1  

Mapping Topoisomerase Sites in Mitochondrial DNA with a Poisonous Top1mt* Ilaria Dalla Rosa, Shar-yin N. Huang, Keli Agama, Salim Khiati, Hongliang Zhang, Yves Pommier

Laboratory of Molecular Pharmacology, Developmental Therapeutics Branch, Center for Cancer Research, National Cancer Institute,

National Institutes of Health, Bethesda, MD 20892, USA

*Running title: In vivo mapping of Top1mt binding sites on the entire mitochondrial genome

To whom correspondence should be addressed: Developmental Therapeutics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892. Tel.: 301-496-5944; Fax: 301-402-0752; E-mail: pommier@nih.gov Keywords: DNA topoisomerases; mitochondria; mitochondrial DNA, DNA repair Background: Top1mt is the mtDNA untwisting enzyme. Results: Using a mutated toxic enzyme, we determined Top1mt sites and mtDNA damage. Conclusions: Top1mt accumulates in the regulatory region of mtDNA. Stable Top1mt cleavage complexes rapidly deplete mtDNA. Significance: This is the first map of Top1mt sites across the entire mitochondrial genome and a new set up to elicit mtDNA damage. ABSTRACT Mitochondrial topoisomerase I (Top1mt) is a type IB topoisomerase present in vertebrates and exclusively targeted to mitochondria. Top1mt relaxes mitochondrial DNA (mtDNA) supercoiling by introducing transient cleavage complexes wherein the broken DNA strand swivels around the intact strand. Top1mt cleavage complexes (Top1mtcc) can be stabilized in vitro by camptothecin (CPT). However, CPT does not trap Top1mtcc efficiently in cells and is highly cytotoxic due to nuclear Top1 targeting. To map Top1mtcc on mtDNA in vivo and to overcome the limitations of CPT, we designed two substitutions (T546A and N550H) in Top1mt to stabilize Top1mtcc. We refer to the double-mutant enzyme as Top1mt*. Using retroviral transduction and ChIP-on-chip assays with Top1mt* in Top1mt knockout murine embryonic fibroblasts (MEFs), we demonstrate that Top1mt* forms high levels of cleavage complexes preferentially in the non-coding regulatory region (NCR) of

mtDNA, accumulating especially at the heavy strand replication origin OH, in the ribosomal genes (12S and 16S) and at the light strand replication origin OL. Expression of Top1mt* also caused rapid mtDNA depletion without affecting mitochondria mass, suggesting the existence of specific mitochondrial pathways for the removal of damaged mtDNA. Type IB topoisomerases (Top1 and Top1mt) relax DNA superhelical tension by allowing the swiveling of one DNA strand around the other, which rapidly dissipates DNA supercoiling (1-3). To execute these reactions, Top1 and Top1mt introduce DNA single-strand breaks through their catalytic tyrosine residues, which remain transiently covalently bound to the 3’-end of the nicks. These catalytic intermediates are referred to as Top1 cleavage complexes (Top1cc). They are normally transient as the 5'-hydroxyl DNA ends quickly religate the nicks by attacking the 3'-tyrosyl-DNA bonds. Camptothecin (CPT) or its clinical derivatives topotecan and irinotecan, as well as the non-camptothecin indenoisoquinolines trap Top1cc’s by binding at the Top1-DNA interface with high selectivity, thereby inhibiting the DNA religation step (4-7). In S-phase, collisions between Top1cc and the replication machinery produce DNA double-strand breaks and eventually cell death, which accounts for the fact that nuclear Top1 is the target of anticancer drugs (1,8). Studies in yeast have shown that, even in the absence of CPT, substitution of conserved residues

http://www.jbc.org/cgi/doi/10.1074/jbc.M114.555367The latest version is at JBC Papers in Press. Published on May 5, 2014 as Manuscript M114.555367

Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  2  

in the active site of Top1 alter the catalytic cycle of the enzyme. Substitution of Thr722 with Ala (T722A) produces a CPT-mimetic effect, enhancing the stability of Top1cc by reducing DNA religation (inhibiting the reverse reaction) (9), while mutation of Asn726 to His (N726H) increases Top1-DNA binding rate (forward reaction) (10). Combination of both mutations in a single polypeptide converts Top1 to a potent cytotoxin by enhancing its DNA cleavage and reducing its DNA religation rate at the same time (11).

Sequences of Top1mt and Top1 are highly similar except for their N-terminal domain, which contain mitochondrial and nuclear targeting sequences, respectively (3,12). Top1mt and Top1 are most likely paralogs that originated from TOP1 gene duplication during vertebrate evolution (12). Top1 and Top1mt are organelle specific (3), and expression of (nuclear) Top1 in mitochondria is toxic (13). The main function of Top1mt is likely to remove topological stress from mitochondrial DNA (mtDNA). MtDNA is a circular multi-copy genome that encodes 13 essential subunits of the mitochondrial respiratory chain, two ribosomal RNAs (12S and 16S) and 22 tRNAs (14,15) (see Fig. 2B). Genetic information is tightly packed in mtDNA as both strands, denoted as heavy (H) and light (L), are actively transcribed. The only non-coding region (NCR) of substantial size is the mtDNA regulatory region, containing the promoters for mtDNA transcription (HSP1, HSP2 and LSP), the origin of H-strand replication (OH) and several conserved sequences with regulatory functions [see schemes in Fig. 2; references (15-17) for reviews on mtDNA transcription and replication]. MtDNA replication is frequently aborted about 600 base pairs downstream from OH (18). The nascent DNA chain, called 7S DNA, displaces the parental H-strand, generating a triple-stranded displacement loop (named the D-loop) (see Fig. 2C). The function of the D-loop is not fully understood. Top1mt is not essential for murine development. Yet, Top1mt KO mouse embryonic fibroblasts (MEFs) show altered oxidative phosphorylation, increased glycolysis and lipid oxidation, defective mitochondrial potential and mitophagy is increased in mice liver tissues (19). The mtDNA defects of Top1mt KO mice is also exhibited by the hypersensitivity of those mice to

the cardiotoxicity of doxorubicin (20) and their altered mtDNA supercoiling (21). Here we set out to map Top1mt binding sites in vivo in the whole mitochondrial genome. Previous mapping of Top1mt sites trapped by CPT has been done by ligation-mediated PCR and limited to the mitochondrial NCR (22). It revealed that treatment of isolated mitochondria with high CPT concentrations preferentially trapped Top1mt at a cluster of sites downstream to the end of 7S DNA (22). However, using CPT has limitations because of the limited permeability of mitochondria to non-cationic molecules and because CPT is readily inactivated at alkaline pH (8,23). Furthermore, CPT traps Top1 at selective sequences that are dictated by the drug stacking with the +1 base of the Top1cc, thereby introducing a sequence-bias for mapping of Top1cc (24). It is also highly cytotoxic due (nuclear) Top1 targeting. To overcome these limitations, we took advantage of the CPT-mimetic mutant established for yeast Top1 (9-11), and designed a mutated Top1mt to generate high levels of Top1mtcc independently of CPT. Using tiling microarray and ChIP-on-chip, we show that Top1mtcc maps to specific mtDNA regulatory elements, and that transduction of the double-mutant Top1mt produces an acute depletion of mtDNA, thereby providing a novel mean to selectively study the cellular consequences of mtDNA damage resulting from irreversible Top1mtcc.

EXPERIMENTAL PROCEDURES

Cell culture, cloning and expression of mutated of Top1mt - Wild type (WT) and Top1mt knockout (KO) MEFs were grown as described (19). The coding sequence of mouse Top1mt (NM_028404.2) was cloned in the retroviral vector pFB-Neo (Agilent, Santa Clara, CA) through link-mediated PCR, generating pFB-Top1mt-Neo. Residues T546 and N550 of Top1mt were mutated to A and H respectively using overlap-extension PCR (25), generating pFB-Top1mt*-Neo. MMLV-based viruses were generated co-transfecting pFB-Top1mt-Neo or pFB-Top1mt*-Neo with the two packaging vectors pVPack-GP and pVPack-VSV-G Neo (Agilent, Santa Clara, CA) in 293T cells. pFB-Neo was co-transfected with the packaging vectors to produce empty viruses utilized as control for

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  3  

transduction effects. 1:10 dilutions of viruses were used to transduce Top1mt KO MEFs and Top1mt expression levels were measured by Western blotting 24 h after transduction.

Western blotting and detection of Top1mt cleavage complexes (ICE bioassay) - Western blotting was performed as described previously (19). The primary antibody used were: anti-Top1mt (19), Anti-OxPhos Complex Kit (#457999, Invitrogen). ICE bioassays were performed as described (26). Membranes were incubated overnight at 4°C with anti-Top1mt antibody (19) and 1 h at room temperature with anti–mouse HRP-linked secondary antibody (GE healthcare). Signals were detected using ECL Plus Western Blotting Detection Reagents (GE healthcare).

ChIP-on-chip - ChIP-on-chip experiments were performed according to the Agilent mammalian ChIP-on-chip protocol version 10.2. Briefly, five 50% confluent T175 cm2 flasks of Top1mt KO MEFs were transduced with Top1mt*-Flag or empty vector as control (see Fig. 1). Twenty four hours after transduction, cells were treated with formaldehyde (1.1% final concentration) for 10 min at room temperature and reactions were stopped by adding 125 mM glycine for 5 min. Cells were then washed with PBS, scraped and lysed in 2 ml lysis buffer (50 mM Tris-HCl pH 8.0, 300 mM NaCl, 0.5% NP-40, 10 mM MgCl2, 5 mM DTT) with protease inhibitors and incubated on ice for 30 min. Lysates were sonicated 7 times for 30 sec at 30% power to obtain chromatin fragments of about 200 base pairs and centrifuged at 14,000 rpm for 10 min at 4°C. 50 µl of lysates were saved frozen at this point for “no-IP” control. Supernatants were diluted in equal volume of dilution buffer (50 mM Tris-HCl pH 8.0, 0.5% NP-40, 5 mM DTT) with protease inhibitors and incubated overnight at 4°C on a rotating platform with 5 µg/ml anti-Flag antibody (#F1804, Sigma, St. Louis, MO). The following day, 150 µl/ml A/G-Plus agarose beads (Santa Cruz, Dallas, TX) were added. After incubation for 2 h at 4°C on a rotating platform, the beads were washed 3 times with wash buffer, 3 times with wash buffer + 200 mM NaCl, 3 times with LiCl buffer and 2 times with Tris-EDTA (TE) (according to the Agilent protocol). The beads were resuspended in 300 µl TE, 0.5% SDS and

transferred in a new tube. At this point the saved 50 µl no-IP lysates were thawed and diluted in TE, 0.5% SDS and treated in parallel with the IP samples. 20 mg/ml proteinase K were added to all samples, followed by incubation for 6 h at 65°C with continuous shacking. After centrifugation (14,000 rpm, 1 min) the chromatin in the supernatants was extracted with equal volume of phenol-chlorophorm-isoamyl alcohol, and ethanol-precipitated with 20 mg/ml glycogen. DNA pellets were resuspended in 65 µl of 10 mM Tris pH 8.0. Both IP and no-IP DNA samples were amplified, labeled and hybridized according to the Agilent protocol. For each probe on the array, the no-IP signal was subtracted from the IP signal (Log2 values). Positive values indicate mtDNA regions where the IP signal is higher than its corresponding no-IP (Top1mt enriched regions).

Recombinant Top1mt expression - For the production of recombinant Top1mt, the mature form of human Top1mt [without mitochondrial targeting sequence, amino acids 25-601 (3)] was cloned in the baculovirus Destination Vector pDest-605 and expressed using Bac-to-bac Expression System (Invitrogen, Grand Island, NY) according to the manufacturer’s procedure. For production of Top1mt*, human mature Top1mt was mutated (T554A and N558H) and expressed as described for native Top1mt.

In vitro DNA cleavage assays - DNA cleavage assays were carried out as described (27). Briefly, 40 base pair custom synthesized oligonucleotides (IDT, Coralville, IA) were 3'-labeled prior to annealing with their unlabeled complementary strand at 1:1 ratio. Reaction mixtures contained 50 to 200 nM of labeled DNA, 10 mM Tris-HCl pH 8.5, 50 mM KCl, 0.1 mM EDTA, 5 mM MgCl2, 15 µg/mL BSA, 1 mM DTT, and 10% DMSO or 10 µM CPT. 70 nM human recombinant Top1mt or Top1mt* were added to reaction mixtures. Following incubation at 25°C for 1 h, reactions were stopped by adding 0.5% SDS (final concentration). Reaction products were separated in 20% denaturing PAGE and imaged by PhosphoImager. Oligonucleotide sequences used in Figure 3 are listed in Table 1.

mtDNA quantification - Total DNA was isolated using DNeasy Blood and tissues Kit (QIAGEN, Gaithersburg, MD). PCRs were

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  4  

performed in triplicates on 384-Well plates. Each PCR reaction (final volume 10 µl) contained 25 ng DNA, 5 µl of Power SYBR-Green PCR Master Mix (Applied Biosystems) and 0.5 µM of each forward and reverse primer. COX1 gene was amplified and POLG2 was used as normalizing control. The primers used were: Cox1-F: TTTTCAGGCTTCACCCTAGATGA, Cox1-R: CCTACGAATATGATGGCGAAGTG, ASPG2-F: GGAGGAGGCACTTTCTCAGC, ASPG2-R: GAAGACCTGCTCCCTGAACAC.

Quantification of mitochondrial mass - Mitochondrial mass was measured by Nonyl acridine orange (NAO) staining (Invitrogen, Carlsbad, CA). Cells (from one T25 cm2 flask) were treated with 50 nM NAO for 30 min at 37°C and then trypsinized and washed in phosphate buffered saline (PBS). Cells were resuspended in 1 ml of pre- warmed Hank’s balanced salt solution (HBSS) buffer and immediately analyzed by flow cytometry with a FACScan flow cytometer (BD Biosciences). RESULTS

Generation of the CPT-mimetic Top1mt – Our rationale for these experiments is that substitutions of Thr722 (T722A) and Asn726 (N726H) in yeast Top1 alter its cleavage/religation equilibrium, increasing the stability of Top1cc and enhancing Top1-DNA binding rate (9-11). Because the active sites of yeast Top1 and Top1mt are well conserved (Fig. 1A), we hypothesized that the corresponding mutations in Top1mt would generate an enzyme prone to trapping mtDNA. Thus, we mutated Thr546 and Asn550 in mouse Top1mt (T546A and N550H) and transduced native or mutated Top1mt constructs (Top1mt and Top1mt*, respectively) in Top1mt knockout (KO) MEFs (Fig. 1B). Top1mt and Top1mt* polypeptides were readily detected at comparable expression levels one day after transduction (Fig. 1C). To determine whether Top1mt* formed the expected high levels of topoisomerase-mtDNA complexes, we compared Top1mtcc in cells expressing Top1mt* vs. Top1mt (Fig. 1D). We also used high concentrations of topotecan (TPT), the clinical water-soluble camptothecin derivative (8), which enters mitochondria (28) to trap Top1mtcc. Unlike wild type Top1mt, which required the presence of TPT to form cleavage

complexes, Top1mt*cc were readily detectable in the absence of drug (Fig. 1D). To demonstrate the specificity of the Top1mtcc detection, we also treated Top1mt KO cells transfected with empty virus with TPT. Lack of Top1mt signal confirmed the selectivity of our Top1mt antibody, as TPT, under these conditions induces high levels of cleavage complexes with nuclear Top1 (29). These results show that Top1mt* bearing the two substitutions T546A and N550H produces elevated levels of Top1mt*cc in the absence of any drugs.

Mapping Top1mt cleavage complexes – Having established that Top1mt* behaved as a poisoning topoisomerase, we used it to map Top1mt binding sites in the mitochondrial genome. To do so, we designed a tiling array for the mouse mtDNA including 3260 probes, where 55 out of 60 nucleotides of each probe overlapped with the next one (Fig. 2A, left). We performed chromatin immunoprecipitation (ChIP) in Top1mt KO MEFs expressing Top1mt* and hybridized the DNA fragments covalently bound to Top1mt* on the array (Fig. 2A, right and bottom panels). Figure 2B summarizes the distribution of Top1mt* sites over the entire mitochondrial genome (shown linearized instead of circular to simplify the presentation). Top1mt* sites were prominently enriched in the non-coding region (NCR), as well as at multiples sites within the ribosomal genes (12S and 16S). To ensure that the signals observed were Top1mt specific, we performed the same ChIP-on-chip protocol in Top1mt KO MEFs transduced with empty vector (Supplemental Fig. 1). Since these cells did not express Top1mt, all sequences immunoprecipitated in these samples can be considered non-specific. IP signals from Top1mt KO cells gave completely different readouts in the negative control, particularly in the NCR, eliminating the possibility that the peaks from Top1mt* mapping results could be false positive peaks. An expanded view of the Top1mt* sites in the NCR is shown in Figure 2C. The NCR (about 880 base pair long) contains the promoters for mitochondrial transcription (black arrowheads) and the origin of replication of H-strand (OH) (15). Transcription of mtDNA starts from three different promoters (HSP1, HSP2 and LSP) and proceeds bidirectionally (Fig. 2C, bottom scheme). In a

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  5  

circular genome such as mtDNA, bidirectional transcription leads to accumulation of negative supercoils (i.e. underwound DNA) behind the transcription machinery and positive supercoils ahead of it (30). The high density of Top1mt* sites in the NCR and ribosomal mtDNA genes, which are highly transcribed, could reflect the need for Top1mt to resolve topological tensions related to mtDNA transcription. Indeed, Top1 is involved in the removal of negative supercoils during transcription elongation in the nucleus, avoiding R-loop formation behind the RNA polymerase (8,31-35). Accordingly, cells lacking Top1mt accumulates highly negative supercoiled mtDNA (21), consistent with a role of Top1mt in removing transcription-associated supercoiling in the mitochondrial genome.

The coincidence of Top1mt sites with mtDNA replication origins for both the heavy and light strand [OH (Fig. 2B-C) and OL (Fig. 2B)] suggests a potential role for Top1mt in mtDNA replication. As shown in Figure 2C, H-strand DNA synthesis starts at OH and can stop prematurely producing the so-called 7S DNA. 7S DNA has a short half-life and is continuously degraded and re-synthesized to maintain the triple-stranded D-loop structure (36). The very strong Top1mt sites at the RNA-DNA switch site (site ∼16060 in Fig. 2C) and over on a broad area downstream OH could reflect Top1mt involvement in adjusting mtDNA topology in association with replication initiation. Similarly, a cluster of Top1mt sites was found at the OL region (Fig. 2B). In addition, a cluster of strong Top1mtcc sites were detected at the end of the D-loop (centered around sites 15335 and 15420), matching the strong site previously detected by ligation-mediated PCR (22), and which also match the Termination Associated Sequence (TAS) element. Hence, it appears that Top1mt* cleavage sites are concentrated in two regions corresponding to the 3’ and 5’ end (OH) of 7S DNA (18,22,37), indicating that Top1mt acts at the edge of the D-loop region. This finding might be related to the fact that Top1 cleavage is driven not only by DNA sequence but also by secondary structure of the template (38). To compare the sites generated by Top1mt* with those induced by Top1cc-targeted drugs, we performed the same ChIP-on-chip experiments in cells expressing wt Top1mt and treated with topotecan (TPT) (Supplemental Fig 2).

Interestingly, TPT induced sites were less concentrated in the NCR and spread on the entire mitochondrial genome. The different distributions between TPT induced and Top1mt* sites is likely due to the drug sequence bias in trapping Top1 (24) that redistributes the enzyme from its “natural” positions.

Together, our mapping results support the implication of Top1mt in mtDNA transcription and replication.

Strand-specific sequencing of the Top1mt* cleavage sites in the NCR - The ChIP-on-chip approach revealed Top1mt*cc position on the entire mitochondrial genome but could not discriminate to which strand Top1mt was linked. To address this question, we designed double-stranded oligonucleotides with sequences spanning four major Top1mt sites within the NCR (+/- 20 bases from the peak) (Table 1 and Fig. 3, oligos B-E). End-labeling of the H- or L-strand allowed the detection of Top1mt cleavage sites on both DNA strands (Fig. 3). Consistent with the in vivo data (Fig. 1C, Fig. 2B and S2), Top1mt* cleaved DNA much more efficiently than Top1mt in the absence of CPT (compare lanes 2 and 4). Moreover, Top1mt sites induced by CPT were often at different positions from those produced by Top1mt* (compare lanes 3 and 4). The sequence-selective trapping of Top1cc by CPT likely accounts for these differences (24). For the two strong sites at the edges of the 7S DNA region (positions 15420 and 16060) (see Fig. 2C), Top1mt cleaved mainly the L-strand sequence (Fig. 3C and E). On the contrary, around positions 15335 and 15690 Top1mt primarily cleaved the H-strand (Fig. 3B and D). The consensus sequence for nuclear Top1 cleavage has been defined as -4 (AT), -3 (GAC), -2 (AT), -1 (T) +1 (GA) (24,39). The analysis of Top1mt cleavage sites mapped in Fig. 3 revealed high similarity between Top1mt and Top1 biochemical sites (see Table 1), indicating that, in addition to DNA structure, the DNA sequence itself play an important role in determining the trapping of Top1mt*. Indeed, the sites in oligonucleotides were also present in cells (compare Figs. 2 and 3).

Top1mt* expression leads to mtDNA elimination – Having established that Top1mt* efficiently produced Top1mt*cc independently of drug both, in cells and in biochemical assays, we

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  6  

investigated the fate of mtDNA after expression of the poisonous Top1mt*. To do so, we transduced Top1mt KO MEFs with double mutant Top1mt* and followed mtDNA copy number for 4 consecutive days (Fig. 4A). Top1mt* expression led to a decrease of mtDNA, reaching about 50% of control after 3 days. Unlike Top1mt*, Top1mt expression did not affect mtDNA copy number. Because the mitochondrial genome encodes for 13 essential subunits of the mitochondrial respiratory chain, to test the consequences of Top1mt*-induced mtDNA loss, we measured the steady state levels of OXPHOS subunits after Top1mt* transduction (Fig. 4B). Three days after Top1mt* transduction, when mtDNA was depleted by 50%, we observed decreases in NDUFA9 and COX4 (complex I and IV subunits, respectively) (Fig. 4B). SDHA (subunits of complex II) was not affected by mtDNA depletion since complex II is entirely nuclear-coded (17). Previous reports showed that accumulation of nuclear Top1cc after pharmacological Top1 trapping leads to DNA lesions, which have to be repaired or will trigger apoptosis. Since mtDNA is partially depleted after Top1mt* expression, our results suggest that trapped Top1mt*cc are not effectively repaired in mitochondria and damaged mtDNA is eliminated. To test whether damaged mtDNA was degraded by mitochondrial autophagy (mitophagy) (40), we examined mitochondrial mass after Top1mt* transduction (Fig. 4C). Mitochondrial mass was not altered, indicating that Top1mt*-induced cleavage complexes activate an alternative mechanism of quality control for the degradation of highly damaged mtDNA. DISCUSSION Here we engineered a mutated Top1mt (Top1mt*) prone to trapping on mtDNA to determine Top1mt catalytic sites in the mitochondrial genome of mammalian cells. Using MEFs from Top1mt KO mice (19), we demonstrate that Top1mt acts preferentially in the regulatory NCR of the mitochondrial genome, with highest occupancy at the promoters and ribosomal RNA coding region. Top1mt sites also appeared concentrated at the beginning and the end of the D-loop region, and at the replication

origin of the L-strand. Biochemical mapping of Top1mt*cc within the four major cleavage sites identified in vivo showed a consensus sequence for Top1mt* cleavage very similar to the one previously reported for Top1 (39). These data indicate that the DNA sequence play a role in determining Top1mt* trapping. However, the strong accumulation of Top1mt* in the NCR indicates that other factors contribute to its trapping. The topological stress generated in the NCR is likely to be the driving force for Top1mt* accumulation. These results suggest a role for Top1mt in relieving mtDNA supercoiling generated by bidirectional transcription and replication and indicate that both, DNA sequence and topology are important in determining Top1mt trapping. Loss of mtDNA impairs the production of essential subunits of the mitochondrial respiratory chain, compromising the oxidative phosphorylation (OXPHOS) (17). The threshold of mtDNA depletion necessary to cause pathogenic mitochondrial dysfunctions varies from 50% to 80%, depending on cellular type (41,42). Here we show that high levels of Top1mt*cc deplete mtDNA by 50% and this partial depletion is sufficient to cause a marked decrease in the steady-state levels of OXPHOS subunits. Top1mt* expression depletes mtDNA by 50%. This limited mtDNA depletion could reflect the fact that only a fraction of mtDNA is targeted by Top1mt*. This would be consistent with our recent study showing that Top1mt associates only with the transcriptionally active fraction of mitochondrial nucleoids (43). Top1cc, which are normally very transient (44,45), are readily trapped on oxidized DNA bases and at DNA nicks, generating stable Top1-DNA intermediates (46). Considering the high oxidative stress present in mitochondria, the formation of persistent and potentially irreversible Top1mtcc could be a frequent “natural” event. Even though multiple mtDNA repair pathways are present in mitochondria (47), repair mechanisms are likely not able to contrast high levels of Top1mt*cc and damaged mtDNA is degraded. These findings provide novel insights and new molecular tools into the field of mtDNA repair.

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  7  

REFERENCES

1. Pommier, Y., Leo, E., Zhang, H., and Marchand, C. (2010) DNA topoisomerases and their poisoning by anticancer and antibacterial drugs. Chemistry & biology 17, 421-433

2. Champoux, J. J. (2001) DNA topoisomerases: structure, function, and mechanism. Annu Rev Biochem 70, 369-413

3. Zhang, H., Barcelo, J. M., Lee, B., Kohlhagen, G., Zimonjic, D. B., Popescu, N. C., and Pommier, Y. (2001) Human mitochondrial topoisomerase I. Proc Natl Acad Sci U S A 98, 10608-10613

4. Hsiang, Y. H., Hertzberg, R., Hecht, S., and Liu, L. F. (1985) Camptothecin induces protein-linked DNA breaks via mammalian DNA topoisomerase I. J. Biol. Chem. 260, 14873-14878

5. Staker, B. L., Hjerrild, K., Feese, M. D., Behnke, C. A., Burgin, A. B., Jr., and Stewart, L. (2002) The mechanism of topoisomerase I poisoning by a camptothecin analog. Proc Natl Acad Sci U S A 99, 15387-15392

6. Ioanoviciu, A., Antony, S., Pommier, Y., Staker, B. L., Stewart, L., and Cushman, M. (2005) Synthesis and mechanism of action studies of a series of norindenoisoquinoline topoisomerase I poisons reveal an inhibitor with a flipped orientation in the ternary DNA-enzyme-inhibitor complex as determined by X-ray crystallographic analysis. J Med Chem 48, 4803-4814

7. Pommier, Y., and Marchand, C. (2012) Interfacial inhibitors: targeting macromolecular complexes. Nat Rev Drug Discov 11, 25-36

8. Pommier, Y. (2006) Topoisomerase I inhibitors: camptothecins and beyond. Nat. Rev. Cancer 6, 789-802

9. Megonigal, M. D., Fertala, J., and Bjornsti, M. A. (1997) Alterations in the catalytic activity of yeast DNA topoisomerase I result in cell cycle arrest and cell death. J Biol Chem 272, 12801-12808

10. Fertala, J., Vance, J. R., Pourquier, P., Pommier, Y., and Bjornsti, M. A. (2000) Substitutions of Asn-726 in the active site of yeast DNA topoisomerase I define novel mechanisms of stabilizing the covalent enzyme-DNA intermediate. J Biol Chem 275, 15246-15253

11. Colley, W. C., van der Merwe, M., Vance, J. R., Burgin, A. B., Jr., and Bjornsti, M. A. (2004) Substitution of conserved residues within the active site alters the cleavage religation equilibrium of DNA topoisomerase I. J Biol Chem 279, 54069-54078

12. Zhang, H., Meng, L. H., Zimonjic, D. B., Popescu, N. C., and Pommier, Y. (2004) Thirteen-exon-motif signature for vertebrate nuclear and mitochondrial type IB topoisomerases. Nucleic Acids Res 32, 2087-2092

13. Dalla Rosa, I., Goffart, S., Wurm, M., Wiek, C., Essmann, F., Sobek, S., Schroeder, P., Zhang, H., Krutmann, J., Hanenberg, H., Schulze-Osthoff, K., Mielke, C., Pommier, Y., Boege, F., and Christensen, M. O. (2009) Adaptation of topoisomerase I paralogs to nuclear and mitochondrial DNA. Nucleic Acids Res 37, 6414-6428

14. Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J., Staden, R., and Young, I. G. (1981) Sequence and organization of the human mitochondrial genome. Nature 290, 457-465

15. Bonawitz, N. D., Clayton, D. A., and Shadel, G. S. (2006) Initiation and beyond: multiple functions of the human mitochondrial transcription machinery. Mol Cell 24, 813-825

16. Falkenberg, M., Larsson, N. G., and Gustafsson, C. M. (2007) DNA replication and transcription in mammalian mitochondria. Annu Rev Biochem 76, 679-699

17. Kasiviswanathan, R., Collins, T. R., and Copeland, W. C. (2012) The interface of transcription and DNA replication in the mitochondria. Biochim Biophys Acta 1819, 970-978

18. Gillum, A. M., and Clayton, D. A. (1978) Displacement-loop replication initiation sequence in animal mitochondrial DNA exists as a family of discrete lengths. Proc Natl Acad Sci U S A 75, 677-681

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  8  

19. Douarre, C., Sourbier, C., Dalla Rosa, I., Brata Das, B., Redon, C. E., Zhang, H., Neckers, L., and Pommier, Y. (2012) Mitochondrial topoisomerase I is critical for mitochondrial integrity and cellular energy metabolism. PLoS One 7, e41094

20. Khiati, S., Dalla Rosa, I., Sourbier, C., Ma, X., Rao, V. A., Neckers, L. M., Zhang, H., and Pommier, Y. (2014) Mitochondrial topoisomerase I (Top1mt) is a novel limiting factor of doxorubicin cardiotoxicity. Clinical cancer research : an official journal of the American Association for Cancer Research

21. Zhang, H., Zhang, Y., Yasukawa, T., Dalla Rosa, I., Khiati, S., and Pommier, Y. (2014) Increased negative supercoiling of mtDNA in TOP1mt knockout mice and presence of topoisomerases IIα and IIβ in vertebrate mitochondria. Nucl. Acids Res. In press

22. Zhang, H., and Pommier, Y. (2008) Mitochondrial topoisomerase I sites in the regulatory D-loop region of mitochondrial DNA. Biochemistry 47, 11196-11203

23. Burke, T. G., Mishra, A. K., Wani, M. C., and Wall, M. E. (1993) Lipid bilayer partitioning and stability of camptothecin drugs. Biochemistry 32, 5352-5364

24. Jaxel, C., Capranico, G., Kerrigan, D., Kohn, K. W., and Pommier, Y. (1991) Effect of local DNA sequence on topoisomerase I cleavage in the presence or absence of camptothecin. J Biol Chem 266, 20418-20423

25. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., and Pease, L. R. (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61-68

26. Regairaz, M., Zhang, Y. W., Fu, H., Agama, K. K., Tata, N., Agrawal, S., Aladjem, M. I., and Pommier, Y. (2011) Mus81-mediated DNA cleavage resolves replication forks stalled by topoisomerase I-DNA complexes. J Cell Biol 195, 739-749

27. Dexheimer, T. S., and Pommier, Y. (2008) DNA cleavage assay for the identification of topoisomerase I inhibitors. Nat Protoc 3, 1736-1750

28. Croce, A. C., Bottiroli, G., Supino, R., Favini, E., Zuco, V., and Zunino, F. (2004) Subcellular localization of the camptothecin analogues, topotecan and gimatecan. Biochem. Pharmacol. 67, 1035-1045

29. Tanizawa, A., Fujimori, A., Fujimori, Y., and Pommier, Y. (1994) Comparison of topoisomerase I inhibition, DNA damage, and cytotoxicity of camptothecin derivatives presently in clinical trials. J. Natl. Cancer Inst. 86, 836-842

30. Liu, L. F., and Wang, J. C. (1987) Supercoiling of the DNA template during transcription. Proc Natl Acad Sci U S A 84, 7024-7027

31. El Hage, A., French, S. L., Beyer, A. L., and Tollervey, D. (2010) Loss of Topoisomerase I leads to R-loop-mediated transcriptional blocks during ribosomal RNA synthesis. Genes Dev 24, 1546-1558

32. Drolet, M., Bi, X., and Liu, L. F. (1994) Hypernegative supercoiling of the DNA template during transcription elongation in vitro. J Biol Chem 269, 2068-2074

33. French, S. L., Sikes, M. L., Hontz, R. D., Osheim, Y. N., Lambert, T. E., El Hage, A., Smith, M. M., Tollervey, D., Smith, J. S., and Beyer, A. L. (2011) Distinguishing the roles of Topoisomerases I and II in relief of transcription-induced torsional stress in yeast rRNA genes. Mol Cell Biol 31, 482-494

34. Aguilera, A., and Garcia-Muse, T. (2012) R loops: from transcription byproducts to threats to genome stability. Mol Cell 46, 115-124

35. Sordet, O., Redon, C. E., Guirouilh-Barbat, J., Smith, S., Solier, S., Douarre, C., Conti, C., Nakamura, A. J., Das, B. B., Nicolas, E., Kohn, K. W., Bonner, W. M., and Pommier, Y. (2009) Ataxia telangiectasia mutated activation by transcription- and topoisomerase I-induced DNA double-strand breaks. EMBO reports 10, 887-893

36. Bogenhagen, D., and Clayton, D. A. (1978) Mechanism of mitochondrial DNA replication in mouse L-cells: kinetics of synthesis and turnover of the initiation sequence. J Mol Biol 119, 49-68

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  9  

37. Doda, J. N., Wright, C. T., and Clayton, D. A. (1981) Elongation of displacement-loop strands in human and mouse mitochondrial DNA is arrested near specific template sequences. Proc Natl Acad Sci U S A 78, 6116-6120

38. Krogh, S., Mortensen, U. H., Westergaard, O., and Bonven, B. J. (1991) Eukaryotic topoisomerase I-DNA interaction is stabilized by helix curvature. Nucleic Acids Res 19, 1235-1241

39. Parker, L. H., and Champoux, J. J. (1993) Analysis of the biased distribution of topoisomerase I break sites on replicating simian virus 40 DNA. Journal of molecular biology 231, 6-18

40. Ding, W. X., and Yin, X. M. (2012) Mitophagy: mechanisms, pathophysiological roles, and analysis. Biol Chem 393, 547-564

41. Dimmock, D., Tang, L. Y., Schmitt, E. S., and Wong, L. J. (2010) Quantitative evaluation of the mitochondrial DNA depletion syndrome. Clinical chemistry 56, 1119-1127

42. Dimmock, D. P., Zhang, Q., Dionisi-Vici, C., Carrozzo, R., Shieh, J., Tang, L. Y., Truong, C., Schmitt, E., Sifry-Platt, M., Lucioli, S., Santorelli, F. M., Ficicioglu, C. H., Rodriguez, M., Wierenga, K., Enns, G. M., Longo, N., Lipson, M. H., Vallance, H., Craigen, W. J., Scaglia, F., and Wong, L. J. (2008) Clinical and molecular features of mitochondrial DNA depletion due to mutations in deoxyguanosine kinase. Human mutation 29, 330-331

43. Sobek, S., Dalla Rosa, I., Pommier, Y., Bornholz, B., Kalfalah, F., Zhang, H., Wiesner, R. J., von Kleist-Retzow, J. C., Hillebrand, F., Schaal, H., Mielke, C., Christensen, M. O., and Boege, F. (2013) Negative regulation of mitochondrial transcription by mitochondrial topoisomerase I. Nucleic Acids Res 41, 9848-9857

44. Koster, D. A., Crut, A., Shuman, S., Bjornsti, M. A., and Dekker, N. H. (2010) Cellular strategies for regulating DNA supercoiling: a single-molecule perspective. Cell 142, 519-530

45. Seol, Y., Zhang, H., Pommier, Y., and Neuman, K. C. (2012) A kinetic clutch governs religation by type IB topoisomerases and determines camptothecin sensitivity. Proc Natl Acad Sci U S A 109, 16125-16130

46. Pourquier, P., and Pommier, Y. (2001) Topoisomerase I-mediated DNA damage. Adv Cancer Res 80, 189-216

47. Kazak, L., Reyes, A., and Holt, I. J. (2012) Minimizing the damage: repair pathways keep mitochondrial DNA intact. Nature reviews. Molecular cell biology 13, 659-671

ACKNOWLEDGEMENTS

We wish to thank all members of the laboratory of Molecular Pharmacology and Developmental Therapeutics Branch for constructive comments. Our studies are supported by the Intramural Program of the National Cancer Institute, National Institutes of Health, DHHS (Grant Z01 BC 006161).

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  10  

FIGURE LEGENDS Figure 1: T546A and N550H mutations trap Top1mt - A. Alignment of the C-terminal region of yeast Top1 with corresponding regions of mouse and human Top1mt polypeptides. Thr722 and Asn726 of yeast Top1 are conserved in Top1mt. B. Experimental approach. Thr546 and Asn550 of mouse Top1mt were mutated to Ala and His, respectively. Native (Top1mt) and mutated (Top1mt*) enzymes were expressed in Top1mt KO MEFs using a lentiviral expression system. Top1mt KO MEFs transduced with empty virus (EV) were used as control. C. Western blot showing Top1mt expression in control cells (EV) and cells expressing Top1mt and Top1mt* 24 h after transduction. D. Formation of Top1mtcc in MEFs transduced with EV, Top1mt or Top1mt* in the presence or absence of topotecan (TPT). Total cellular DNA was extracted and 650 ng were blotted to PVDF membrane using a slot-blot vacuum system. Top1mt-mtDNA complexes were visualized by Western blotting using Top1mt specific antibody. Figure 2: Distribution of Top1mt* cleavage complexes (Top1mt*cc) in the mouse mitochondrial genome with preferential accumulation in regulatory regions - A. Scheme of the ChIP-on-chip method for mapping Top1mt binding sites in the mitochondrial genome in cells. Left: murine mtDNA tiling array design; Right: following transduction of Top1mt KO MEFs with flagged Top1mt*, enzyme-DNA complexes were immunoprecipitated using Flag antibody. Crosslinks between Top1mt* and mtDNA were proteolyzed prior to hybridization on the array specific for the murine mitochondrial genome. B. Top1mt*cc sites along the whole mtDNA. For convenience, the mitochondrial genome is shown linearly with the non-coding regulatory region (NCR) in the center. For each probe on the chip, the signal (log2 values) for the immunoprecipitated (IP) sample was normalized to the no IP sample. The murine mitochondrial genome organization is schematized under the plot with its 2 rRNA coding sequences (gray arrow: 12S and 16S), 13 mRNA (12 of which are coded by the H-strand, and shown as arrows pointing right), and 22 tRNAs. C. Detailed mapping of the Top1mt sites in the NCR. Discrete peaks are indicated by dotted lines and their position is shown on top. Organization of the NCR is sketched below; LSP: light strand promoter; HSP1/2: heavy strand promoters 1 and 2; CBS1, 2 and 3: conserved sequences 1, 2 and 3; TAS: termination associated sequence; OH: replication origin for the H-strand. Figure 3: Nucleotide resolution mapping of the prominent Top1mt sites in the NCR - A. Schematic representation of the regions analyzed in panels B-E. Double-stranded 40 base pair oligonucleotides corresponding to the sequences identified as Top1mt cleavage sites by ChIP-on chip analysis (see Fig. 2) were used as substrates for DNA cleavage assay using recombinant Top1mt and Top1mt*, as indicated. B-E. Representative experiments showing Top1mt and Top1mt* cleavage sites. Reaction products were resolved on polyacrylamide gels. For each sequence analyzed, lanes 2 and 3 show cleavage sites induced by Top1mt in the absence or presence of camptothecin (CPT), respectively. Lanes 4 show cleavage sites generated by Top1mt* independently of CPT. Strand-specific labeling allowed the discrimination of L- or H-strand cleavage. Genomic positions corresponding to the cleavage sites are annotated on the sides of each gel. Figure 4: Expression of Top1mt* is toxic to cellular mtDNA – A. Quantification of mtDNA in Top1mt KO MEFs after transduction of Top1mt and Top1mt*. Values at each time point are relative to mtDNA copy number of Top1mt KO MEFs transduced with empty vector. B. Western Blot analysis of respiratory chain subunits in Top1mt KO MEFs three days after transduction of the construct indicated on the top. OXPHOS subunits tested were COX4 (Complex IV), NDUFA9 (Complex I), and SDHA (Complex II). C. Mitochondrial mass quantification 3 days after Top1mt* or Top1mt transduction.

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

 

  11  

Table 1. Oligonucleotide sequences used for Top1mt* biochemical mapping. Capital letters indicate the -1 positions of Top1mt* cleavage sites.

Peak position Strand Sequence 5’-3’

15335 (B)

L ggtctTgtaaacctgaaaTgaagatcttctcttctcaaga H tcttgagaagagaagaTcttcatttcaggtttacaagacc

15420 (C)

L gtattctaattaaactacTtctTgagtacataaatttaca H tgtaaatttatgtactCaagaagtagtttaattagaatac

15690 (D)

L tccccatttggtctatTaatctaccatcctccgtgaaacc H ggtttcacggaggaTggtagaTtaatagaccaaatgggga

16060 (E)

L attcatgcttgtTagacaTaaaTgctactcaataccaaat H atttggtattgagtagcatttatgtctaacaagcatgaat

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

Yeast Top1 T722A, N726HMouse Top1mt T546A, N550H =Top1mt*

ScTop1-C-termmmTop1mt-CtermHsTop1mt-Cterm

702 736526 560534 568

- - - - - I Q L K D K E E N S Q V S L G T S K I N Y I D P R L S V V FL A R L C A K A T D K E E N K Q V A L G T A K L N Y L D P R I S I A WL A Q L S V Q A T D K E E N K Q V A L G T S K L N Y L D P R I S I A W

A

C

Top1mt

EV

B

Top1mt*

-TPT

+TPT

Top1mt

EV Top1mt*D

mmTop1mt

5931

Figure 1

Emptyvector

(EV)

Top1mt

Top1mt*

Virus production

EV Top1mt Top1mt*

Transduction

Top1mt KO MEFs

EV Top1mt Top1mt*

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

A60 bases

55 bases5 bases

Mouse mtDNA

3260 probes

Chip

N550H

T546AFlagTop1mt*

Transduction

ChIP

Top1

mt*

bin

ding

B

COX3ATP8 ND3 ND4 ND5 ND6 CYTB NCRND4L

OH

12S 16S ND1 ND2 COX1 COX2

OL

ATP6

1.5

1.0

0.5

0

1.5

1.0

0.5

1533515420

15630

15690

16060

12SCytB OH

180

C

7S

Figure 2

Hybridization

Top1

mt*

bin

ding

HSP1/2

CBS1 CBS3

CBS2TAS

F

LSP

TP L

H5’3’

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

15420 L 15420 HTop1mt − + + − − + + −

CPT − − + − − − + − Top1mt* − − − + − − − +

1541815422

15424

15335 L 15335 HTop1mt − + + − − + + −

CPT − − + − − − + − Top1mt* − − − + − − − +

LH

TAS

TP

CytB

CBS1 CBS2 CBS3

OH

5’3’

15335

15420

15690

16060

15321

1533315338

B C

A

Figure 3

B C D E

F12SHSP1/2

LSP

1 2 3 4 1 2 3 4 1 2 3 41 2 3 4

16051

16057

16061

16060 L 16060 HTop1mt − + + − − + + −

CPT − − + − − − + − Top1mt* − − − + − − − +

15690 L 15690 HTop1mt − + + − − + + −

CPT − − + − − − + − Top1mt* − − − + − − − +

1568615688

15695

D E

1 2 3 4 1 2 3 41 2 3 4 1 2 3 4

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

0

0.5

1.0

1.5

day 1 day 2 day 3 day 4

Top1mt Top1mt*

A

1

0.5

1.5

Mito

chon

dria

l mas

sC

Figure 4

B

SDHA (II)

NDUFA9 (I)

COX4 (IV)

EV

Top1mt

Top1mt*

MtD

NA

cop

y nu

mbe

r(%

con

tro)

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from

Yves PommierIlaria Dalla Rosa, Shar-yin N. Huang, Keli Agama, Salim Khiati, Hongliang Zhang and

Mapping Topoisomerase Sites in Mitochondrial DNA with a Poisonous Top1mt

published online May 5, 2014J. Biol. Chem. 

  10.1074/jbc.M114.555367Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2014/05/05/M114.555367.DC1

by guest on February 4, 2018http://w

ww

.jbc.org/D

ownloaded from