPK in mediating the

effects of GH on hippocampal synaptic transmission, I pretreated hippocampal

brain slices with tyrphostin AG 490 to block JAK2 protein tyrosine kinase,

wortmannin to block the PI3-kinase signaling pathway, and U-0126 to block th

MAPK pathway. Pretreatment of slices for 1 hr with these inhibitors completel

blocked the normal enhancing effect of GH on excitatory synapt

(F

ng pathways are required for the induction of GH effects on hippocampal

synapses.

My results are consistent with the earlier work of Argetsinger et al.

and Sotiropoulos et al. (1994), who reported that activation of GHR stimulates

JAK2 kinase and facilitates the association of GHR with JAK2 into a comple

with subsequent phosphorylation of both proteins. Many intracellular proteins

subsequently phosphorylated in a cascade, including MAPK. Kim et al. (1

also reported the requirement for GHR and JAK2 activation in GH signaling.

They a

7878

the Ras/MAPK, STAT, and IRS/PI3-kinase systems. Yamauchi et al. (1998) also

reported that the PI3-kinase signaling pathway is important in mediating GH

effect on 3T3 L1 adipocytes. They reported that wortmannin, a specific PI3-

kinase

and

ole for PI3-kinase or MAPK in the maintenance of GH-dependent

PSP enhancement. My findings are consistent with the observation of Opazo et

al. (20

y et

inhibitor, completely blocked the anti-lipolytic effect of GH on 3T3 L1

adipocytes. Yamauchi et al. (1998) reported that GH induced tyrosine

phosphorylation of IRS-1/IRS-2 in liver, with JAK2-phosphorylated IRS-1, -2,

-3 providing docking sites for p85 PI3-kinase and activating PI3-kinase for

downstream biological effects.

To determine if the PI3-kinase and MAPK signaling pathways are required

for the maintained expression of GH effects I treated hippocampal slices with

WORT or U0126 beginning 30 min after initiation of GH treatment. Neither

WORT nor U0126 had any inhibitory effect on already established GH

enhancement of hippocampal synaptic transmission (Figure 13), suggesting that

there is no r

E

03) that PI-3 kinase is specifically involved in the induction of tetanus-

induced LTP, but is not required for maintenance of LTP.

How might PI-3 kinase lead to enhanced synaptic transmission? Opazo et

al. (2003) argued that PI3-kinase leads to downstream activation of the ERK

pathway in tetanus-induced LTP. Other possibilities were suggested by Impe

al. (1998) and Davis et al. (2000), who reported that ERK activation contributed

7979

to LTP induction by facilitating transcriptional events, mRNA synthesis and

protein synthesis. The effective blockade of L-LTP requires treatment with a

translational inhibitor around the time of L-LTP induction, whereas treatment

L-LTP induction produces no effect (Otani et al., 1989; Frey and Morris, 1997

Alltogether, there is considerable evidence that both protein synthesis a

kinase activation are important for the induction but not the maintenance of LTP.

Based on the roles of pro

after

).

nd PI3-

tein synthesis and PI3-kinase, it seems possible

at MAPK and ERK activation are also important for the induction of LTP but not

for the

0).

locked by

of

lices blocks

ubsequent synaptic potentiation by tetanus.

th

maintenance of LTP. Both PI3-kinase and MAPK signaling pathways are

important for LTP induced by repeated tetanization; MEK inhibitors strongly

reduce the induction of LTP by TPS (Winder et al., 1999; Watabe et al., 200

Furthermore, LTP induced by short trains of TPS is almost completely b

the PI3-kinase inhibitors LY294002 and wortmannin (Opazo et al., 2003). The

marked similarity in pathways required for GH enhancement of excitatory

synaptic transmission and for tetanization induced L-LTP suggests that

competition within a common set of pathways may be the underlying cause

my finding that GH pretreatment of rat hippocampal brain s

s

8080

GH treatment of in vitro hippocampal brain slices does not affect total

phospho-STAT5A/B protein levels.

GH activates JAK2 tyrosine kinase and members of the STAT family of

transcription factors, including STATs 1, 3, and 5 (Smit et al., 1997). GH plays a

important role in specific gene transcription through transient phosphorylational

activation of STAT proteins (Rico-Bautista et al., 2004). GH-induced STAT5

or

n

NA-binding activity was detected after 2 min, reached a maximum at 10 min,

decrea

es

Although GH has well known stimulating effects on three major signaling

athways, there is considerable variability in the level of activation of these

ifferent pathways among different tissues, and a corresponding variability in the

importance of these three pathways in mediating specific effects of GH. For

D

sed rapidly with up to 1 hr of GH treatment, and declined slowly with even

longer GH treatment (Fernandez et al., 1998). At least two STAT5 proteins

(STAT5A and STAT5B) exist in mouse and human (Smit et al., 1997). GH

activates both STAT5A and STAT5B in several cell types (Smit et al., 1997).

GH-dependent tyrosyl phosphorylation of both STAT5A and STAT5B requires

the same specific regions of GHR and activation of JAK2 kinase (Smit et al.,

1997). To determine the effect of GH treatment on the expression of total and

phospho-STAT5a,b, I used western blot analysis of hippocampal brain slic

treated with GH (2 nM) for 15-30 min. GH treatment did not affect protein

expression of total or phospho-STAT5a/b compared to ACSF alone control

(Figure 11).

p

d

8181

example, Yamauchi et al. (1998) found that GH induced tyrosine phosphorylatio

of IRS-1/IRS-2 in liver, and the IRS-1 a

n

ugmentation of Ras/Raf/MEK1/MAPK and

PI3K p

e

hr

d

TAT5b via dephosphorylation by phospho-tyrosine phosphatase.

ecause JAK2/STAT5 signaling is enhanced by protein synthesis inhibitors,

wherea

athways was greater than the tyrosine phosphorylation of STAT5 (Liang et

al., 2000). Also, Ji et al. (2002) reported that unlike the JAK2/STAT5 pathway,

the effect of GH on activation of the MEK/ERK and PI3-kinase/Akt pathways did

not recover following prolonged incubation in the absence of GH. Finally,

Friedrichsen et al. (2001) found that JAK2/STAT5 signaling pathway was

required for GH/PRL-induced pancreatic beta-cell proliferation; however, MAPK,

PI3K, and PKC signaling pathways were not required.

I also found that GH action on excitatory synaptic transmission was

blocked by pretreatment with cycloheximide, a protein synthesis inhibitor (Figur

16). In contrast, Fernandez et al. (1998) observed that JAK2 tyrosine

phosphorylation and STAT5 DNA-binding activity were prolonged for at least 4

in the presence of cycloheximide. These discrepant observations can be

explained by Gebert et al. (1999), who found that termination of GH-induce

STAT5b signaling is a complex process involving down-regulation of JAK2

signaling to S

B

s GH enhancement of excitatory synaptic transmission was prevented by

protein synthesis inhibition, it seems even more unlikely that JAK2/STAT5 is

required for GH effects on hippocampal excitatory synaptic transmission.

8282

Protein synthesis is necessary for the induction but not the maintenance of

GH enhancement of synaptic transmission

Protein synthesis in mammals is required for memory formation (Flexner

et al., 1963; Davis and Squire, 1984). Studies in hippocampal slice preparations

have distinguished two phases of LTP, an early phase (E-LTP) lasting for 2 hr

and a late phase (L-LTP) greater in amplitude and longer in duration more

hr, based on different sensitivities to mRNA and protein synthesis inhibitor

(Nguyen et al., 1994). In my experiments, GH enhanced excitatory synaptic

transmission in CA1 area of rat hippocampus, and this

than 3

s

effect lasted for more than

hour Because of the similar nature of the enhancement, and the similarity in

signali es as

tic

uction

y

,

onsequence of their translational blockade.

3 s

ng pathways, we may consider the GH effect on hippocampal synaps

a form of L-LTP. Kelleher et al. (2004a) reported the dependence on

macromolecular synthesis for long lasting forms of memory and synap

plasticity in rodent hippocampus that might reflect regulation at the transcriptional

or translational level. To investigate the role of protein synthesis in the ind

of GH-dependent L-LTP, I pretreated hippocampal brain slices with 60 µM

cycloheximide for 30 min before GH treatment. This pretreatment completel

blocked the normal effect of GH on excitatory synaptic transmission (Figure 14)

emphasizing the importance of protein synthesis in the induction of GH-

dependent L-LTP. The validity of this interpretation of my data is supported by

the finding of Kelleher et al. (2004a) who showed that the effects of protein

synthesis inhibitors on long lasting synaptic plasticity are the specific

c

8383

Several agonists can induce long-lasting protein synthesis-dependent

forms of LTP, including the neurotrophins BDNF and NT4, forskolin and the

cally

treatment.

of GH

al.

dy

memberane–permeable cAMP analog Sp-cAMP, and D1/D5 dopamine receptor

agonists (Kang and Schuman, 1995). It is well known that L-LTP induced by

repeated tetanization is dependent on protein synthesis. However, there are

differences between L-LTP induced by pharmacological agents and L-LTP

induced by repeated tetanization. Kelleher et al. (2004a) reported that chemi

induced L-LTP differs from tetanization induced L-LTP in that it develops

gradually, requires 1-2 hr to reach a maximum level, and is nullified completely

by pretreatment with protein synthesis inhibitors (Kelleher et al., 2004a).

To test the role of protein synthesis in the maintenance of GH-dependent

L-LTP, I applied cycloheximide beginning 30 min after initiation of GH

Cycloheximide applied 30 min after GH had no effect on the maintenance

enhanced excitatory synaptic transmission (Figure 15). Studies on L-LTP have

indicated that effective inhibition requires treatment with a translational inhibitor

around the time of L-LTP induction, whereas delayed treatment after L-LTP

induction has no effect (Otani et al., 1989; Frey and Morris, 1997). Kelleher et

(2004a) reported that rates of protein synthesis increased rapidly following L-LTP

induction. They added that failure of translational inhibitors to affect alrea

established L-LTP argues against the simple requirement of ongoing protein

synthesis to maintain steady-state protein level.

8484

Previous studies indicate that repeated tetanization induces rapid

enhancement of protein synthesis, which is necessary for full L-LTP express

(Kelleher et al., 2004a). Also, increased rates of protein synthesis can be

detected rapidly after L-LTP induction (Kelleher et al., 2004b). Taken together

both kinds of L-LTP, drug-induced and tetanization-induced, require protein

synthesis for their induction, then we might expect competitive inhibition of

tetanus-induced L-LTP by previous GH-induced L-LTP.

ion

, if

for

he PI-3 kinase pathway and

rotein synthesis. Solid lines indicate direct effects and dashed lines indicate

indirect effects.

Figure 16. Diagrammatic illustration of the proposed signaling pathway

GH in the hippocampus. GHR dimerization and activation of JAK2 leads to

stimulation of the MAPK pathway, stimulation of t

p

8585

How m tic

of the

I3-

tic

of substrate proteins or

interactions

et al. (2000) reported that IRS-1 expression augments both the

as/Raf/MEK1/MAPK and the PI3K pathways. So there is a possibility that GH

sal

ight growth hormone contribute to enhanced excitatory synap

transmission in rat hippocampus?

GH activates GHRs leading to receptor dimerization and activation

non-receptor tyrosine kinase, JAK2. JAK2 activation by GH triggers the activation

of various pathways including Pl3-kinase and the Ras/MAPK systems. Both P

kinase and MAPK mediate GH-dependent enhancement of excitatory synap

transmission in rat hippocampus through phosphorylation

stimulation of protein translation. The GH activation of PI3-kinase and MAPK

pathways begins with GH-induced JAK2 phosphorylation, since GH effects on

EPSPs were blocked by the JAK2 inhibitor. In support of the requirement for

JAK2, Kim et al. (1998) found that GHR and JAK2 activation are required for GH

signaling, and Yamauchi et al. (1998) reported that activation of JAK2 by GH

binding to its receptor mediates the biological actions of GH.

Although JAK2, PI-3 kinase and MAPK are required, the specific

leading from JAK2 to PI-3 kinase and MAPK are not certain. Liang

R

activates JAK2, which in turn activates IRS-1, which then mediates GH-

dependent activation of both PI3-kinase and MAPK. To test this possibility, we

would need to be able to assay IRS activation by phosphorylation, and the cau

relationship of IRS phosphorylation with respect to both PI-3 kinase and MAPK

activation.

8686

The second possibility is that activated GHR-JAK2 in turn activates the

H stimulates tyrosine phosphorylation of

the ep

e

t L-

is regulation could

ccur at either the translational level or the transcriptional level, or both.

Howev lation at

,

the presence of

n of

for synaptic regulation.

MAPK signaling pathway without a requirement for IRS or PI-3 kinase.

Yamauchi et al. (1998) reported that G

idermal growth factor receptor and causes its association with Grb2,

resulting in stimulation of the MAPK signaling pathway in liver. In addition,

Vanderkuur et al. (1997) reported that GH promoted the rapid, transient

association of SHC with the Grb2-SOS complex, which correlated with the time

course of Ras, Raf, and MEK activation. In the Vanderkurr et al. (1997) study,

Ras, Raf, and MEK returned to near basal activity after 15 to 30 min despite th

continuous presence of GH. Further investigation will be required to determine

the specific pathway linking GHR-JAK2 to MAPK in the hippocampus.

Synthesis of new proteins is required for the induction of GH-dependen

LTP of excitatory synaptic transmission in rat hippocampus. Th

o

er, the rapid onset of GH effects favors the enhancement of trans

the ribosomal level. This hypothesis is supported by the finding of Bodian (1965)

Autilio et al. (1968), and Morgan and Austin (1968) who reported

ribosomal assemblies in neuronal dendrites and the ability of isolated synaptic

fractions to support de novo protein synthesis. In addition, the observatio

Steward and Levy (1982) that dendritic polyribosomes preferentially localized

near postsynaptic sites, suggests that local protein synthesis may be important

8787

An important question, as yet unanswered, is how GH promotes local

protein synthesis. As a potential mechanism, I propose that GH activation of PI3-

kinase t

nd Le

nts

n into

olve this

ay

nhances protein synthesis at the transcription level. In favor of this possibility is

the fin

ic

leads to activation of another mediator that promotes protein synthesis a

the level of translation. This proposal is supported by Chou et al (1998) a

Good et al. (1998), who reported that PI3-kinase stimulates PDK-1, activating

PKCζ. Further support comes from the finding that inhibition of PKCζ preve

LTP in the hippocampal CA1 region (Ling et al., 2002). Further investigatio

GH-dependent L-LTP, for example, with PKCζ inhibitors, may help to res

issue.

Although there is evidence for GH stimulation of protein synthesis via

activation of PI-3 kinase, the MAPK pathway could also link GHR activation to

protein synthesis. I propose that GH through stimulation of MAPK pathw

e

ding of Hodge et al. (1998) that GH promotes phosphorylation of Elk-1

which in turn causes transcriptional activation. In addition, these same authors

found that overexpression of dominant-negative Ras and the ERK-specif

phosphatase (mitogen-activated protein kinase phosphatase-1), and the

application of MEK inhibitor PD098059, blocked GH-stimulated activation of

Ras/MEK/ERK pathway and abrogated the GH-induced stimulation of the

transcription factors Jun N-terminal kinase and Elk-1 in 3T3-F442A cells.

8888

NMDA Receptor-Mediated Effects of Growth Hormone

Section III

8989

Introduction

Functional roles of NMDAR subunits composition

The NMDAR is an ionotropic glutamate receptor defined by its selective

activation by the agonist N-methyl-D-aspartate. The NMDAR plays crucial roles

in synaptic plasticity and development, and also in excitotoxic injury (Grosshans

and Browning, 2001, Mallon et al., 2004). NMDARs are multimeric proteins

containing two obligatory NR1 subunits, usually paired with two NR2A or NR2B

subunits (Cull-Candy et al., 2001).

While the NR1 subunit is obligatory for channel function, the NR2

composition plays an important functional modulatory role, affecting channel

kinetics and pharmacology (Yoshimura et al., 2003). Differences in NR2 subunit

composition underlie age-dependent changes in NMDAR dependent excitatory

postsynaptic current (EPSC) kinetics and pharmacology (Flint et al., 1997). The

proportion of the cells displaying fast NMDAR EPSCs and NR2A increases

during postnatal development (Flint et al., 1997). In visual cortex, NR2 subunit

composition changes with visual experience, in addition to age, affecting

neocortical plasticity through differential subunit regulation at inhibitory and

excitatory connections (Yoshimura et al., 2003).

LTP induction depends on both NMDA receptor-mediated Ca2+ influx and

subunit-specific signaling, with the intracellular C-terminal domain of the NR2

9090

subunits directing signaling pathways with an age-dependent preference (Kohr et

l., 2003). LTP induction at mature CA3-to-CA1 connections results primarily

om NR2A-type signaling and NR2A-type receptors. Mutant mice lacking the

tracellular C-terminal domain (NR2A∆C/∆C) were deficient in calcium signaling

quired for LTP induction (Kohr et al., 2003). In young (<14 day old), but not

ature (>42 day old) mice, NR2B-containing receptors participated in LTP

duction. Consistent with the different roles of NR2A and NR2B in immature

nd adult hippocampus, CA3-to-CA1 LTP in NR2A∆C/∆C was more strongly

duced in adult than young mice, but could be restored to wild-type levels by

repeated tetanic stimulation (Kohr et al., 2003).

NMDARs have been implicated in both LTP and LTD for many years

(Dudek and Bear, 1992; Bliss and Collingridge, 1993). The ability of NMDARs to

participate in opposite forms of synaptic plasticity may be related to the pattern of

synaptic activation required to induce LTP or LTD. These different patterns of

synaptic stimulation resulted in corresponding differences in calcium signaling.

Long trains of low frequency synaptic stimulation produce modest but prolonged

elevation of intracellular calcium ion leading to LTD via the activation of

phosphatases (Lisman, 1989). On the other hand, high frequency trains of

synaptic stimulation produce a greater rise in intracellular calcium leading to LTP

via stimulation of protein kinases (Lisman, 1989). An additional factor allowing

NMDARs to participate in multiple, opposing forms of plasticity is the NR2

subunit composition of the receptor, since activation of NMDARs can produce

a

fr

in

re

m

in

a

re

9191

either increases or decreases in synaptic efficiency depending on subunit

composition (Bliss and Schoepfer, 2004).

specific antagonists ( Nishiyama et al., 2000;

ummings et al., 1996). On the other hand, APV (0.5 µM) prevented HFS-

induce lective

A

distinct roles in long-term

ynaptic plasticity (Erreger et al., 2005). Recordings from outside-out patches

that co

Ifenprodil (3 µM) and Ro25-6981 (0.5 µM), selective antagonists of the

NR2B subunit, completely blocked LTD induced by low-frequency stimulation

(Liu et al., 2004; Williams, 2001). Although LTP is more sensitive to partial block

of NMDARs by low concentration of APV, neither Ifenprodil nor Ro25-6981

affected the induction of LTP by high frequency stimuli (HFS), indicating the

selective blockade of LTD by NR2B

C

d LTP without affecting LFS-induced LTD (Liu et al., 2004). The se

effect of low dose APV on LTP was explained by a requirement for NR1-NR2

NMDARs (Liu et al., 2004), since the NR2A containing NMDARs are more

sensitive to APV blockade than NR2B containing receptors (Buller et al., 1994).

An NR2A specific antagonist NVP-AAMO77 (0.4 µM) prevented both normal LTP

induced by a single episode of HFS and saturated LTP induced by multiple

episodes of HFS, but had little effect on LFS-induced LTD (Liu et al., 2004).

The relative expression levels of NR2A and NR2B is regulated

developmentally and may allow NMDARs to play

s

ntain a single active channel show that NR2A-containing receptors have a

higher probability of opening and a higher peak open probability than NR2B-

9292

containing receptors in response to a brief synaptic-like pulse of glutamate

(Erreger et al., 2005). At high frequency tetanic stimulation (100 Hz; >100ms),

typically used to induce LTP, the charge transfer mediated by NR1/NR2A

considerably exceeds that of NR1/NR2B (Erreger et al., 2005). In contrast,

under low frequencies simulation typically used to induce LTD (1 Hz), NR1/NR

makes a larger contribution to total charge transfer and therefore calcium in

than NR1/NR2A (Erreger et al., 2005).

Additional regulatory control over NMDAR function is exerted by subunit

specific phosphorylation of NMDARs (Lau and Hu

2B

flux

ganir, 1995). In particular,

rosine phosphorylation of NR2 subunits is thought to be important for regulating

NMDA nity

,

tion

ty

receptor function (Lau and Huganir, 1995). Studies using immunoaffi

chromatography of detergent extracts of rat synaptic plasma membranes on anti-

phosphotyrosine antibody-agarose demonstrated that the NR2A and NR2B

subunits, but not NR1 subunits, are tyrosine-phosphorylated (Lau and Huganir

1995). The selective tyrosine phosphorylation of NR2A and NR2B, but not NR1,

was confirmed by immunoprecipitation of the NR1, NR2A, and NR2B subunits

with subunit specific antibodies followed by immunoblotting with anti-

phosphotyrosine antibodies (Lau and Huganir, 1995). Tyrosine phosphoryla

of glutamate receptors was specific to the NMDA receptor. No tyrosine

phosphorylation of the AMPA (GluR1-4) or kainate (GluR6/7, KA2) receptor

subunits was detected (Lau and Huganir, 1995).

9393

Protein kinase C (PKC) potentiates NMDA receptor function via acti

of non-receptor tyrosine kinases leading to

vation

tyrosine phosphorylation of NR2A

and/or NR2B (Grosshans and Browning, 2001). Tyrosine phosphorylation of both

NR2A -

ns

ar

s

ensity protein of 95 kDa (PSD-95) (Gardoni et al., 2001). The dynamic and

recipro important

n of

l

and NR2B is increased following treatment of rat hippocampal CA1 mini

slices with 500 nM phorbol 12-myristate 13-acetate (PMA) for 15 min (Grossha

and Browning, 2001). Phosphorylation of serine 890 on the NR1 subunit is

increased with PMA treatment for 5 min with phosphorylation returning to ne

basal levels by 10 min while tyrosine phosphorylation of NR2A and NR2B wa

sustained for up to 15 min (Grosshans and Browning, 2001). Phosphorylation of

NR2A, NR2B and NR1 was blocked by pretreatment with the selective PKC

inhibitor chelerythrine, with the tyrosine kinase inhibitor Lavendustin A or with the

Src family tyrosine kinase inhibitor PP2 (Grosshans and Browning, 2001).

One additional mechanism for regulating NMDAR function is protein-

protein interactions among the distinct protein components of the postsynaptic

density (PSD). The three major components of the PSD are the NMDAR, the

Ca2+/ calmodulin-dependent protein kinase II (α-CaMKII), and the postsynaptic

d

cal interactions of the NMDAR, α-CaMKII, and PSD-95 have an

role in hippocampal synaptic plasticity (Gardoni et al., 2001). The associatio

both native and recombinant α-CaMKII and PSD-95 depends on the C-termina

NR2A (S1389-V1464) sequence (Gardoni et al., 2001). Activation of NMDARs,

by either pharmacological means or by LTP-inducing synaptic stimulation,

9494

modulated the association of α-CaMKII and PSD-95 with the NR2A C-tail

(Gardoni et al., 2001).

Correlation of GH, GluRs, MEK/ERK and Pl 3-kinase/Akt pathways

GH modulates many functions of the central nervous system, improving

memory, alertness and motivation (Fargo et al., 2002). It is well documented tha

GH secretion declines slowly with age r

t

eaching 25% of the adolescent level in

ery old age (Corpas et al., 1993). Magnusson et al. (2002) demonstrated a

signific

s

e

anges in

ease of

nths

ession of these receptor

ubtypes.

v

ant drop in the protein expression of the major subunits of the NMDA

receptor occur during the aging process. They indicated that subunit alteration

may explain some of the changes that are seen in NMDA receptor functions

during aging.

Sonntag et al. (2000) studied the effects of age and chronic insulin-lik

growth factor-1 (IGF-1) administration on NMDA receptor density and subtype

expression in frontal cortex, CA1, CA2/3 and the dentate gyrus of the

hippocampus of young (10 months), middle-aged (21 months) and old (30

months) male Fisher 344xBrown Norway (F1) rats. No age-related ch

125I-MK-801 binding or NMDAR1 protein expression were observed in

hippocampus or frontal cortex. However, they reported a significant decr

NR2A and NR2B protein expression in hippocampus between 21 and 30 mo

of age, and administration of IGF-1 increased expr

s

9595

In addition, GH might affect the expression of NMDA receptors in a more

direct way. GH treatment by subcutaneous injection for 10 days caused up

regulation of GHRs and NR2B receptor subunits, and led to a significant increase

in the NR2B/NR2A ratio in the hippocampus of young adult rats (Le Greves et a

2002). Aging normally leads to decreased NR1 expression in rats. This age-

dependent effect was antagonized by GH treatment (Le Greves et al., 2002)

Le Greves et al. (2002) found a significant positive correlation between the leve

of GHR mRNA and NR2B gene transcripts indicating a GHR-mediated effect on

the synaptic function of the NMDAR complex.

Declining GH during aging may have other consequences for the synaptic

mechanisms of memory. GH induces the activation of Raf/MEK1/MAPK and

l.,

.

l

PI3-

inase pathways in several different tissues (Winston and Hunter, 1995;

Vande l.,

al.,

zo

k

rkuur et al., 1997; Hodge et al., 1998; Yamauchi et al., 1998; Kim et a

1998; Liang et al., 2000; Ji et al., 2002). NMDA receptor-dependent LTP is

inhibited by drugs that inhibit PI3-kinase and MAPK/ERK activation (Opazo et

2003). Several findings indicated that the Ras signaling pathway has an

important role in NMDA receptor-dependent forms of synaptic plasticity (Opa

et al., 2003). Hippocampal LTP is altered in mice with mutations affecting H-Ras

(Manabe et al., 2000), Ras GTPase-activating protein NF1 (neurofibromin)

(Costa et al., 2002) or SynGAP (a synaptic Ras-GTPase activating protein)

(Komiyama et al., 2002). PI3-kinase inhibitors also inhibt NMDAR mediated ERK

activation (Opazo et al., 2003).

9696

In addition to regulating MAPK/ERK activation, PI3-kinase may con

to LTP by controlling the

tribute

trafficking of AMPA-type glutamate receptors. PI3-

inase is involved in the trafficking and insertion of GluR1 subunits of AMPA-type

chang

ly

itter

nists to pharmacologically isolate NMDAR and AMPAR

omponents of synaptic transmission, tested GH for effect on these isolated,

compo

have

nt

k

glutamate receptors (Passafaro et al., 2001), including activity-dependent

es in AMPA receptor trafficking-insertion that are implicated in LTP

(Malinow and Malenka, 2002). Membrane insertion of GluR1-containing AMPA

receptors induced by NMDA receptor activation in cultured neurons is complete

blocked by the PI3-kinase inhibitor wortmannin (Passafaro et al., 2001).

To answer the question, whether GH effects on hippocampal synaptic

function are mediated by NMDARs or AMPARs? I used specific neurotransm

receptor antago

c

nents and compared the isolated NMDAR-mediated fEPSPs (fEPSPNs)

and isolated AMPAR-mediated fEPSPs (fEPSPAs) to the dual component

fEPSPs. To address the question, does short-term treatment with GH

similar consequences on NMDAR expression as long-term, chronic treatme

with GH? I used western blotting to measure NMDA-NR1, NR2A, and NR2B

expression levels in GH treated and control rat hippocampal slices.

9797

Materials and Methodes

Electrophysiology

The methods used for hippocampal slice preparation, field potential

recording and data analysis were as discussed in section I. To isolate AMPA

dependent responses I treated slices with the NMDAR antagonist 5-amino-

R-

specific competitive antagonist of

MPAR, and bicuculline methiodide (BMI 10 µM), a specific competitive

antago

phosphovaleric acid (D-AP5 50 µM) for 30 min before GH application. To isolate

NMDAR-dependent responses, hippocampal slices were pretreated with 6-7-

dinitroquinoxalline-2-3-dione (DNQX 30 µM), a

A

nist of the GABAA

d has

receptor, for 30 min before application of GH. This

pharmacological method of isolating AMPAR- and NMDAR-mediated synaptic

responses was originally described by Davies and Collingridge (1989), an

been widely used since then.

Western Blotting

To examine the effect of GH on the expression of NMDAR subunit

hippocampal slices were prepared as described in earlier sections and allowed t

recover for 1 hour After recovery, slices obtained from the same animal were

placed into 2 separate interface chambers. The slices in one chamber were

exposed to ACSF alone to serve as a control, and the slices in the other cha

were exposed to ACSF + GH (2 nM). After 3 hours of treatment, both groups of

s,

o

mber

9898

slices were rapidly frozen on dry ice and stored at -80 °C until used for protein

isolation.

Hippocampal slices were homogenized in protein lysis buffer [1% Nonidet

P-40 (NP-40), 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SD

0.15 M NaCl, 0.01 M sodium phosphate, pH 7.2, 2 mM ethylenediamine

tetraacetic acid (EDTA), and 1% protease inhibitor cocktail]. Then, burst

sonication was done (< 10 sec), and samples were centrifuged at 14,000 × g for

20 min. at 4 °C. The supernatant solution was obtained and total protein

S),

estimated using the Bradford method (Bradford, 1976). Equal amounts of total

protein %

were

room

and

,

4

on X-ray

film (Fuji Medical System USA, Inc., Stamford, CT) using the ECL system

mersham-Pharmacia), following the manufacturer’s instructions. To correct for

ossible loading differences, blots were probed with an antibody to neuron-

pecific enolase (NSE). The following primary antibodies were used: anti-NSE

from GH treated slices and control slices (200 µg) were separated on 8

polyacrylamide gels. The separated proteins were transferred to nitrocellulose

membranes (Micron Separations, Inc., Westboro, MA). The membranes

blocked (1 hour at room temperature) in 5% nonfat dry milk in T-T-S (0.5%

Tween-20, 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.2 mM EDTA), and then

incubated with primary antibody diluted in 5% non-fat dry milk in T-T-S (at

temperature for 1 hour, or overnight at 4 °C). Membranes were then washed

incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies

diluted 1:5000 in 5% non-fat dry milk in T-T-S (1 hour at room temperature or

°C overnight). Blots were washed again and proteins were detected

(A

p

s

9999

(AB951, Chemicon Internat ti-NMDA-R1 (60021A,

harMingen International, 1:1000), anti-NMDA-R2A (AB1555P, Chemicon, 1:500

DA-R2B (N38120, Transduction Laboratories, 1:2000 to

ional, 1:6000 to 1:8000), an

P

to 1:2000), anti-NM

1:4000).

Reagents

Reagents used in this study were recombinant human GH (rhGH)

(Bachem), ranging from 1-2 nM (22-44 ng/ml); bicuculline methiodide (BMI 10

µM), 6-7-dinitroquinoxalline-2-3-dione (DNQX 30 µM) (Tocris) and 5-amino-

phosphovaleric acid (D-AP5 50 µM). BMI and DNQX were dissolved in D

AP5 was dissolved in 100 mM NaOH.

MSO.

100100

Results

NQX

shown

mined

,

s in

GH-induced potentiation of NMDAR-mediated fEPSPs (fEPSPNs)

To determine if GH can enhance NMDAR-mediated excitatory synaptic

transmission, I isolated fEPSPNs by pretreating hippocampal slices with D

(30 µM) to block AMPARs and BMI (10 µM) to block GABAA receptors (as

in figure 17 and 19). GH enhanced pharmacologically isolated NMDAR-mediated

excitatory synaptic transmission in CA1. To ensure that the response exa

in this experiment was actually due to NMDAR activation, I applied AP5 (50 µM)

to block NMDARs, at the end of the two hours period of GH application. AP5

blocked the previous GH enhancement, verifying that GH had acted through

NMDARs to enhance excitatory synaptic transmission.

GH-induced potentiation of AMPAR-mediated fEPSPs (fEPSPAs)

To determine if GH enhances AMPAR-mediated excitatory synaptic

transmission in the CA1 region, I pretreated hippocampal slices with AP5 (50 µM)

beginning 30 min before GH application to isolate fEPSPAs (Figure18 and 19).

GH caused significant enhancement of fEPSPAs. GH enhancement of fEPSPAs

was significantly greater than the dual component fEPSPs (when GH was

applied without AP5). This result suggests that GH can act through AMPAR

addition to NMDARs.

101101

GH treatment decreased the expression of NR2B protein

NMDARs have an important role in synaptic plasticity (Grosshans and

Browning, 2001; Mallon et al., 2004). Previous studies showed that NMDAR

activation can produce either increases or decreases in synaptic efficiency

epending on the subunit composition of NMDAR (Bliss and Schoepfer, 2004). In

estigate the effect of GH treatment on subunit composition of

(2

e

sed

d

order to inv

NMDARs, hippocampal brain slices were perfused in ACSF containing GH

nM) for 3 hours Control slices were perfused with ACSF alone for the same tim

period. Western blotting of hippocampal slice homogenates revealed decrea

protein expression of NR2B, but no change in NR2A or NR1 (Figure 20).

102102

igure 17. GH enhanced isolated NMDAR-mediated fEPSPs (fEPSPNs).

ore GH

application) with DNQX (30 µM) to block AMPA receptors and BMI (10 µM) to

block G A 5, at

response recorded during the pre-GH baseline period (thin solid line), the

was

compared to baseline recording and compared to ACSF alone control

re was no significant difference between application of

H alone and GH+DNQX+ BMI, p>.05.

F

GH (1 nM) enhanced fEPSP in slices pretreated (beginning 30 min bef

ABA receptors. Addition of the NMDAR competitive antagonist, AP

the end of the two hours GH application period verified that the enhanced fEPSP

was mediated by NMDA receptors (see the inset top left). The inset shows the

response during 2nd hour of GH treatment (thick solid lines), and the response

after addition of AP5 (dotted line). Significant enhancement of fEPSP slope

obtained in both GH alone (squares, n=10) and GH+DNQX (circles, n=5)

(diamonds), p<.05. The

G

103103

Figure 18. GH enhanced isolated AMPAR-mediated fEPSPs (fEPSPAs)

GH (1 nM) enhanced fEPSP slope in slices pretreated with AP5 (50 µM,

beginning 30 min before GH application) to block NMDARs. The inset shows

fEPSPs during the 15 min baseline recording (thin lines), and fEPSPS during the

2ndh of GH treatment (thick lines) either in the presence (n=6) or absence of AP5,

(n=10). GH significantly enhanced fEPSP in the presence of AP5 (uptriangles)

compared to its absence (squares, p<.05). EPSPs slope was significantly

enhanced in both the presence and absence of AP5 compared to baseline

recording and compared to ACSF control (diamonds, p<.05).

104104

0

100

200

300

400

500

ACSF GH

GH+DNQX+B

MI

GH+AP5

fEP

SP

slo

pe (%

bas

elin

e)

1st hr

2nd hr

+

+

+ns

*

Figure 19. Summary comparison of effects of GH alone, GH+DNQX+BMI,

GH+AP5 and control ACSF. GH enhanced both fEPSPNs and fEPSPAs. Non

the dual component fEPSPs. Results represent the mean ± SE during the

,

+ = significant difference at p<0.02 compared to pre-GH baseline and ACSF

significant change between the GH enhancement of fEPSPNs and dual

component fEPSPs. GH enhancement of fEPSPAs was significantly higher than

indicated time periods; * = significant difference at p<0.04 compared to GH

treatment alone, ns = nonsignificant compared to GH application alone at p>0.3

alone.

105105

106106

A.

Figure 20

B

90

95

100

105

NR1 NR2A NR2B

rol)

80

85

Type of the NMDA receptor subunit

Mea

n gr

ey (%

con

t

**

106106

Figure 20. GH decreased NR2B, but not NR1 or NR2A protein

A. Hippocampal slices were treated with 2 nM GH or ACSF alone for 3 hours.

Western blotting of slice homogenates revealed decreased NR2B protein in GH

treated tissue. NR2A and NR1 levels were unaffected by GH treatment. NSE was

used as a loading control.

B. Statistical analysis of GH effects on NMDAR subunit expression. Blots were

analyzed by densitometry, and normalized relative to control. GH caused a

significant decrease in NR2B protein (**p<0.007, n = 12), but NR1 (p<0.2, n =12)

and NR2A (p<0.2, n =12) were not altered by GH.

107107

Discussion

GH affects the expression of NMDARs, which are required for normal

emory function. In tetanization-induced LTP, NMDARs play an important role in

the induction of synaptic potentiation, by allowing calcium influx into postsynaptic

neurons during high frequency stimulation, and the block of NMDARs, for

example, by AP5, inhibits LTP (Bliss and Collingridge, 1993). It is well known

that LTP is triggered by calcium influx into postsynaptic neurons in the CA1 area

of the hippocampus. Although metabotropic GluRs and voltage-gated calcium

channels contribute to postsynaptic calcium increase under some circumstances,

NMDARs are the major route for calcium entry (Bliss and Collingridge, 1993). To

isolate NMDAR mediated synaptic responses and examine effects of GH, slices

were perfused with ACSF containing DNQX and BMI beginning 30 min before

and continuing during GH treatment (Figure 17). I found that GH caused an

enhancement of fEPSPNs that appeared essentially identical in amplitude and

time course with the GH-enhancement of dual component fEPSPs. Thus, the

enhancing effect of GH on fEPSPs in area CA1 is mediated in part by NMDARs.

Previous studies indicated that over activation of NMDARs before or

during tetanic train reduces the probability to generate LTP of the fEPSPAs

(Coen et al., 1989; Huang et al., 1992; Izumi et al., 1992; Neuman et al., 1987),

without preventing LTP of pharmacologically isolated fEPSPNs (Bashir et al.,

m

108108

1991; Berretta et al., 1991; Gozlan et al., 1994; Xie et al., 1992). To determine if

al inhibition of NMDARs by AP5 and treatment with

on NMDARs, and

pplication of strong tetanic stimulation significantly potentiated the isolated

PSPAs. However, strong tetanus in the absence 7Cl¯-kyn did not affect

PSPAs. In the study of Aniksztejn and Ben-Ari (1995), the authors tested the

ypothesis that the expression of LTP by AMPARs and NMDARs depends on the

egree of NMDAR activation during the tetanus. They found that LTP of

PSPAs has a lower threshold than that of fEPSPNs. They suggested that tetani

at generate LTP of fEPSPNs have a low probability of inducing LTP of

PSPAs. They concluded that AMPA and NMDA components are potentiated

rough two different postsynaptic processes. Aniksztejn and Ben-Ari (1995)

roposed a model representing the relative contribution of AMPARs & NMDARs

LTP as function of degree of NMDAR activation (Figure 21).

GH enhancement of excitatory synaptic transmission in the CA1 region of

hippocampus is also mediated by AMPARs, hippocampal slices were perfused

with ACSF containing the NMDAR blocker AP5 to isolate fEPSPAs. My results

indicate that pharmacologic

GH produced enhancement of isolated fEPSPAs that is significantly greater than

dual component fEPSPs (Figure 18 and 19). This result is supported by the

finding of Aniksztejn and Ben-Ari (1995) that addition of 7-Chlorolynurenate

(7Cl¯-kyn), an antagonist of the allosteric glycine site

a

fE

fE

h

d

fE

th

fE

th

p

to

109109

Figure 21. Model representing the relative contribution of AMPARs and

NMDARs to LTP as function of degree of NMDARs activation. The degree of

n.

At the beginning of tetanization AMPAR contribution to the postsynaptic

response is high. However, with progressively greater NMDAR activation, the

PA contribution to tetanization decreases gradually until it vanishes, resulting

in the bell shaped response to tetanization (modified from Aniksztejn and Ben-

Ari, 19

In agreement with the results of Aniksztejn and Ben-Ari, 1995; Gozlan et

contribution of AMPARs to LTP depends on the the degree of NMDAR activatio

AM

95).

al., 1994; Huang et al., 1992; Izumi et al., 1992; Xie et al., 1992; Bashir et al.,

110110

1991; Berretta et al., 1991; Coen et al., 1989; Neuman et al., 1987, I suggest that

GH produces strong activation of NMDARs that inhibits the AMPAR contrib

to GH-dependent L-LTP. However, keep in mind that the GH effect was of slow

onset resulting in a gradual increase in the number of NMDARs activated.

Therefore, it is wise not to rule out the possibility of an AMPAR contribution to

fEPSP enhancement at least during the initial 30 min of GH treatment. It is

important to understand how NMDARs could exert a negative regulatory effe

on the AMPAR’s response to GH. Iwakura et al. (2001) found that NMDA

treatment of cultured hippocampal neurons reduced the total number of

AMPARs on the neuronal surface, but not in the total membrane fraction. Th

also observed that NMDA-treatment caused down-regulation of AMPA-stim

channel activity and reduced immunoreactivity for GluR1. They concluded that

NMDAR activation induced down-regulation of functional AMPARs. Further

investigation is needed to clarify the mechanism by which GH-induced NM

activation limits the response of AMPARs.

NMDAR antagonists block the induction of both LTP and LTD (Bliss and

Collingridge, 1993; Dudec and Bear, 1992), and the NMDAR subunit compos

is considered a determining factor for LTP or LTD (Bliss and Schoepfer, 2004;

Liu et al., 2004). To investigate the role of NMDAR subunit com

ution

ct

bound

ey

ulated

DAR

ition

position in

ediating GH effects, hippocampal brain slices were perfused with ACSF

ontaining GH (2 nM) for 3 hours Western blots of GH treated slices showed

m

c

111111

decreased protein expression of the NR2B subunit of NMDARs (Figure 20).

HFS and s

ity in

NR2B-subunit-containing receptors limit NMDAR function by inhibitory restraint

over NR2A-subunit-containing receptors, via calcineurin activation (Mallon et al.,

2004).

In my experiments, GH decreased the expression of NR2B subunits but

not the NR2A subunits. According to the findings of Mallon et al. (2004), Liu et al.

(2004), Bliss and Schoepfer (2004), Bliss and Collingridge (1993), and Dudec

and Bear (1992), this decrease in the NR2B subunit should allow enhanced

function of the NR2A-containing NMDARs.The relative loss of NR2B compared

to NR2A after GH treatment might therefore contribute to the GH-induced

enhancement of fEPSPs.

NR2A and NR1 protein level were unaffected by GH treatment for 3 hours.

Liu et al. (2004) reported the requirement of NMDARs that is lacking their

NR2B subunits for LTP induction. The use of the NR2A specific antagonist NVP-

AAMO77 (0.4 µM) prevented both normal LTP induced by a single episode of

aturated LTP induced by multiple episodes of HFS, but had little effect

on LFS-induced LTD (Liu et al., 2004). Mallon et al. (2004) reported that “LTP

induction critically involves primarily receptors containing the NR2A subunit”.

They added that “endogenous factors or drugs that modify this NR2B/NR2A

interaction could have a major influence on synaptic transmission and plastic

the brain”. At both presynaptic and postsynaptic sites in the rat hippocampus,

112112

Figure 22. Diagrammatic illustration of t

he proposed mechanism of

interaction between GH, PI3-kinase, MAPK, and NMDARs. GH activates

GHR/JAK2, which activates PI3-kinase. PI3-kinase activates Fyn tyrosine kinase,

which then activates NMDARs. NMDARs activate SynGAP, converting inactive

and

My results indicate that GH-induced L-LTP was mediated at least in part

by NMDARs. Also GH treatment for 3 hours decreased expression of the NR2B

ras to active ras and activating MAPK pathway.

Proposed mechanisms of interaction between GH, PI3-kinase, MAPK,

NMDARs

113113

subunit, supporting my earlier finding that GH enhanced fEPSPNs. An import

question here is: How does GH regulate NMDAR subunit expression and

ant

NMDAR function? In addition, my finding that PI3-kinase and MAPK were

import

5,

et

that GH activation of the JAK2/PI3-kinase pathway enhances NMDAR

ctivation probably by phosphorylation, and also contributes to down-regulation

of NR2 t

n

f

ant for the induction of GH effects on fEPSPs raises another question, how

GH-induced enhancement of NMDAR function is related to PI3-kinase and

MAPK signaling pathways?

Recent studies have shown that the regulatory subunit of PI3-kinase, P8

binds directly to NR2B subunits (Hisatsune et al., 1999). Also PI3-kinase

stimulates a group of tyrosine kinases called Fyn tyrosine kinase (Hisatsune

al., 1999). MEK and ERK are regulated by SynGAP, a Ras GTPase-activating

protein that binds PSD-95 (Kim et al., 1998). More recent studies show that

NMDARs join large multiprotein complexes that contain a number of proteins

involved in Ras signaling (Husi et al., 2000). Taken together, These results

suggest

a

B subunits allowing NR2A to become dominant mediating GH-dependen

L-LTP (Figure 22). In addition, GH might also activate the MAPK pathway

through the association of NMDARs, PSD-95 and SynGAP. Further investigatio

is needed to know the exact molecular mechanisms that link GH stimulation o

PI3-kinase and MAPK to NMDARs.

114114

CONCLUSION

115115

Previous studies have shown that GH affects many functions of the central

nervous system, with beneficial effects on memory, alertness and motivatio

Others indicated that a common set of cellular mechanisms link GH-induce

improvement of memory function to NMDARs and LTP. Yet the mechanisms by

which GH improves memory function of the brain or how GH-induced

improvement of memory func

n.

d

tion relates to NMDARs and LTP are not well

stablished. The purpose of this study was three-fold. First, to determine if the

short t

ine

r

K2,

d

nsmission was mediated through NMDARs.

Finally, GH treatment of hippocampal brain slices increased GHR message and

decreased the abundance of NR2B protein.

e

erm treatment with GH affects synaptic transmission in CA1 area of rat

hippocampus. Second, if GH does affect synaptic transmission, to determ

which GH-signaling pathway or pathways are required, and to determine whethe

protein synthesis is required. Third, to determine the roles of AMPARs and

NMDARs in mediating GH action.

In summary, my results showed that GH caused a long-lasting

enhancement of excitatory synaptic transmission in area CA1 of rat

hippocampus. This GH-induced L-LTP blocked further potentiation by tetanus.

GH did not act through an increase in probability of glutamate release from

presynaptic terminals. The GH-induced potentiation of fEPSPs required JA

PI3-kinase, and MAPK, and the synthesis of new protein, but only during

induction of potentiation, and not during maintenance of potentiation. GH-induce

potentiation of excitatory synaptic tra

116116

My results demonstrate that GH induced L-LTP is related to both

MDARs channel activity and subunit composition, and there are common

ignaling pathways underlying GH-induced L-LTP and tetanization-induced L-

TP. Thus, GH enhancement of synaptic transmission in the hippocampus might

xplain the well known finding that GH treatment improves cognition and

emory. My discovery that GH is a potent short-term modulator of excitatory

ynaptic transmission in the hippocampus will facilitate a deeper understanding

f neuroendocrine regulation of memory function. However, this discovery raises

ew issues that were not apparent previously. Future studies will be needed in

several areas. First, to verify the echanisms by which GH

duces activation of GHR/JAK2, PI3-kinase and MAPK, and alters NMDAR

xpression and protein synthesis. Second, to determine whether GH stimulates

F-I release and to assess whether IGF-I participates in the short term effects of

H in hippocampus.

N

s

L

e

m

s

o

n

exact molecular m

in

e

IG

G

117117

REFERENCES

Adams JP, Sweatt JD (2002) Molecular psychology: roles for the ERK MAP

kinase cascade in memory. Annu Rev Pharmacol Toxicol 42:135-163

Aleman A, de Vries WR, de Haan EH, Verhaar HJ, Samson MM, Koppeschaar

HP (2000) Age-sensitive cognitive function, growth hormone and insulin-like

growth factor 1 plasma levels in healthy older men. Neuropsychobiology

41(2):73-78

Alexandros N, George M, Edward O, Anthony K, Philip W and George P (1999)

Sleep deprivation effects on the activity of the hypothalamic-pituitary-adrenal and

growth axes: potential clinical implications. Clin Endocrinol 51: 205-215

Anderson NG (1992) Growth hormone activated mitogen-activated protein kinase

and S6 kinase and promotes intracellular tyrosine phosphorylation in 3T3-F442A

preadipocytes. Biochem J 284:649-652

Aniksztejn L, Ben-Ari Y (1995) Expression of LTP by AMPA and/or NMDA

receptors is determined by the extent of NMDA receptors activation during the

tetanus. J Neurophysiol 74(6):2349-57

118118

Arend e and

ren

ongen-

,

rtola A, Singer W (1993) Long-term depression of excitatory synaptic

ansmission and its relationship to long-term potentiation. Trends Neurosci.

6(11):480-7

rwert LI, Deijen JB, Drent ML (2003) Effects of an oral mixture containing

lycine, glutamine and niacin on memory, GH, and IGF-I secretion in middle-

ged and elderly subjects. Nutr Neurosci 6(5):269-275

s NJ, Boonstra VH, Hokken-Koelega AC (2004) Head circumferenc

body proportions before and during growth hormone treatment in short child

who were born small for gestational age. Pediatrics 114(3):683-690

Arends NJ, Boonstra VH, Mulder PG, Odink RJ, Stokvis-Brantsma WH, R

Westerlaken C, Mulder JC, Delemarre-Van de Waal H, Reeser HM, Jansen M

Waelkens JJ, Hokken-Koelega AC (2003) GH treatment and its effect on bone

mineral density, bone maturation and growth in short children born small for

gestational age: 3-year results of a randomized, controlled GH trial. Clin

Endocrinol (Oxf) 59(6):779-787

Argetsinger LS, Campbell GS, Yang XJ, Witthuhn BA, Silvennoline O, Ihle JN

Carter-Su C (1993) Identification of JAK2 as a GHR-associated tyrosine kinase.

Cell 74:237-244

A

tr

1

A

g

a

119119

Autilio LA, Appel SH, Pettis P, G Biochmical studies of

synapses in vitro.I. Protein synthesis. Biochem 7, 2615-2622

Bashir ZI, Alford S, Davies SN, Randall AD, Collingridge GL (1991) Long-term

potentiation of NMDA receptor-mediated synaptic transmission in the

hippocampus Nature 10;349(6305):156-8

Bazan JF (1989) A novel family of growth factor receptors: a common binding

domain in the growth hormone, prolactin, erythropoietin and IL-6 receptor, and

the p75 IL-2 receptor β-chain. Biochem Biophys Res Commun 164:788-795

Bear MF, Malenka RC. (1994) Synaptic plasticity: LTP and LTD. Curr Opin

Neurobiol. 4(3):389-99

Bekkers JM, Stevens CF (1989) Presynaptic mechanism for long-term

potentiation in the hippocampus. Nature 346:724-729

Bengtsson BA, Eden S, Lonn L, Kvist H, Stokland A, Lindstedt G, Bosaeus I, Tolli

J, Sjostrom L, Isaksson OG (1993) Treatment of adults with growth hormone

(GH) deficiency with recombinant human GH. J Clin Endocrinol Metab 76(2):309-

317

ambetti PL (1968)

120120

Berg U, Bang P (2004) Exercise and circulating insulin-like growth factor I. Horm

Res 62 Suppl 1:50-8

erretta N, Berton F, Bianchi R, Brunelli M, Capogna M, Francesconi W (1991)

l

.

liss TVP, Collingridge GL (1993) A synaptic model of memory: long-term

o T (1973) Long-lasting potentiation of synaptic transmission in

e dentate area of the anaesthetized rabbit following stimulation of the perforant

RNA with specific

ynaptic sites. Proc Natl Acad Sci USA 53,418-425

B

Long-term Potentiation of NMDA Receptor-mediated EPSP in Guinea-pig

Hippocampal Slices Eur J Neurosci.;3(9):850-854

Bjork S, Jonsson B, Westphal O, Levin JE (1989) Quality of life of adults with

growth hormone deficiency: a controlled study. Acta Paediatr Scand Supp

356:55-59

Bliss T, Schoepfer R (2004) Controlling the ups and downs of synaptic strength

Science 304(5673):973-974

B

potentiation in the hippocampus. Nature 361:31-39

Bliss TVP, Lom

th

path. J Physiol 232:331-356

Bodian D (1965) A suggestive relationship of nerve cell

s

121121

Boguszewski M, Dahlgren J, Bjarnason R, Rosberg S, Carlsson LM, Carlsson B,

lbertsson-Wikland K (1997) Serum leptin in short children born small for

Eur J

ty

dults with growth hormone (GH) deficiency: response to

eatment with recombinant human GH in a placebo-controlled 21-month trial. J

urman P, Hetta J, Wide L, Mansson JE, Ekman R, Karlsson FA (1996) Growth

an P, Deijen JB (1998) Quality of life and cognitive function in patients with

ituitary insufficiency. Psychother Psychosom 67(3):154-167

A

gestational age: relationship with the growth response to growth hormone

treatment. The Swedish Study Group for Growth Hormone Treatment.

Endocrinol 137(4):387-395

Buller AL, Larson HC, Schneider BE, Beaton JA, Morrisett RA, Monaghan DT

(1994) The molecular basis of NMDA receptor subtypes: native receptor diversi

is predicted by subunit composition. J Neurosci 14(9):5471-5484

Burman P, Broman JE, Hetta J, Wiklund I, Erfurth EM, Hagg E, Karlsson FA

(1995) Quality of life in a

tr

Clin Endocrinol Metab 80(12):3585-3590

B

hormone treatment affects brain neurotransmitters and thyroxine. Clin Endocrinol

(Oxf) 44(3):319-324

Burm

p

122122

Cantrell DA (2001) Phosphoinositide 3-kinase signalling pathways. J Cell Sci

114(Pt 8):1439-1445

Carlson HE, Gillin JC, Gorden P, Snyder F (1972) Abscence of sleep-related

growth hormone peaks in aged normal subjects and in acromegaly. J Clin

Endocrinol Metab 34(6):1102-5

Chou MM, Hou W, Johnson J, Graham LK, Lee MH, Chen CS, Newton AC,

Schaffhausen BS, Toker A (1998) Regulation of protein kinase C zeta by PI

kinase and

3-

PDK-1. Curr Biol 8(19):1069-1077

ms, does growth hormone replacement improve the

uality of life in GH-deficient adults? Baillieres Clin Endocrinol Metab 12(2):261-

oan EJ, Irving AJ, Collingridge GL (1989) Low-frequency activation of the

orpas E, Harman SM, Blackman MR (1993) Human growth hormone and

Chrisoulidou A, Kousta E, Beshyah SA, Robinson S, Johnston DG (1998) How

much, and by what mechanis

q

279

C

NMDA receptor system can prevent the induction of LTP. Neurosci Lett

23;105(1-2):205-10

C

human aging. Endocr Rev 14(1):20-39

123123

):442-

tto C, Bertino E, Marozio L, Fabris C, Arisio R,

iraudi GF, Testori O, Ariano M, et al. (1993) Immunolike growth hormone

osta RM, Federov NB, Kogan JH, Murphy GG, Stern J, Ohno M, Kucherlapati

odel

Mde L, Gama-Rodrigues J, Pinotti HW

999) Clinical use of growth hormone and glutamine in short bowel syndrome

y S, Farrant M (2001) NMDA receptor subunits: diversity,

evelopment and disease. Curr Opin Neurobiol 11(3):327-335

Corvera S, Czech MP (1998) Direct targets of phosphoinositide 3-kinase

products in membrane traffic and signal transduction. Trends Cell Biol 8(11

446

Costa A, Zoppetti G, Benede

G

substance in tissues from human embryos/fetuses and adults. J Endocrinol

Invest 16(8):625-633

C

R, Jacks T, Silva AJ (2002) Mechanism for the learning deficits in a mouse m

of neurofibromatosis type 1. Nature 415(6871):526-530

Cukier C, Waitzberg DL, Borges VC, Silva

(1

Rev Hosp Clin Fac Med Sao Paulo 54(1):29-34

Cull-Candy S, Brickle

d

124124

Cummings JA, Mulkey RM, Nicoll RA, Malenka RC (1996) Ca2+ signaling

requirements for long-term depression in the hippocampus. Neuron 16(4):825-

33

ikland

one Age Progression during the First Year of

rowth Hormone Therapy in Pre-Pubertal Children with Idiopathic Growth

ort

1):40-47

osci 12:21-34

B Biol

3-84

ol

8

Darendeliler F, Ranke MB, Bakker B, Lindberg A, Cowell CT, Albertsson-W

K, Reiter EO, Price DA (2005) B

G

Hormone Deficiency, Turner Syndrome or Idiopathic Short Stature, and in Sh

Children Born Small for Gestational Age: Analysis of Data from KIGS (Pfizer

International Growth Database). Horm Res 63(

Davis S, Butcher SP, Morris RGM (1992) The NMDA receptor antagonist D-2-

amino-5-phosphonopentanoate (D-APV) impairs spatial learning and LTP in vivo

at intracerebral concentrations comparable to those that block LTP in vitro. J

Neur

Davies SN, Collingridge GL (1989) Role of excitatory amino acid receptors in

synaptic transmission in area CA1 of rat hippocampus. Proc R Soc Lond

Sci. 22;236(1285):37

Davis HP, Squire LR (1984) Protein synthesis and memory: a review. Psych

Bull 96:518-559

125125

Davis S, Vanhoutte P, Pages C, Caboche J, Laroche S (2000) The MAPK/ERK

J Neurosci 20(12):4563-4572

ts

eijen JB, de Boer H, van der Veen EA (1998) Cognitive changes during growth

area increases with

ng-term potentiation in the hippocampal dentate gyrus. Brain Res 453:308-314

,

:995-1008

ippocampus

uring memory formation. Hippocampus 12:821-833

cascade targets both Elk-1 and cAMP response element-binding protein to

control long-term potentiation-dependent gene expression in the dentate gyrus in

vivo.

Deijen JB, de Boer H, Blok GJ, van der Veen EA (1996) Cognitive impairmen

and mood disturbances in growth hormone deficient men.

Psychoneuroendocrinology 21(3):313-322

D

hormone replacement in adult men. Psychoneuroendocrinology 23(1):45-55

Desmond NL, Levy WB (1988) Synaptic interface surface

lo

Dobrunz LE, Stevens CF (1997) Heterogeneity of release probability, facilitation

and depletion at central synapses. Neuron 18(6)

Donahue CP, Jensen RV, Ochiishi T, Eisenstein I, Zhao M, Shors T, Kosik KS

(2002) Transcriptional profiling reveals regulated genes in the h

d

126126

Dudek SM, Bear MF (1992) Homosynaptic long-term depression in area C

hippocampus and effects of N-methyl-D-aspartate receptor blockade. Proc Natl

Acad

A1 of

Sci USA 89(10):4363-4367

siol Endocrinol Metab.

86(6):E1060-70

th

and activate intracellular signaling pathways involved in

europrotection, Endocrinology 143(10):4113-4122

998) Desensitization of the growth hormone-induced

anus kinase 2 (Jak 2)/signal transducer and activator of transcription 5 (STAT5)-

9(4):1815-1824

Erreger K, Dravid SM, Banke TG, Wyllie DJ, Traynelis SF (2005) Subunit-specific

gating controls rat NR1/NR2A and NR1/NR2B NMDA channel kinetics and

synaptic signaling profiles. J Physiol. Feb 17; [Epub ahead of print]

Everson CA, Crowley WR (2004) Reductions in circulating anabolic hormones

induced by sustained sleep deprivation in rats. Am J Phy

2

Fargo LM, Panda C, Dickson SL, Hewson AK, Argente J, Chowen JA (2002)

Growth hormone and GH- releasing peptide-6 increase brain insulin-like grow

factor-1 expression

n

Fernandez L, Flores-Morales A, Lahuna O, Sliva D, Norstedt G, Haldosen LA,

Mode A, Gustafsson JA (1

J

signaling pathway requires protein synthesis and phospholipase C.

Endocrinology 13

127127

Flexner JB, Flexner LB, Stellar E (1963) Memory in mice as affected by

intracerebral puromycin. Science 141:57-59

Flint AC, Maisch US, Weishaupt JH, Kriegstein AR, Moyer H (1997) NR2A

ubunit expression shortens NMDAR synaptic currents in developing neocortex.

ta E, Umana A, Negrin C, Zhang JG,

orstedt G (2001) Endoplasmic reticulum stress prolongs GH-induced Janus

ivo and in vitro. J Physiol (Lond) 490:703-711

late a late stage of

TP in hippocampal CA1 neurons. Science 260(5114):1661-1664

e

s

J Neurosci 17(7):2469-2476

Flores-Morales A, Fernandez L, Rico-Bautis

N

kinase (JAK2)/signal transducer and activator of transcription (STAT5) signaling

pathway. Mol Endocrinol 15(9):1471-1483

Frey U, Frey S, Schollmeier F and Krug M (1996) Influence of actinomycin D, a

RNA synthesis inhibitor, on long-term potentiation in rat hippocampal neurons in

v

Frey U, Huang YY, Kandel ER (1993) Effects of cAMP simu

L

Frey U, Morris RG (1997) Synaptic tagging and long-term potentiation. Natur

385(6616):533-536

128128

Friedrichsen BN, Galsgaard ED, Nielsen JH, Moldrup A (2001) Growth hormone-

and prolactin-induced proliferation of insulinoma cells, INS-1, depends on

activation of STAT5 (signal transd

ucer and activator of transcription 5). Mol

ndocrinol 15(1):136-148

hormone-

leasing peptide. Arzneimittelforschung 54(12):868-880

ptic plasticity involves competition between Ca2+/calmodulin-

ependent protein kinase II and postsynaptic density 95 for binding to the NR2A

lse-

56

E

Furuta S, Shimada O, Doi N, Ukai K, Nakagawa T, Watanabe J, Imaizumi M

(2004) General pharmacology of KP-102 (GHRP-2), a potent growth

re

Gardoni F, Schrama LH, Kamal A, Gispen WH, Cattabeni F, Di Luca M (2001)

Hippocampal syna

d

subunit of the NMDA receptor. J Neurosci 21(5):1501-1509

Gebert CA, Park SH, Waxman DJ (1999) Termination of growth hormone pu

induced STAT5b signaling. Mol Endocrinol 13(1):38-

Gibney J, Wallace JD, Spinks T, Schnorr L, Ranicar A, Cuneo RC, Lockhart S,

Burnand KG, Salomon F, Sonksen PH, Russell-Jones D (1999) The effects of 10

years of recombinant human growth hormone (GH) in adult GH-deficient

patients. J Clin Endocrinol Metab 84(8):2596-2602

129129

Golgeli A, Tanriverdi F, Suer C, Gokce C, Ozesmi C, Bayram F, Kelestim

(2004) Utility of P300 auditory event related p

ur F

otential latency in detecting

ognitive dysfunction in growth hormone (GH) deficient patients with Sheehan's

53-

ozlan H, Diabira D, Chinestra P, Ben-Ari Y (1994) Anoxic LTP is mediated by

h Horm IGF Res 14(3):200-6

Hilton DJ (2005) SOCS2

egatively regulates growth hormone action in vitro and in vivo. J Clin Invest

rosshans DR, Browning MD (2001) Protein kinase C activation induces tyrosine

7-744

c

syndrome and effects of GH replacement therapy. Eur J Endocrinol 150(2):1

159

G

the redox modulatory site of the NMDA receptor J Neurophysiol 72(6):3017-22

Greenhalgh CJ, Alexander WS (2004) Suppressors of cytokine signalling and

regulation of growth hormone action. Growt

Greenhalgh CJ, Rico-Bautista E, Lorentzon M, Thaus AL, Morgan PO, Willson

TA, Zervoudakis P, Metcalf D, Street I, Nicola NA, Nash AD, Fabri LJ, Norstedt

G, Ohlsson C, Flores-Morales A, Alexander WS,

n

115(2):233-6

G

phosphorylation of the NR2A and NR2B subunits of the NMDA receptor. J

Neurochem 76(3):73

130130

Grunwald T, Beck H, Lehnertz K, Blumcke I, Pezer N, Kurthen M, Fernandez G,

Van Roost D, Heinze HJ, Kutas M and Elger CE (1999) Evidence relating h

verbal memory to hippocampal N-methyl-D-aspartate receptors. Proc Natl A

Sci USA 96:12085-12089

uman

cad

arvey S, Hull K (2003) Neural growth hormone: an update. J Mol Neurosci

Brain Dev 14(3):170-174

Guyton AC, Hall, JE (2000) Textbook of Medical Physiology. W.B.

Saunderscompany: Philadelphia, Pennsylvania 19106.

H

20(1):1-14

Harvey S, Hull KL, Fraser RA (1993) Growth hormone: neurocrine and

neuroendocrine perspectives. Growth Regul 3(3):161-171

Hayashi M, Shimohira M, Saisho S, Shimozawa K, Iwakawa Y (1992) Sleep

disturbance in children with growth hormone deficiency.

Heinze E, Boker M, Blum W, Behnisch W, Schulz A, Urban J, Mauch E (1998)

GH, IGF-I, IGFBP-3 and IGFBP-2 in cerebrospinal fluid of infants, during puberty

and in adults. Exp Clin Endocrinol Diabetes 106(3):197-202

131131

Hisatsune C, Umemori H, Mishina M, Yamamoto T (1999) Phosphorylation-

dependent interaction of the N-methyl-D-aspartate receptor epsilon 2 subu

with phosphatidylinositol 3-kinase. Genes Cells. Nov;4(11):657-66

Hodg

nit

e C, Liao J, Stofega M, Guan K, Carter-Su C, Schwartz J (1998) Growth

ormone stimulates phosphorylation and activation of elk-1 and expression of c-

ormone (LH)-like peptides in the rodent brain: non-parallel ontogenetic

1):785-98

s

Mem 1(1):74-82

h

fos, egr-1, and junB through activation of extracellular signal-regulated kinases 1

and 2. J Biol Chem 273(47):31327-31336

Hojvat S, Emanuele N, Baker G, Connick E, Kirsteins L, Lawrence AM (1982)

Growth hormone (GH), thyroid-stimulating hormone (TSH), and luteinizing

h

development with pituitary counterparts. Brain Res 256(4):427-434

Hsieh CC, Papaconstantinou J (2004) Akt/PKB and p38 MAPK signaling,

translational initiation and longevity in Snell dwarf mouse livers. Mech Ageing

Dev. 125(10-1

Huang YY, Kandel ER (1994) Recruitment of long-lasting and protein kinase A-

dependent long-term potentiation in the CA1 region of hippocampus require

repeated tetanization. Learn

132132

Huang YY, Kandel ER (1995) D1/D5 receptor agonists induce a protein

synthesis-dependent late potentiation in the CA1 region of the hippocampus.

Proc Natl Acad Sci USA 92(7):2446-2450

Huang YY, Li XC, Kandel ER (1994) cAMP contributes to mossy fiber LTP by

lar synthesis-

tivity on the induction of long-term potentiation. Science.

;255(5045):730-3

receptor and growth

ormone binding protein transcripts in brain and peripheral tissues of the rat.

usi H, Ward MA, Choudhary JS, Blackstock WP, Grant SG (2000) Proteomic

i.

mpey S, Obrietan K, Wong ST, Poser S, Yano S, Wayman G, Deloulme JC,

Chan G, Storm DR (1998) Cross talk between ERK and PKA is required for Ca2+

initiating both a covalently mediated early phase and macromolecu

dependent late phase. Cell 79(1):69-79

Huang YY, Colino A, Selig DK, Malenka RC (1992) The influence of prior

synaptic ac

7

Hull KL, Harvey S (1998) Autoregulation of growth hormone

h

Growth Horm IGF Res 8(2):167-173

H

analysis of NMDA receptor-adhesion protein signaling complexes. Nat Neurosc

3(7):661-9

I

133133

stimulation of CREB-dependent transcription and ERK nuclear translocation

Neuron 21(4):869-883

.

anmanesh A, Lizarralde G, Veldhuis JD (1991) Age and relative adiposity are

akura Y, Nagano T, Kawamura M, Horikawa H, Ibaraki K, Takei N, Nawa H

tion of

g

76(43):40025-40032.

ide release. Science 28;257(5074):1273-6

Ir

specific negative determinants of the frequency and amplitude of growth

hormone (GH) secretory bursts and the half-life of endogenous GH in healthy

men. J Clin Endocrinol Metab. 73(5):1081-8

Iw

(2001) N-methyl-D-aspartate-induced alpha-amino-3-hydroxy-5-methyl-4-

isoxazole proprionic acid (AMPA) receptor down-regulation involves interac

the carboxyl terminus of GluR2/3 with Pick1. Ligand-binding studies usin

Sindbis vectors carrying AMPA receptor decoys. J Biol Chem. 26;

2

Izumi Y, Clifford DB, Zorumski CF (1992) Inhibition of long-term potentiation by

NMDA-mediated nitric ox

Ji S, Frank SJ, Messina JL (2002) Growth hormone-induced differential

desensitization of STAT5, ERK, and Akt phosphorylation. J Biol Chem

277(32):28384-28393

134134

Kaba H, Hayashi Y, Higuchi T, Nakanishi S (1994) Induction of an olfacto

memory by the activation of a metabotropic glutamate receptor. Science

265:262-264

ry

of skeletal maturation and an earlier

nset of puberty in children with idiopathic short stature. Arch Dis Child

M (1995) Long lasting neurotrophin-induced enhancement of

ynaptic transmission in adult hippocampus. Science 267:1658-1662

id

uffers. Horm Res 62 Suppl 3:98-103

elleher III RJ, Govindarajan A, Jung H-Y, Kang H, Tonegawa S (2004b)

Kamp GA, Waelkens JJ, de Muinck Keizer-Schrama SM, Delemarre-Van de

Waal HA, Verhoeven-Wind L, Zwinderman AH, Wit JM (2002) High dose growth

hormone treatment induces acceleration

o

87(3):215-220

Kang H, Schuman E

s

Kappelgaard AM, Bojesen A, Skydsgaard K, Sjogren I, Laursen T (2004) Liqu

growth hormone: preservatives and b

Kelleher III RJ, Govindarajan A, Tonegawa S (2004a) Translational Regulatory

Mechanisms in Persistent Forms of Synaptic Plasticity. Neuron 44(1):59-73

K

Translational control by MAPK signaling in long term synaptic plasticity and

memory. Cell 116:467-469

135135

Kelly A, Lynch MA (2000) Long-term potentiation in dentate gyrus of the rat is

inhibited by the phosph

oinositide 3-kinase inhibitor, wortmannin.

europharmacology 39(4):643-651

that

im SO, Jiang J, Yi W, Feng GS, Frank SJ (1998) Involvement of the Src

nd

ohr G, Jensen V, Koester HJ, Mihaljevic AL, Utvik JK, Kvello A, Ottersen OP,

on. J

eurosci 23(34):10791-10799

ti J,

l CM, Martin SJ, Morris RG, O'Dell TJ, Grant SG (2002)

ynGAP regulates ERK/MAPK signaling, synaptic plasticity, and learning in the

N

Kim JH, Liao D, Lau LF, Huganir RL (1998) SynGAP: a synaptic RasGAP

associates with the PSD-95/SAP90 protein family. Neuron 20(4):683-91

K

homology 2-containing tyrosine phosphatase SHP-2 in growth hormone

signaling. J Biol Chem. Jan 23;273(4):2344-54

Kimura F, Tsai CW (1984) Ultradian rhythm of growth hormone secretion a

sleep in the adult male rat. J Physiol. 353:305-15

K

Seeburg PH, Sprengel R, Hvalby O (2003) Intracellular domains of NMDA

receptor subtypes are determinants for long-term potentiation inducti

N

Komiyama NH, Watabe AM, Carlisle HJ, Porter K, Charlesworth P, Mon

Strathdee DJ, O'Carrol

S

136136

complex with postsynaptic density 95 and NMDA receptor. J Neurosci

22(22):9721-9732

Krug M, Lossner B, Ott T (1984) Anisomycin blocks the late phase of long-term

9-

eptor-

ls: evidence for presynaptic expression and extra synaptic

lutamate spillover. Neuron 17:461-474

1993) Age-

lated reduction of human growth hormone-binding sites in the human brain.

arsen L, Ropke C (2002) Suppressors of cytokine signalling: SOCS. APMIS

au LF, Huganir RL (1995) Differential tyrosine phosphorylation of N-methyl-D-

rmone in HIV/AIDS: current uses and future

rospects. Pediatr AIDS HIV Infect 6(5):281-91

potentiation in the dentate gyrus of freely moving rats. Brain Res Bull. 13(1):3

42

Kullmann DM, Erdemli G, Asztely F (1996) LTP of AMPA and NMDA rec

mediated signa

g

Lai Z, Roos P, Zhai O, Olsson Y, Fholenhag K, Larsson C, Nyberg F (

re

Brain Res 621(2):260-266

L

110(12):833-44

L

aspartate receptor subunits. J Biol Chem 270(34):20036-20041

Laurence J (1995) Growth ho

p

137137

Lazarus DD, Scanes CG (1988) Acute effects of hypophysectomy

administration of pancreatic and thyr

and

oid hormones on circulating concentrations

f somatomedin-C in young chickens: relationship between growth hormone and

e Good JA, Ziegler WH, Parekh DB, Alessi DR, Cohen P, Parker PJ (1998)

the

e Greves M, Steensland P, Le Greves P, Nyberg F (2002) Growth hormone

tor subunits gene transcripts

male rats. Proc Natl Acad Sci USA 99(10):7119-7123

7)

ceptor

RNAs in brain regions of the male rat. Neurosci

ett 226(1):61-64

processes. Exp Biol Med (Maywood) 228(7):800-810

o

somatomedin-C. Domest Anim Endocrinol 5(4):283-289

L

Protein kinase C isotypes controlled by phosphoinositide 3-kinase through

protein kinase PDK1. Science 281(5385):2042-2045

L

induces age-dependent alteration in the expression of hippocampal growth

hormone receptor and N-methyl-D-aspartate recep

in

Le Greves P, Huang W, Johansson P, Thornwall M, Zhou Q, Nyberg F (199

Effects of an anabolic-androgenic steroid on the regulation of the NMDA re

NR1, NR2A and NR2B subunit m

L

Lemon JA, Boreham DR, Rollo CD (2003) A dietary supplement abolishes age-

related cognitive decline in transgenic mice expressing elevated free radical

138138

Lhuillier L, Dryer SE (2002) Developmental regulation of neuronal KCa channels

y TGF beta1: an essential role for PI3 kinase signaling and membrane insertion.

g L, Jiang J, Frank SJ (2000) Insulin receptor substrate-1-mediated

nhancement of growth hormone-induced mitogen-activated protein kinase

e PI-3 kinase signaling pathway in fear conditioning and synaptic plasticity in

synthesis-dependent late phase of cerebellar long

rm depression. Neuron 17:483-490

o LS, Serrano PA, Blace N, Kelly MT, Crary JF, Sacktor TC

002) Protein kinase M zeta is necessary and sufficient for LTP maintenance.

isman J (1989) A mechanism for the Hebb and the anti-Hebb processes

8

b

J Neurophysiol 88(2):954-964

Lian

e

activation. Endocrinology 141(9):3328-3336

Lin CH, Yeh SH, Lin CH, Lu K T, Leu TH, Chang WC, Gean PW (2001) A role for

th

the amygdala. Neuron 31(5):841-851

Linden DJ (1996) A protein

te

Ling DS, Benard

(2

Nat Neurosci 5(4):295-296

L

underlying learning and memory. Proc Natl Acad Sci USA 86(23):9574-957

139139

Liu L, Wong TP, Pozza MF, Lingenhoehl K, Wang Y, Sheng M, Auberson YP,

ction of

d changes in the protein

xpression of subunits of the NMDA receptor. Brain Res Mol Brain Res. 28;99

king and synaptic plasticity.

nnu Rev Neurosci 25:103-126

xp Brain Res; [Epub

head of print]

Neurosci 20(7):2504-2511

ed

12

Wang YT (2004) Role of NMDA receptor subtypes in governing the dire

hippocampal synaptic plasticity. Science 304:1021

Magnusson KR, Nelson SE, Young AB (2002) Age-relate

e

(1):40-45

Malinow R, Malenka RC (2002) AMPA receptor traffic

A

Mallon AP, Auberson YP, Stone TW (2004) Selective subunit antagonists

suggest an inhibitory relationship between NR2B and NR2A-subunit containing

N-methyl-D: -aspartate receptors in hippocampal slices. E

a

Manabe T, Aiba A, Yamada A, Ichise T, Sakagami H, Kondo H, Katsuki M (2000)

Regulation of long-term potentiation by H-Ras through NMDA receptor

phosphorylation. J

Martin KC, Michael D, Rose JC, Barad M, Casadio A, Zhu H, Kandel ER (1997)

MAP kinase translocates into the nucleus of the presynaptic cell and is requir

for long-term facilitation in Aplysia. Neuron 18(6):899-9

140140

Mathis C, Lehman J, Ungerer A (1992) The selective protein kinase inhibitor,

NPC 15437, induced specific deficits in memory retention in mice. Eur J

Pharmacol 220: 107-110

McBain CJ, Mayer ML (1994) N-methyl-D-aspartic acid receptor structure

function. Physiol Rev. 74(3):723-60

and

cGauley GA, Cuneo RC, Salomon F, Sonksen PH (1990) Psychological well-

onyer H, Sprengel R, Schoepfer R, Herb A, Higuchi M, Lomeli H, Burnashev N,

ce 256(5060):1217-1221

em.

orris RGM, Andersen E, Lynch GS, Baudry M (1986) Selective impairment of

yl-D-

M

being before and after growth hormone treatment in adults with growth hormone

deficiency. Horm Res 33(Suppl 4):52-54

M

Sakmann B, Seeburg PH (1992) Heteromeric NMDA receptors: molecular and

functional distinction of subtypes. Scien

Morgan IG, Austin L (1968) Synaptosomal protein synthesis in a cell-free syst

J Neurochem 15, 41-51

M

learning in rats and blockade of long-term potentiation in vivo by an N-meth

aspartate receptor antagonist, AP5. Nature 319:774-776

141141

Murphy AE, Harvey S (2001) Extrapituitary beta TSH and GH in early chick

embryos. Mol Cell Endocrinol 185(1-2):161-171

Mustafa A, Nyberg F, Bogdanovic N, Islam A, Roos P, Adem A (1994a)

ustafa A, Adem A, Roos P, Nyberg F (1994b) Sex differences in binding of

ustafa A, Sharma HS, Olsson Y, Gordh T, Thoren P, Sjoquist PO, Roos P,

rat

akanishi S (1992) Molecular diversity of glutamate receptors and implications

, Browning MD (1998)

aintenance of late-phase LTP is accompanied by PKA-dependent increase in

Somatogenic and lactogenic binding sites in rat brain and liver: quantitative

autoradiographic localization. Neurosci Res 20(3):257-63

M

human growth hormone to rat brain. Neurosci Res 19(1):93-99

M

Adem A, Nyberg F (1995) Vascular permeability to growth hormone in the

central nervous system after focal spinal cord injury. Influence of a new anti-

oxidant H 290/51 and age. Neurosci Res 23(2):185-194

N

for brain function. Science 258(5082):597-603

Nayak A, Zastrow DJ, Lickteig R, Zahniser NR

M

AMPA receptor synthesis. Nature 394:680-683

142142

Neuman R, Cherubini E, Ben-Ari Y (1987) Is activation of N-methyl-D-aspartate

ett

guyen PV, Abel T, Kandel ER (1994) Requirement of critical period of

ishiyama M., Hong K., Mikoshiba K., Poo M.M., Kato K (2000) Calcium stores

yberg F, Burman P (1996) Growth hormone and its receptors in the central

atomy. 4th

dition St Louis Missouri Mosby Inc

Stalla GK, Holsboer F, Zihl J (2004) The effect of growth

ormone substitution on cognitive performance in adult patients with

receptor gated channels sufficient to induce long term potentiation? Neurosci L

5;80(3):283-8

N

transcription for induction of late phase of LTP. Science 265:1104-1107

N

regulate the polarity and input specificity of synaptic modification. Nature

30;408(6812):584-588

N

nervous system -- location and functional significance. Horm Res 45(1-2):18-22

Nolte J (1999) The human brain an introduction to its functional an

e

Oertel H, Schneider HJ,

h

hypopituitarism. Psychoneuroendocrinology 29(7):839-850

143143

Opazo P, Watabe AM, Grant SG, O'Dell TJ (2003) Phosphatidylinositol 3-kin

regulates the induction of long-term potentiation t

ase

hrough extracellular signal-

lated kinase-independent mechanisms. J Neurosci 23(9):3679-3688

nce

in synthesis but not

essenger RNA synthesis immediately post-tetanization. Neuroscience

aradisi R, Frank G, Magrini O, Capelli M, Venturoli S, Porcu E, Flamigni C

Hokken-Koelega A

003) Effect of discontinuation of growth hormone treatment on risk factors for

ga AC

tional age. J Clin Endocrinol

etab 89(11):5295-5302

re

Otani S, Marshall CJ, Tate WP, Goddard GV, Abraham WC (1989) Maintena

of long-term potentiation in rat dentate gyrus requires prote

m

28(3):519-526

P

(1993) Adeno-pituitary hormones in human hypothalamic hypophysial blood. J

Clin Endocrinol Metab 77(2):523-527

Pareren VY, Mulder P, Houdijk M, Jansen M, Reeser M,

(2

cardiovascular disease in adolescents born small for gestational age. J Clin

Endocrinol Metab 88(1):347-353

Pareren VYK, Duivenvoorden HJ, Slijper FS, Koot HM, Hokken-Koele

(2004) Intelligence and psychosocial functioning during long-term growth

hormone therapy in children born small for gesta

M

144144

Passafaro M, Piech V, Sheng M (2001) Subunit-specific temporal and spatial

patterns of AMPA receptor exocytosis in hippocampal neurons. Nat Neurosci

4(9):917-926

Patty L (1990) Homology of a domain of the growth/ prolactin receptor fa

type III modules of fibronectin. Cell 61:13-14

mily with

ine

naffected by GH or GH secretagogue (MK-0677)

dministration. Horm Metab Res 31(2-3):133-137

roducts in cell function. J Biol Chem 274(13):8347-8350

roudman JA (2000) Identification of growth

ormone and prolactin-containing neurons within the avian brain. Cell Tissue Res

(2004) Growth

ormone treatment attenuates age-related changes in hippocampal short-term

plasticity and spatial learning Neurosci. 129(1):119-27

Prahalada S, Block G, Handt L, DeBurlet G, Cahill M, Hoe CM, van Zwieten MJ

(1999) Insulin-like growth factor-1 and growth hormone (GH) levels in can

cerebrospinal fluid are u

a

Rameh LE, Cantley LC (1999) The role of phosphoinositide 3-kinase lipid

p

Ramesh R, Kuenzel WJ, Buntin JD, P

h

299(3):371-383

Ramsey MM, Weiner JL, Moore TP, Carter CS, Sonntag WE

h

145145

Ranke MB, Stanley CA, Rodbard D, Baker L, Bonglovanni A, Parks JS (1975)

Sex differences in binding of human growth hormone to isolated rat hepatocy

Proc Nat Acad Sci 73(3):847-851

tes.

eichlin S (1983) Somatostatin (second of two parts). N Engl J Med

eural expression of the pituitary GH gene.

Endocrinol 147(3):413-422

us

ivator of transcription 5 signaling pathway

quires an intact actin cytoskeleton. Exp Cell Res 294(1):269-280

l-

rosci Lett 167:141-144

Raymond CR, Redman SJ, Crouch MF (2002) The phosphoinositide 3-kinase

and p70 S6 kinase regulate long-term potentiation in hippocampal neurons.

Neuroscience 109(3):531-536

R

22;309(25):1556-63

Render CL, Hull KL, Harvey S (1995) N

J

Rico-Bautista E, Negrin-Martinez C, Novoa-Mogollon J, Fernandez-Perez L,

Flores-Morales A (2004) Downregulation of the growth hormone-induced Jan

kinase 2/signal transducer and act

re

Riedel G, Wetzel W, Reymann KG (1994) (R, S)-α-Methyl-4-carboxypheny

glycine (MCPG) blocks spatial learning in rats and long-term potentiation in the

dentate gyrus in vivo. Neu

146146

Rodgers EE, Theibert AB (2002) Functions of PI 3-kinase in development of th

nervous system. Int J Dev Neurosci 20(3-5):187-197

e

osenzweig ES, Barnes CA (2003) Impact of aging on hippocampal function:

of

anna PP, Cammalleri M, Berton F, Simpson C, Lutjens R, Bloom FE,

long-term potentiation

the hippocampal CA1 region. J Neurosci 22(9):3359-3365

lism before and during long-term growth hormone (GH)

eatment in children with short stature born small for gestational age either with

h J (1977) Distribution of

rowth hormone and thyroid-stimulating hormone in cerebrospinal fluid and

R

plasticity, network dynamics, and coginition. Progress in Neurobiology 69:143-

179

Sacktor TC, Osten P, Valsamis H, Jiang X, Naik MU, Sublette E (1993)

Persistent activation of the zeta isoform of protein kinase C in the maintenance

long-term potentiation. Proc Natl Acad Sci USA 90(18):8342-8346

S

Francesconi W (2002) Phosphatidylinositol 3-kinase is required for the

expression but not for the induction or the maintenance of

in

Sas T, Mulder P, Hokken-Koelega A (2000) Body composition, blood pressure,

and lipid metabo

tr

or without GH deficiency. J Clin Endocrinol Metab 85(10):3786-3792

Schaub C, Bluet-Pajot MT, Szikla G, Lornet C, Talairac

g

147147

pathological compartments of the central nervous system. J Neurol Sci

31(1):123-131

Scheepens A, Sirimanne E, Beilharz E, Breier BH, Waters MJ, Gluckman PD,

chneider-Rivas S, Rivas-Arancibia S, Vazquez-Pereyra F, Vazquez-Sandoval

tinction

y growth hormone (GH) and growth hormone releasing

ormone (GHRH) in rats. Life Sci 56(22):PL433-PL441

mer B, Wisden W, Sprengel R, Kuner T, Lomeli H,

erb A, Kohler M, Burnashev N (1994) Molecular biology of glutamate receptors.

ci 14:5325-

337

f AMPA receptors after

ynaptic NMDA receptor activation. Science 284:1811-1816

Williams CE (1999) Alterations in the neural growth hormone axis following

hypoxic-ischemic brain injury. Brain Res Mol Brain Res 68(1-2):88-100

S

R, Borgonio-Perez G (1995) Modulation of long-term memory and ex

responses induced b

h

Schoepfer R, Monyer H, Som

H

Prog Neurobiol. 42(2):353-7

Schulz PE, Cook EP, Johnston D (1994) Changes in paired-pulse facilitation

suggest presynaptic involvement in long-term potentiation. J Neuros

5

Shi SH, Hayashi Y, Petralia RS, Zaman SH, Wenthold RJ, Svoboda K, Malinow

R (1999) Rapid spine delivery and redistribution o

s

148148

Silva AJ, Paylor R, Wehner JM, Tonegawa S (1992) Impaired Impaired spatial

arning in alpha-calcium-calmodulin kinase II mutant mice. Science

S, Vanderkuur JA, Stimage A, Han Y, Luo G, Yu-Lee LY, Schwartz J,

arter-Su C (1997) Growth hormone-induced tyrosyl phosphorylation and

ology

oderling TR, Derkach VA (2000) Postsynaptic protein phosphorylation and LTP.

late N-methyl-D-

spartate receptor subtype expression in rats. Brain Res Bull. 1;51(4):331-8

-C,

kinase and

anscription. Endocrinology 135:1292-1298

le

10;257(5067):206-11

Smit L

C

deoxyribonucleic acid binding activity of STAT5A and STAT5B. Endocrin

138(8):3426-3434

S

Trends Neurosci 23:75-80

Sonntag WE, Bennett SA, Khan AS, Thornton PL, Xu X, Ingram RL, Brunso-

Bechtold JK (2000) Age and insulin-like growth factor-1 modu

a

Sotiropoulos A, Perrot-Applanat M, Dinerstein H, Pallier A, Postel-Vinay M

Finidori J, Kelly P (1994) Distinct cytoplasmic regions of growth hormone

receptor are required for activation of JAK2, mitogen-activated protein

tr

149149

Stacy JJ, Terrell TR, Armsey TD (2004) Ergogenic AIDS: human growth

hormone. Curr

Sports Med Rep 3(4):229-233

0-

91

al HA (2003) Quality of

fe of growth hormone (GH) deficient young adults during discontinuation and

al MAP kinase cascade: a biochemical signal

tegration system subserving synaptic plasticity and memory. J Neurochem

M, Nakahara T, Kojima S, Nakano T, Muranaga T, Nagai N, Ueno H,

akazato M, Nozoe S, Naruo T (2004) Effect of nutritional rehabilitation on

Stanton PK, Sarvey JM (1984) Blockade of long-term potentiation in rat

hippocampal CA1 region by inhibitors of protein synthesis. J Neurosci 4:308

3088

Steward O, Levy WB (1982) Preferential localization of polyribosomes under the

base of dendritic spines in granule cells of dentate gyrus. J Neurosci 2, 284-2

Stouthart PJ, Deijen JB, Roffel M, Delemarre-van de Wa

li

restart of GH therapy. Psychoneuroendocrinology 28(5):612-626

Sweatt JD (2001) The neuron

in

76(1):1-10

Tanaka

N

circulating ghrelin and growth hormone levels in patients with anorexia nervosa.

Regul Pept T15;122(3):163-8

150150

Tang YP, Shimizu E, Dube GR, Rampon C, Kerchner GA, Zhuo M, Liu G, Tsien

annenbaum GS (1990) Interrelationship of somatostatin and growth hormone-

e.

) Facilitation, augmentation and potentiation at central

ynapses. Trends Neurosci 23(7):305-12

ou Q, Lagerholm S, Huang W, Le Grevès P, Nyberg

(2001) Morphine decreases the levels of the gene transcripts of growth

hornton PL, Ingram RL, Sonntag WE (2000) Chronic [D-Ala2]-growth hormone-

ller D (1999) LTP promotes

rmation of multiple spine synapses between a single axon terminal and a

dendrite. Nature 402:421-425

JZ (1999) Genetic enhancement of learning and memory in mice. Nature

401(6748):63-69

T

releasing hormone in the genesis of the rhythmic secretion of growth hormon

Acta Paediatr Scand Suppl 367:76-80

Thomson AM (2000

s

Thörnwall-Le Grevès M, Zh

F

hormone receptor and growth hormone binding protein in the male rat

hippocampus and spinal cord. Neurosci Lett 304:(1-2)69-72

T

releasing hormone administration attenuates age-related deficits in spatial

memory. J Gerontol A Biol Sci Med Sci. 55(2):B106-12

Toni N, Buchs PA, Nikonenko I, Bron CR, Mu

fo

151151

Trommald M, Hulleberg G, Andersen P (1996) Long-term potentiation is

ssociated with new excitatory spine synapses on rat dentate granule cells.

JZ, Huerta PT, Tonegawa S (1996) The essential role of hippocampal CA1

MDA receptor-dependent synaptic plasticity in spatial memory. Cell 87:1327-

an Dam PS, Aleman A, de Vries WR, Deijen JB, van der Veen EA, de Haan EH,

ance ML, Kaiser DL, Evans WS, Furlanetto R, Vale W, Rivier J, Thorner MO

s

for

somatostatin secretion. J Clin Invest 75(5):1584-90

)

n-

a

Learn Mem 3:218-228

Tsien

N

1338

v

Koppeschaar HP (2000) Growth hormone, insulin-like growth factor I and

cognitive function in adults. Growth Horm IGF Res 10(Suppl B):S69-S73

V

(1985) Pulsatile growth hormone secretion in normal man during a continuou

24-hour infusion of human growth hormone releasing factor (1-40). Evidence

intermittent

Vanderkuur JA, Butch ER, Waters SB, Pessin JE, Guan KL, Carter-Su C (1997

Signaling molecules involved in coupling growth hormone receptor to mitoge

activated protein kinase activation. Endocrinology 138(10):4301-4307

152152

Vikman K, Carlsson B, Billig H, Eden S (1991) Expression and regulation of

growth hormone (GH) receptor messenger ribonucleic acid (mRNA) in rat

adipose tissue, adipocytes, and adipocyte precursor cells: GH regulation of GH

ceptor mRNA. Endocrinology 129(3):1155-1161

38

on of long-term potentiation and

ynergistically activates mitogen-activated protein kinase in the hippocampal

amino

: a 2-

re

Wajnrajch MP (2005) Physiological and pathological growth hormone secretion.

J Pediatr Endocrinol Metab. 18(4):325-

Watabe AM, Zaki PA, O'Dell TJ (2000) Coactivation of beta-adrenergic and

cholinergic receptors enhances the inducti

s

CA1 region. J Neurosci 20(16):5924-5931

Watkins JC, Evans RH (1981) Pharmacological antagonists of excitant

acid action. Life Sci. 23;28(12):1303-8

Whitman BY, Myers S, Carrel A, Allen D (2002) The behavioral impact of growth

hormone treatment for children and adolescents with Prader-Willi syndrome

year, controlled study. Pediatrics 109(2):E35

Williams K (2001) Ifenprodil, a novel NMDA receptor antagonist: site and

mechanism of action. Curr Drug Targets 2(3):285-298

153153

Winder DG, Martin KC, Muzzio IA, Rohrer D, Chruscinski A, Kobilka B, Kandel

ncy

5-

e. J Biol Chem 270(52):30837-30840

(GH)

for a

ose effect. J Pediatr 146(1):45-53

sitol 3-kinase and

ther protein kinases. J Neurosci 18(16):6261-6278

ene

xpression with age. Endocrinology 136:4551-4557

ER (1999) ERK plays a regulatory role in induction of LTP by theta freque

stimulation and its modulation by beta-adrenergic receptors. Neuron 24(3):71

726

Winston LA, Hunter T (1995) JAK2, Ras, and Raf are required for activation of

extracellular signal-regulated kinase/mitogen-activated protein kinase by growth

hormon

Wit JM, Rekers-Mombarg LT, Cutler GB, Crowe B, Beck TJ, Roberts K, Gill A,

Chaussain JL, Frisch H, Yturriaga R, Attanasio AF (2005) Growth hormone

treatment to final height in children with idiopathic short stature: Evidence

d

Wu RL, Butler DM, Barish ME (1998) Potassium current development and its

linkage to membrane expansion during growth of cultured embryonic mouse

hippocampal neurons: sensitivity to inhibitors of phosphatidylino

o

Xiaowei XU, Bennett SA, Ingram RL, Sonntag WE (1995) Decreases in growth

homone receptor signal transduction contribute to the decline in IGF-1 g

e

154154

Xie X, Berger TW, Barrionuevo G (1992) Isolated NMDA receptor-mediated

synaptic responses express both LTP and LTD J Neurophysiol 67(4):1009-

Xu X, Bennett SA, Ingram RL, Sonntag WE (1995)

13

Decreases in growth hormone

ceptor signal transduction contribute to the decline in insulin-like growth factor I

amauchi T, Kaburagi Y, Ueki K, Tsuji Y, Stark GR, Kerr IM, Tsushima T,

ne

-1, -

,

JAK2 kinase. J Biol Chem

73(25):15719-15726

003) Two forms of synaptic plasticity with

istinct dependence on age, experience, and NMDA receptor subtype in rat

hanges in dendritic spines

sociated with long-term synaptic plasticity. Annu Rev Neurosci 24:1071-1089

n of growth hormone

inding sites in rat brain. Acta Paediatr Suppl 406:92-95

re

gene expression with age. Endocrinology 136(10):4551-4557

Y

Akanuma Y, Komuro I, Tobe K, Yazaki Y, Kadowaki T (1998) Growth hormo

and prolactin stimulate tyrosine phosphorylation of insulin receptor substrate

2, and -3, their association with p85 phosphatidylinositol 3-kinase (PI3-kinase)

and concomitantly PI3-kinase activation via

2

Yoshimura Y, Ohmura T, Komatsu Y (2

d

visual cortex. J Neurosci 23(16):6557-6566

Yuste R, Bonhoeffer T (2001) Morphological c

as

Zhai Q, Lai Z, Roos P, Nyberg F (1994) Characterizatio

b

155155

Zhu JJ, Qin Y, Zhao M, Van Aelst L, Malinow R (2002) Ras and Rap control

AMPA receptor trafficking during synaptic plasticity. Cell 110(4):443-455

156156