Manual KOOI-REACHFORKS® · the other hand until the locker engages again at the different length....

2
These patented lift truck tines are extended in length manually by the lift truck driver. The mechanical “movable outer sleeves” are secured to the base fork and cannot be removed. They simply extend and lock into place. These forks offer a lower cost alternative to hydraulic KOOI-forks and they are typically used in applications with less frequent need for tine length change. FEATURES • Remain mounted on the forklift truck so they are always available for the driver. • Lightweight construction that is extended easily to a variety of lengths. • Cannot catch on objects, like tensioning straps. • Eliminate safety risks and inconveniences typically associated with loose fork extensions. • Extension in just one simple movement. • No hydraulic parts. • Low maintenance costs. • No loose parts. The simplicity of extension forks Manual extendable forks stay on the forklift truck permanently, saving time, space and money compared to traditional fork extensions (outersleeves). This mechanical option is lower in cost than the hydraulic fork making it ideal for low usage application. The manner of adjusting the outer sleeve is highly innovative. It simply involves moving a pin (which also serves as a grease nipple) sideways, causing the locker to be retracted. As soon as the locker is disengaged, the outer sleeve can be moved using the other hand until the locker engages again at the different length. Manual KOOI-REACHFORKS®

Transcript of Manual KOOI-REACHFORKS® · the other hand until the locker engages again at the different length....

Page 1: Manual KOOI-REACHFORKS® · the other hand until the locker engages again at the different length. ... D1/D2*S (mm) CoG1 (mm) CoG2 (mm) Weight (kg) ISO/ FEM MME 17 0800/0400 1700

These patented lift truck tines are extended in length manually by the lift truck driver. The mechanical “movable outer sleeves” are secured to the base fork and cannot be removed. They simply extend and lock into place. These forks offer a lower cost alternative to hydraulic KOOI-forks and they are typically used in applications with less frequent need for tine length change.

FEATURES• Remain mounted on the forklift truck so they are always available for the driver.

• Lightweight construction that is extended easily to a variety of lengths.

• Cannot catch on objects, like tensioning straps.

• Eliminate safety risks and inconveniences typically associated with

loose fork extensions.

• Extension in just one simple movement.

• No hydraulic parts.

• Low maintenance costs.

• No loose parts.

The simplicity of extension forksManual extendable forks stay on the forklift truck permanently, saving time, space and money compared to traditional fork extensions (outersleeves). This mechanical option is lower in cost than the hydraulic fork making it ideal for low usage application. The manner of adjusting the outer sleeve is highly innovative. It simply involves moving a pin (which also serves as a grease nipple) sideways, causing the locker to be retracted. As soon as the locker is disengaged, the outer sleeve can be moved using the other hand until the locker engages again at the different length.

Manual KOOI-REACHFORKS®

Page 2: Manual KOOI-REACHFORKS® · the other hand until the locker engages again at the different length. ... D1/D2*S (mm) CoG1 (mm) CoG2 (mm) Weight (kg) ISO/ FEM MME 17 0800/0400 1700

Manual KOOI-REACHFORKS®

• The lift truck manufacturer must determine the combined extension fork and lift truck capacity.• Meijer Handling Solutions reserves the right to modify and improve their products without prior notice being given.• In cold-storage applications KOOI-REACHFORKS® can be used down to -30 degrees Celcius, contact your dealer.

Model Capacity on LC 600 mm (kg)

L(mm)

L+K(mm)

C(mm)

Section D1/D2*S (mm)

CoG1(mm)

CoG2(mm)

Weight(kg)

ISO/FEM

MME 17 0800/0400

1700

800 400

40 132x41

220 245 95

2AMME 17 0800/0200 800 200 220 245 95MME 17 1000/0200 1000 200 295 315 110MME 17 1200/0800 1200 800 380 500 121

MME 20 0800/0400

2000

800 400

45 132x58

235 295 114

2AMME 20 0800/0200 800 200 235 295 114MME 20 1000/0200 1000 200 315 415 131MME 20 1200/0800 1200 800 405 545 150MME 20 1400/1000 1400 1000 484 640 161

MME 24 0800/0200

2400

800 200

45 132x45

220 275 104

2AMME 24 0800/0400 800 400 220 275 104MME 24 1000/0200 1000 200 300 325 121MME 24 1200/0800 1200 800 385 515 135

MME 30 0800/0200

3000

0800 200

45 132x58

220 275 122

3AMME 30 0800/0400 0800 400 220 275 122MME 30 1000/0200 1000 200 300 325 144MME 30 1200/0800 1200 800 390 515 158MME 30 1400/1000 1400 1000 470 645 176

MME 35 0800/0200

3500

800 200

50 132x63

230 300 140

3AMME 35 0800/0400 800 400 230 300 140MME 35 1000/0200 1000 200 320 390 160MME 35 1200/0800 1200 800 400 550 183MME 35 1400/1000 1400 1000 485 680 205


Cog5 Cog7 crystal structure reveals interactions essential for the … · tions of Cog2 and Cog4, the structures of COG’s eight subunits and the principles governing their assembly

Cog5 Cog7 crystal structure reveals interactions essential for the … · tions of Cog2 and Cog4, the structures of COG’s eight subunits and the principles governing their assembly

STANDARD PATTERNS OF SILK-SCREEN PRINTING...STANDARD PATTERNS OF SILK-SCREEN PRINTING 20 mm 15 mm 3 mm 5 mm 11 mm 11 mm 10 mm 13 mm 15 mm 30 mm 40 mm 20 mm 15 mm 20 mm 5 mm 2 mm 7

STANDARD PATTERNS OF SILK-SCREEN PRINTING...STANDARD PATTERNS OF SILK-SCREEN PRINTING 20 mm 15 mm 3 mm 5 mm 11 mm 11 mm 10 mm 13 mm 15 mm 30 mm 40 mm 20 mm 15 mm 20 mm 5 mm 2 mm 7

MM-01 MM-03 MM-02 · 2020. 5. 25. · MM-01 MM-03 MM-04 MM-05 MM-06 MM-02 MM-07 MM-08 MM-09. MM-10 MM-12 MM-13 MM-14 MM-15 MM-11 MM-16 MM-17 MM-18. MM-19 MM-21 MM-22 MM-23 MM-24 MM-20

MM-01 MM-03 MM-02 · 2020. 5. 25. · MM-01 MM-03 MM-04 MM-05 MM-06 MM-02 MM-07 MM-08 MM-09. MM-10 MM-12 MM-13 MM-14 MM-15 MM-11 MM-16 MM-17 MM-18. MM-19 MM-21 MM-22 MM-23 MM-24 MM-20

Preview of "Cog1-2008F-01-Foundations1.ppt"

Preview of "Cog1-2008F-01-Foundations1.ppt"

COG Complex Complexities : Detailed Characterization of a ...eprints.whiterose.ac.uk/99817/1/fcell_04_00023.pdf · AAACTTGCCCA, Cog2 Catalog No. HCP205454-CG01-3-B-a Target: CTTGTTGATGAGTTCGACCA,

COG Complex Complexities : Detailed Characterization of a ...eprints.whiterose.ac.uk/99817/1/fcell_04_00023.pdf · AAACTTGCCCA, Cog2 Catalog No. HCP205454-CG01-3-B-a Target: CTTGTTGATGAGTTCGACCA,

Pier Caps - Thermatech Cap Brochure.pdf · Pier Caps . 180 mm 60 mm 69 mm 200 mm 200 mm 75 mm 75 mm 200 mm 200 mm 75 mm 85 mm 200 mm Pier Caps . 150 mm 60 mm 200 mm 70 mm 74 mm 200

Pier Caps - Thermatech Cap Brochure.pdf · Pier Caps . 180 mm 60 mm 69 mm 200 mm 200 mm 75 mm 75 mm 200 mm 200 mm 75 mm 85 mm 200 mm Pier Caps . 150 mm 60 mm 200 mm 70 mm 74 mm 200

Time Words and music byJames Blunt, Steve Robson,Ryan Tedder and Bob Marley … · 2017-08-10 · MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM

Time Words and music byJames Blunt, Steve Robson,Ryan Tedder and Bob Marley … · 2017-08-10 · MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM

Head Start Early Learning Outcomes Framework 2015 (Birth ... · • Infant/Toddler COG2, COG8 Emergent Mathematical Thinking • Infant/Toddler COG1, COG2, COG3 Imitation & Symbolic

Head Start Early Learning Outcomes Framework 2015 (Birth ... · • Infant/Toddler COG2, COG8 Emergent Mathematical Thinking • Infant/Toddler COG1, COG2, COG3 Imitation & Symbolic

FRIDGE & FREEZER - LG USA...400 mm 50 mm 570 mm mm 565 mm 570 mm 592 mm 404 mm 51 mm 54.5 mm 39 mm 696 mm 5 mm 400 mm 1017 mm 617 mm 1775 mm 1802 mm 220 mm 60 mm 300 mm 360 mm •

FRIDGE & FREEZER - LG USA...400 mm 50 mm 570 mm mm 565 mm 570 mm 592 mm 404 mm 51 mm 54.5 mm 39 mm 696 mm 5 mm 400 mm 1017 mm 617 mm 1775 mm 1802 mm 220 mm 60 mm 300 mm 360 mm •

. fiEÿJ IMT2500 MT2500Z MT2500S 910 390 850 MT2500SZ 1828 X14ûll (î41 mm mm mm mm mm mm mm mm mm mm min mm mm mm mm mm 602 550 [KM63 540 [Coromant Capto CG

. fiEÿJ IMT2500 MT2500Z MT2500S 910 390 850 MT2500SZ 1828 X14ûll (î41 mm mm mm mm mm mm mm mm mm mm min mm mm mm mm mm 602 550 [KM63 540 [Coromant Capto CG

Scalpelli Freer Implantologia Freer chisels Implantology ... · Implantologia Implantology mm 17,0 mm 15,0 mm 4 mm 6 mm 8 mm 10 mm 12 mm 17,0 mm 15,0 mm 4 mm 6 mm 8 mm 10 mm 12 mm

Scalpelli Freer Implantologia Freer chisels Implantology ... · Implantologia Implantology mm 17,0 mm 15,0 mm 4 mm 6 mm 8 mm 10 mm 12 mm 17,0 mm 15,0 mm 4 mm 6 mm 8 mm 10 mm 12 mm

Conserved oligomeric Golgi complex subunit 1 deficiency ... · graded in Cog1- and Cog2-deficient CHO mutants (13). Yeast mutants with defects in COG subunits have also been identified

Conserved oligomeric Golgi complex subunit 1 deficiency ... · graded in Cog1- and Cog2-deficient CHO mutants (13). Yeast mutants with defects in COG subunits have also been identified

Words and Music by Jim Henson, Sam Pottle and …MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM 14 14 15 16 17 18 19 20 21 Sop. Cor. Solo Cor. Rep. Cor. 2nd Cor. 3rd

Words and Music by Jim Henson, Sam Pottle and …MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM 14 14 15 16 17 18 19 20 21 Sop. Cor. Solo Cor. Rep. Cor. 2nd Cor. 3rd

Instruction For Use - europe.gc.dental · 1,5 mm 1,2 mm 1,0 mm 1,2 mm 1,0 mm Rounded Shoulder 1,5 mm 1,5 mm 1,0 mm Max. 11 mm 1,0 mm 1,2 mm 1,5 mm Max. 9 mm 1,0 mm 1,5 mm Fig. 1 Fig.

Instruction For Use - europe.gc.dental · 1,5 mm 1,2 mm 1,0 mm 1,2 mm 1,0 mm Rounded Shoulder 1,5 mm 1,5 mm 1,0 mm Max. 11 mm 1,0 mm 1,2 mm 1,5 mm Max. 9 mm 1,0 mm 1,5 mm Fig. 1 Fig.

Time 3.56min. Words and Music by Ragnar Thorhallsson NannaBryndis Hilmarsdottir LITTLE ... · 2017-08-09 · Steady Beat q = 106 MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM

Time 3.56min. Words and Music by Ragnar Thorhallsson NannaBryndis Hilmarsdottir LITTLE ... · 2017-08-09 · Steady Beat q = 106 MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM

LEITERPLATTENVERBINDER - Elmatik - Deutsch.… · 2,5 mm 2,50 mm 3,50 mm 5,00 mm 7,50 mm 10,00 mm 2,54 mm 3,81 mm 5,08 mm 7,62 mm 10,16 mm 3,5 mm 5,0 mm 7,00 mm 7,0 mm 7,5 mm 10,0

LEITERPLATTENVERBINDER - Elmatik - Deutsch.… · 2,5 mm 2,50 mm 3,50 mm 5,00 mm 7,50 mm 10,00 mm 2,54 mm 3,81 mm 5,08 mm 7,62 mm 10,16 mm 3,5 mm 5,0 mm 7,00 mm 7,0 mm 7,5 mm 10,0

Time Words and Music by Andrew Hozier Byrne TAKE ME … · Words and Music by Andrew Hozier rByrne 3 4 MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM

Time Words and Music by Andrew Hozier Byrne TAKE ME … · Words and Music by Andrew Hozier rByrne 3 4 MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM MM

Kataloğu İndirmek İçin21 mm 25 mm 31 mm 04 I. Technical details çap mm 18, 19, 20 mm 18, 19, 20, 22 mm 0.26 mm 22, 24 mm 0.74 mm 0.70 mm 0.66 mm 0.62 mm 0.58 mm 0.54 mm 0.50 mm

Kataloğu İndirmek İçin21 mm 25 mm 31 mm 04 I. Technical details çap mm 18, 19, 20 mm 18, 19, 20, 22 mm 0.26 mm 22, 24 mm 0.74 mm 0.70 mm 0.66 mm 0.62 mm 0.58 mm 0.54 mm 0.50 mm

M. Pharmacy I Semester (Main & Backlog) Examination ...gprcp.ac.in/Qpmp/pci/all cog1.pdfSubject: Advanced Pharmacognosy ... 7 Write short notes on a) Dietary fibers 9 b) Digestive

M. Pharmacy I Semester (Main & Backlog) Examination ...gprcp.ac.in/Qpmp/pci/all cog1.pdfSubject: Advanced Pharmacognosy ... 7 Write short notes on a) Dietary fibers 9 b) Digestive

08-All A4 - ystsb.com · Grease * Consult us E mm mm mm tr/min omw/min rpm min degré qraad degree Grad mm: ± kgm2 dm3 mm mm mm mm mm mm mm mm mm mm mm 3.1 3.2 10

08-All A4 - ystsb.com · Grease * Consult us E mm mm mm tr/min omw/min rpm min degré qraad degree Grad mm: ± kgm2 dm3 mm mm mm mm mm mm mm mm mm mm mm 3.1 3.2 10