1

Program workshop

Malassezia: from skin to model species July 4-6, 2018 Westerdijk Fungal Biodiversity Institute, Uppsalalaan 8, 3584CT Utrecht, The Netherlands How to get there http://www.westerdijkinstitute.nl/DefaultInfo.aspx?Page=ContactUs

Organizers Teun Boekhout & Thomas Dawson ISHAM working group Malassezia, epidemiology and pathobiology & Malassezia Research Consortium Support

2

Wednesday afternoon, July 4 Theme Ecology, diversity and microbiome 14.00-14.30 Keynote

Biodiversity and ecology of Malassezia species. F.J. Cabañes Universitat Autònoma de Barcelona, BELLATERRA, BARCELONA, Spain

Malassezia species form a monophyletic group of basidiomycetous yeasts unique among the fungi. They are characterized to be lipophilic microorganisms which are associated to the human and animal skin. The genus was created by Baillon in 1889 and remained limited to only two species, M. furfur and M. pachydermatis, for over a century. Nowadays, the genus includes 17 species and new species are expected to be described in the coming years. Special morphological characteristics (e.g. colony and cell morphology) have been cited for some Malassezia spp. However, separation of Malassezia species on the basis of only morphological characteristics may be considered to be subjective or unreliable. Currently, the phenotypical characterization of these yeasts is based mainly on the evaluation of their ability to use certain polyoxyethylene sorbitan esters (Tweens 20, 40, 60 and 80) and Cremophor EL. However, difficulties remain in obtaining a high level of certainty in the identification of some lipid-dependent strains by means of physiological tests without molecular characterization. Although a genetic boundary between Malassezia species has been not clearly stated, the within-species “gold standard” D1/D2 sequence similarity is above 99% (<1% of dissimilarity). Other molecular markers (e.g. ITS region, CH2 and beta-tubulin genes) may be useful to achieve discrimination among the species of this group. On the other hand, genomics has become a promising methodology to infer phylogenetic relationships among these species. Minimal standards for the use of genome data in delineating new species in this group should be discussed. As far as the ecology of these yeasts is concerned, Malassezia species have

been only isolated from mammals and some birds. Recent metagenomics studies showed that it was possible to detect the presence of Malassezia-similar genes in environmental DNA samples (e.g. nematodes, marine sponges, coral colonies, marine dinoflagellates). However, the presence of Malassezia cells have been not reported in these environmental studies. Consequently, the real

identity of these yeasts detected by culture-independent techniques in these environmental habitats still remain unknown.

14.30-14.45 Malassezia in the environment

A. Amend1, T.L. Dawson2, T. Boekhout3 1University of Hawaii Manoa, HONOLULU, USA 2Agency for Science, Technology and Research, Skin Research Institute Singapore, SINGAPORE, Singapore 3Westerdijk Fungal Biodiversity Institute, UTRECHT, Nederland Objectives: Until recently, yeasts of the basidiomycetous genus Malassezia were known mainly from skin of warm-blooded animals, including humans. In the laboratory they could be maintained on lipid supplemented media and when grown at temperatures of ca. 30°C. Recent DNA barcoding, however, detected the occurrence of these yeasts in unexpected habitats. Further they point to a large diversity of putatively undescribed species. Methods: Here we present an overview of results from various metabarcoding and metagenomics studies on the occurrence of Malassezia in various environmental habitats.

Results: Presumed Malassezia DNA was detected in a wide diversity of habitats, including terrestrial, marine, and indoor environments. Moreover, it dominated the mycobiomes of animals like sponges, corals, nematodes, snails, and insects. Sequenced transcripts and ribosomal RNA indicate that Malassezia is actively functioning in at least some of these environments. Using ITS as a marker several novel phylogenetic lineages are found indicating that the existing number of species may be higher than presently know. Future studies may focus on addressing the functional role of the yeasts in such habitats, as well as in situ detection by e.g. FISH.

3

Conclusion: The diversity of Malassezia yeasts largely extends what is known from previous clinical studies. Combining environmental microbial community data from metagenomics studies with those obtained by functional genomics, and culturing and imaging Malassezia directly from these environments will provide insight in the environmental reservoir of Malassezia yeasts as well as their ecophysiology that also may contribute to our understanding of the human/animal host interactions.

14.45-15.00 Identification of Malassezia species in seborrheic dermatitis and fungal

microbiota in androgenetic alopecia Y.P. Ran1, H. Zhang2, J.H. Huang2, X. Ran1 1West China Hospital, CHENGDU, China Objectives: Seborrheic dermatitis (SD) is a sub-acute or chronic superficial inflammatory skin condition, characterized by pruritic, erythematous plaques with greasy, yellow-gray scales,scales, which appear on areas rich in sebaceous glands such as the face, scalp, upper chest, and back. Androgenetic alopecia (AGA) is the most common cause of hair loss and affects up to 70% of men and 40% of women. Although genetic and environmental factors play a role, the causes of SD and AGA are complex and incompletely understood and the pathogenesis remains unclear. We explored Malassezia spp. composition in SD skin and fungal microbiota in AGA by non-culture based molecular identification. Methods: We analyzed Malassezia microflora in SD patients by applying a transparent dressing to the lesional skin and using direct detection of fungal DNA using nested PCR. We collected samples from the lesional skin of 146 SD patients in China and extracted fungal DNA directly from the lesional samples without culture. Specific primers for each Malassezia species were designed to

amplify existing yeasts in each sample. Some samples were randomly selected to culture and identified by morphological and physiologic criteria. We focused on fungal microbiota of AGA: (1) pulling out the loose hair from the calvaria region (vulnerable to baldness) and occipital region (non-baldness) of AGA patients, to observe the fungus with microscope, SEM and TEM; (2) high-throughput sequencing and fluorescence quantification real-time PCR (QRT-PCR) combining the specific primers and probe of the Malassezia species to analyze the fungal micro-ecology. Results: M. globosa and M. restricta were found in 87.0 and 81.5 % of SD patients, respectively, which together accounted for more than 50 % of Malassezia spp. recovered in these Chinese patients. The majority of SD patients (82.9 %) showed co-colonization of two or more Malassezia species. The positive rate of Malassezia in 10 AGA patients (60%) was higher than 10 control (40%). SEM observed many Malassezia yeasts adhering and inserted to the surface of hair root, TEM proved the yeasts invaded into the fair follicle dermal root sheath. High-throughput sequencing the hair roots from AGA revealed Basidiomycota (61.03%), Ascomycota (35.58%), Zygomycota (0.40%) in calvaria region, and Basidiomycota (54.21%), Ascomycota (41.18%), Zygomycota (1.87%) in occipital region. In the control group, Basidiomycota (24.94%), Ascomycota (73.16%), Zygomycota (0.49%) revealed in calvaria region, and Basidiomycota (34.37%), Ascomycota (63.78%), Zygomycota (0.62%) in occipital region. The scalp scales by OpSiteTM sterile transparent sticking were detected with QRT-PCR. In AGA group, the constitute of M. globose (37%) and M. restricta (53%) in calvaria is significantly higher than in occipital region of M. globose (22%) and M. restricta (31%). In the control group no statistical difference existed. Conclusion: Our results indicated M. globosa and M. restricta predominated in Malassezia colonization in Chinese SD patients. Non-culture-based methods may more accurately reflect Malassezia microflora constitution. The pathogenicity of Malassezia to AGA is worth further investigation.

15.00-15.15 Socio-demographic characteristics and spectrum of Malassezia species in

seborrhoeic dermatitis in urban and rural population of India S.M. Rudramurthy1, P. Honnavar2, A. Chakrabarti2, S. Dogra2, S. Handa2, P.V. M Lakshmi2 1Postgraduate institute of medical Education and Research, Chandigarh, CHANDIGARH, India

4

2PGIMER, CHANDIGARH, India Objectives: Seborrheic dermatitis/dandruff (SD/D) is a common, persistent, relapsing inflammatory condition affecting the areas rich in sebaceous glands. Though cases of SD/D are widely prevalent in India, Malassezia species implicated are not well studied. The aim of our study was to estimate the prevalence and spectrum of Malassezia species in patients with SD/D in north India. Methods: Two hundred SD/D patients and 100 healthy controls from both rural and urban background of north India were enrolled. SD/D severity was clinically graded as mild, moderate, severe and very severe. The isolates were identified by phenotypic characters and confirmed by ITS2 PCR-RFLP band pattern and sequencing of ITS region of rDNA. Results: Severe (59%) and very severe (71%) form of SD/D was higher in the rural population compared to urban population (p=0.004). Isolation rate of Malassezia was significantly higher in overall SD/D patients scalp (82%) compared to healthy controls (67%) (p=0.005). From the scalp of SD/D patients predominately M. globosa (36.2%) was isolated followed by M. restricta (31.3%), M. furfur (15.7%), mixture of M. globosa and M. restricta (12%) and M. arunalokei (4.8%), similarly, M. globosa (49.3%) was predominately isolated from the scalp of healthy controls followed by M. restricta (22.4%), M. furfur (14.9%), mixture of M. globosa and M. restricta (10.4%) and M. arunalokei (3%). No significant difference was observed in the isolation of M. globosa from scalp of SD/D patients compared to that of HC and/or nasolabial fold of SD/D patients and healthy control, whereas M. restricta was significantly higher in scalp of SD/D patients compared to healthy control and/or nasolabial fold of both SD/D patients and healthy control (p=0.0001). Conclusion: In comparison to our present study, isolation of M .restricta was either very less or nil in the

previous epidemiological studies. As per our knowledge, this is the largest epidemiological study for Malassezia species in patients with SD/D.Our findings indicate that M. restricta plays a major role in the causation of SD/D. Newly identified species, M. arunalokei was isolated only from rural subjects.

15.15-15.30 Tea 15.30.16.00 Keynote

The human skin mycobiome in health and disease Thomas L. Dawson, Jr1 and Teun Boekhout2 1Agency for Science, Technology and Research, Skin Research Institute Singapore, and Department of Drug Discovery, School of Pharmacy, Medical University of North Carolina, Charleston, USA 2Westerdijk Fungal Biodiversity Centre, Uppsalalaan, UTRECHT, and Institute of Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands

Objectives: The human bacterial microbiome has achieved virtual celebrity status, but the human mycobiome remains elusive and poorly investigated. Early skin mycobiome studies leveraged the ITS region via terminal fragment length polymorphism (tFLP) and indicated a dominance of Malassezia

species on human scalp skin. Recent metagenomic studies confirm the overall skin dominance of Malassezia. Significant further in vitro, in vivo, and clinical data support a causal role in seborrheic dermatitis, via M. globosa lipase-mediated release of unsaturated sebaceous free fatty acids, and a role in exacerbation of many other common skin disorders including pityriasis versicolor, atopic dermatitis, atopic eczema, and psoriasis. However, it remains unclear what role (if any) the mycobiome would play in maintenance of skin health. Methods: A key next step to define interventional strategies will be development of functional skin microbiome models, including biochemical microbe/host and microbe/microbe signaling and global community function via metagenome reconstruction and metatranscriptomics. Results:

5

Intra-subject variability coupled with data supporting temporal inter-individual stability highlight the need for future investigations to be longitudinal or interventional. Parallel group experiments are able to define potential areas of interest and support identification of correlations, but measurement of inter-subject changes during significant changes in skin physiology or via organism or pathway specific interventions will allow hypothesis development and testing. Conclusion: An Asian Skin Microbiome Program has been initiated in Singapore to pair with the Singaporean Healthy Living in Singapore (HELIOS) cohort to collect extensive phenotypic measurements together with overall health assessments, complete human genomes, skin physiology, biochemical measures, and the skin microbiome, to enable investigation of the complex interrelationships between environmental, lifestyle and genetic factors on disease risk. Coupling the microbial community analyses with functional metabolic data, longitudinal and interventional studies should allow development of biochemical models of skin health and disease and promote design of positive interventions.

16.00-16.15 Malassezia in the human gut: friend or foe or artefact? M.L Richard INRA Micalis, JOUY EN JOSAS, France Objectives: The bacterial intestinal microbiota plays major role in human physiology and inflammatory bowel diseases (IBDs). Although some data suggest a role of the fungal microbiota in IBD pathogenesis, the available data are scarce. The aim of our study was to characterize the fecal fungal microbiota in patients with IBD. Methods: Bacterial and fungal composition of the fecal microbiota of 235 patients with IBD and 38 healthy subjects (HS) was determined using 16S and ITS2 sequencing, respectively. Results: We observed that fungal microbiota is skewed in IBD, with an increased Basidiomycota/Ascomycota ratio, a decreased proportion of Saccharomyces cerevisiae and an increased proportion of Candida albicans compared with HS. Additionally, Malassezia sp., a usual

inhabitant of the skin, was identified in many samples and its repartition seemed modified depending on the disease status. We also identified disease specific alterations in diversity, indicating that a Crohn’s disease-specific gut environment may favor fungi at the expense of bacteria. The concomitant analysis of bacterial and fungal microbiota showed a dense and homogenous correlation network in HS but a dramatically unbalanced network in IBD, suggesting the existence of disease-specific inter-kingdom alterations. Again, Malassezia sp. was identified as central for fungi-bacteria interactions in ulcerative colitis in particular. Conclusion: In conclusion, besides bacterial dysbiosis, our study identifies a distinct fungal microbiota dysbiosis in IBD characterized by alterations in biodiversity and composition. Moreover, the identification of Malassezia in the gut, prompt many question on its actual colonization of the gut, and its role in the gut physiology in health and disease.

16.15-16.30 Hybridization in the Malassezia furfur complex.

B. Theelen1, S. Denil2, T. Dawson Jr.2, T. Boekhout1 1Westerdijk Fungal Biodiversity Institute, UTRECHT, Nederland 2Institute of Medical Biology, A-star, SINGAPORE, Singapore Objectives: The current Malassezia furfur species contains high genetic diversity, based on Random Amplification of Polymorphic DNA (RAPD), Pulsed Field Gel Electrophoresis (PFGE), and Amplified Fragment Length Polymorphism (AFLP). Further exploration of this genetic diversity in a large number of M. furfur strains from various backgrounds showed indications of a potential hybridization event. Here we further explore this phenomenon and attempt to explain the relevance. Methods: M. furfur strains representing the putative hybrid and both putative parental genotypes were characterized with full genome sequencing (Illumia, PacBio, and Nanopore), AFLP, PFGE, Multi Locus Sequence Typing (MLST), Matrix Assisted Laser Desorption/Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF-MS), mating type PCR, mitochondrial PCR/sequencing, and cell size.

6

The putative hybrid genome sequences were assembled using the Redundans pipeline for heterozygous/polymorphic genomes, and scaffolds containing high variant percentages were phased into their putative parental copies. The parental origin of the phased hybrid scaffolds was explored with Basic Local Alignment Search Tool (BLAST). RNAseq data was used to train genome annotation using Funannotate for the hybrid and suspected parental genomes to compare gene content and function. Results: These new findings support and refine our original hypothesis of a hybridization event in the M. furfur species complex. Sanger MLST for the suspected hybrid strains indicated presence of both parental alleles. Genome sequencing confirmed the MLST, but interestingly revealed instances of loss or duplication of specific parental regions, resulting in aneuploidy. Cells of the putative hybrid strain were significantly longer than the parental strains. One of the hybrid-derived phased parental genotypes showed high divergence from other sub-clusters in the species complex and phylogenetic analysis based on multiple genes, indicates that this is likely a new species. Conclusion: Multiple data sets support that a hybridization event occurred in the Malassezia furfur complex and that one of the parental strains in fact is a previously undescribed species. One of the parental strain clusters has a predominantly mammalian skin host background and the other is from a mixture of isolates from surficial and deep-seated host backgrounds. The hybrid strains are all but one from animal hosts, suggesting the hybridization event is potentially host-shift related. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_1_453789_b8dd4d30-

b1cc-41f4-aace-7e3b52cf79a4.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_453789_b8dd4d30-

b1cc-41f4-aace-7e3b52cf79a4.png 16.30-16.45 Comprehensive Analysis of the microbiome of keratotic plugs, and

interactions between Malassezia and Propionibacterium (Cutibacterium) acnes T. Sugita, M. Unno, O. Cho Meiji Pharmaceutical University, TOKYO, Japan Objectives: Many microorganisms are found in keratotic plugs. Propionibacterium (Cutibacterium) acnes is one of the major bacteria microbiome; acne vulgaris develops when the microorganism grows abnormally. Here, we studied the relationship between the microbiome of keratotic plugs and acne-associated inflammation. Comprehensive analysis of the microbiome. A total of 101 keratotic plugs were obtained from 10 otherwise healthy subjects, and all microbiomes were analyzed using the Illumina MiSeq method. Malassezia restricta and P. acnes were the predominant fungal and bacterial microbiomes,

respectively. Interactions between M. restricta and P. acnes growing in normal human epidermal keratinocytes (NHEK)Various concentrations of M. restricta and P. acnes were co-cultured in NHEK, and the cytokine concentrations of culture supernatants measured by ELISA. The levels of the inflammatory cytokines IL-6, IL1-α, and IL-8 increased synergistically when the microorganisms were co-cultured, suggesting that inflammation reflects the extent of infection by both microorganisms.

16.45-17.00 Next-generation sequencing provides new insights regarding Malassezia in

canine allergic dermatitis where population-level differences are associated with disease C. Meason-Smith1, S. Lawhon1, T. Olivry2, A. Rodrigues Hoffmann1 1Texas A&M University, COLLEGE STATION, USA 2North Carolina State University, RALEIGH, USA Objectives: DNA sequencing technologies have revolutionized the study of skin commensals, how they contribute to health, and their role in disease. Recently, next-generation sequencing (NGS) has been applied to estimate the relative abundance of microorganisms on animal skin. The purpose of this study is to quantify absolute abundances of Malassezia spp. on canine skin using real-time quantitative PCR (qPCR), classify skin-associated Malassezia to the species level with

7

phylogenetic analysis of NGS data, and re-assess the role of Malassezia in canine allergic dermatitis. Methods: To quantify Malassezia from skin swabs, two qPCRs for Malassezia spp. and M. pachydermatis were performed on 192 samples taken from 25 dogs, comprising two previously published NGS studies. Malassezia sequences were speciated by aligning sequences to a published Malassezia database with the open-source bioinformatics software Pplacer. Results: Previous NGS studies found that Malassezia comprised only 6% of fungal sequences from healthy and non-lesional allergic canine skin, whereas the current study identified Malassezia as 97% of fungal sequences from experimentally induced atopic canine skin. Quantitative PCR confirmed that M. pachydermatis was significantly higher on swabs taken from the laboratory colony of dogs compared to client owned healthy and allergic dogs. Quantitative PCR and NGS results did not always correlate. M. pachydermatis abundance was not significantly different between healthy and non-lesional allergic skin using qPCR, although M. pachydermatis was increased on allergic skin at the axilla, ear, groin and nostril (non-significant). Phylogenetic analysis of 37,000 NGS Malassezia sequences from healthy and non-lesional allergic dogs showed M. restricta was more abundant on healthy skin (P<0.05), while M. pachydermatis was more abundant on non-lesional allergic skin (P<0.05). Conclusion: Molecular methodologies are proving to be useful in the study of skin commensals, and may indicate that M. restricta acts as a commensal on healthy skin, while the pathogenic M. pachydermatis dominates the skin of non-lesional allergic dogs. We suspect the genotype of a

laboratory colony of experimentally induced atopic dogs predisposes them to increased abundances of skin-associated Malassezia. Comparison of quantitative and relative abundance methods are not always consistent and should be considered in the choice of methods for future studies. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_1_422127_4e80aa4c-

805c-4d72-b767-e86e540c29fb.png Thursday morning, July 5 Theme Clinical, Therapy and Diagnostics 9.30-9.50 World Association for Veterinary Dermatology Clinical Consensus

Guidelines for Malassezia dermatitis in dogs and cats. R. Bond Royal Veterinary College, NORTH MYMMS, HATFIELD, United Kingdom Objectives: In 2013 the World Association for Veterinary Dermatology (WAVD) decided to facilitate the development of Clinical Consensus Guidelines (CCG) for commonly encountered skin diseases; these CCG are intended to be primarily evidence-based but expert opinion is utilised where a body of evidence is lacking. In 2017 WAVD commissioned the development of CCG on Malassezia dermatitis in dogs and cats in order to provide the veterinary community and other interested parties with current information on the pathophysiology, diagnosis, treatment and prevention of skin diseases associated with these yeasts. Methods: During 2017, Professor Ross Bond (Royal Veterinary College, UK) formed an expert panel comprising a group of specialist practitioners, academic veterinary dermatologists and mycologists. The participants were Dr Emmanuel Bensignor (Clinique Vétérinaire, France), Prof Jacques Guillot (École Nationale Vétérinaire d’Alfort, France), Professor Peter Hill (University of Adelaide, Australia), Dr Rui Kano (Nihon University, Japan), Professor Ken Mason (Dermcare Vet, Australia) Professor Dan Morris (University of Pennsylvania, USA) and Dr David Robson (Melbourne Veterinary Specialist Centre, Australia). Lead authors were appointed to prepare literature reviews on each of the relevant topics that were then circulated to all other members of the panel for development of consensus summaries. Draft CCG are listed for presentation at the 2018 annual meetings of the North American Veterinary Dermatology Forum (May 2018) and the European

8

Society / College of Veterinary Dermatology (September 2018), and posted on the WAVD website (www.wavd.org) to solicit input from individuals and affiliated organisations. Further comment from ISHAM members is encouraged and welcomed. Once all received comments are reviewed, it is intended that the finalised CCG will be submitted for publication in late 2018. Results: The draft CCG contains sections on historical aspects, ecology and epidemiology, yeast virulence factors, immunological responses, predisposing host factors, clinical signs, diagnostic testing (microscopy, culture, molecular, histopathology), antifungal resistance, topical and systemic therapy, prevention and zoonotic potential. Conclusion: There has been a remarkable expansion of knowledge on Malassezia yeasts and their role in

animal disease, particularly since the early 1990’s. Malassezia dermatitis in dogs and cats has evolved from a disease of obscurity and controversy on its existence, to now being a routine diagnosis in general veterinary practice. Clinical signs are well-recognised, and diagnostic approaches are well-developed. A range of topical and systemic therapies is known to be effective. CCG enable both busy practitioners and specialists to access critical reviews of the current scientific literature to help inform their clinical practice, and highlight areas for further research and development.

9.50-10.05 Mycosyph, the greatest imitator

M. Laurence Shipshaw Labs, MONTREAL, Canada Objectives: Sexual risk factors and genes controlling immunity against fungi have been linked to prostate disease (prostate cancer and benign prostatic hyperplasia), multiple sclerosis and spondyloarthritis (seronegative arthritis, psoriasis and Crohn’s disease). A consistent framework explaining these links is missing. Methods: Literature review of prostate disease, multiple sclerosis, and spondyloarthritis with data extraction on sexual and fungal risk factors. Results: Prostate cancer, multiple sclerosis and spondyloarthritis have unambiguous sexual risk factors,

especially a moderate association with seropositivity to various sexually transmitted infections (STIs). Multiple sclerosis and spondyloarthritis are rare in children. The distribution of these diseases’ age at onset matches STIs. Less reliable sexual risk factors include age at first intercourse, number of sexual partners, smoking, and cervical cancer lesions. Prostate disease, multiple sclerosis and spondyloarthritis have unambiguous links with fungi.

Low prostatic expression of the fungicidal protein PSP94 increases prostate cancer risk in a dose dependant manner. A non-functional isoform of PSP94 is a reliable biomarker of benign prostatic hyperplasia. PSP94 perforates plasma membranes containing ergosterol. The gene conferring the

greatest multiple sclerosis risk (HLA-DRB1*1501) causes immune hypersensitivity to fungi. Antibodies against fungi are strongly associated with multiple sclerosis and spondyloarthritis. Enteric Candida colonization is a risk factor for psoriasis. Oral fungicides nystatin and dimethyl

fumarate improve multiple sclerosis and psoriasis symptoms. CD4+ T cell recognition of fungal antigens is associated with spondyloarthritis. Functional polymorphisms in IL23R and CARD9 genes (critical for immunity against fungi) are risk factors of spondyloarthritis. ERAP proteins trim peptides held by MHC class I molecules. ERAP alleles’ association with multiple sclerosis and spondyloarthritis, and PSP94’s lack of activity in extracellular fluids both indicate the causative infection is intracellular. Associations with obesity suggest it may be lipophilic. High monozygotic twin concordance in spondyloarthritis (>60%) and high lifetime risk of prostate disease (>80%) indicate it is ubiquitous. Of known medically important microbes, only Malassezia have the above properties. Specific recognition of Malassezia antigens by CD4+ T cells in psoriasis suggests the causative species may be part of this genus. The strong association (odds ratio of 25) between granulomatous Crohn’s disease and Malassezia within gut lesions of teenagers supports this. If these results are correct, then the genus Malassezia likely contains one or more sexually acquired species

present in nearly all adult animals’ internal organs. Conclusion: Many observational and clinical studies support a sexually acquired fungal etiology in prostate disease, multiple sclerosis and spondyloarthritis. This infection appears to be necessary in

9

producing a variety of seemingly unrelated symptoms currently considered autoimmune. These symptoms are similar to those produced by the first great imitator, the sexually acquired bacterium Treponema pallidum (syphilis). “Mycosyph” is thus proposed as an umbrella term encompassing

these symptoms. Susceptibility to develop disease is mainly genetically determined: symptoms seem to occur only in a small minority of infected individuals whose immune system recognizes the fungus in specific organs. For example HLA-DRB1*1501 would enable B cells to detect this fungus in the brain, and HLA-B*27 would enable CD8+ T cells to detect this fungus in the spine. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_1_433035_323f9622-

a0a2-441f-913b-648ab90463b1.jpg Caption 1: Low PSP94 concentration increases prostate cancer risk

10.05-10.20 Malassezia-related infections: A call for specific guidelines for diagnosis

and patient management C. Cafarchia1, T. Boekhout2 1Università degli Studi di Bari Aldo Moro, BARI, Italy 2Westerdijk Fungal Biodiversity Centre, Uppsalalaan, UTRECHT, Netherlands Objectives: Malassezia spp. are lipid dependent yeasts, inhabiting the skin and mucosa of humans and animals. They are involved in a variety of skin disorders in humans and animals and cause bloodstream infections in severe immunocompromised patients. The knowledge on these yeasts has increased tremendously during the last two decades and in this presentation, the latest findings on clinical importance of Malassezia-related infections are reviewed. Methods: The most recent literature on Malassezia infections both in humans and animals, their occurrence, diagnostic methods, in vitro susceptibility testing and therapeutic approaches were summarized and discussed. Results: Out of 17 lipophilic species recently assigned to the Malasseziomycetes class, Malassezia sympodialis, Malassezia globosa and Malassezia restricta are considered the main agents of dermatological disorders in immunocompetent patients while Malassezia pachydermatis cause dermatitis or otitis in pets. Malassezia furfur, Malassezia pachydermatis and Malassezia sympodialis cause systemic infections in immunocompromised hosts, especially neonates. Since multiple Malassezia species and/or genotypes with varying antifungal profile may cause unique or similar pathologies, serious concern about the diagnostic procedures and antifungal treatment has been raised. Isolation and enumeration of Malassezia cells from clinical specimens remains a challenge because of their lipid dependency. In addition, since the clinical features, laboratory markers, and strategies for patient management do not differ between Candida and Malassezia fungemia, a more accurate etiological diagnosis is needed in high-risk patients by employing lipid-supplemented culture media in the current mycological routine. As for the treatment of these infections, topical antifungal agents (mainly azoles) are adequate for the management of localized skin lesions, while systemic itraconazole or fluconazole is needed for invasive skin diseases. For catheter-related Malassezia, catheter removal, discontinuation of the lipid infusion and administration of antifungal drugs such as amphotericin B, fluconazole and voriconazolo, are recommended. Despite the attempt to treat these fungal infections, a trend toward recurrence is often observed in humans and animals with dermatitis. Moreover, the induction of in vitro fluconazole resistance in M. pachydermatis as well as the clinical evidence of treatment failure with terbinafine in patients with pytiriasis versicolor or with fluconazole or posaconazole in preventing M. furfur fungemia in humans suggest the occurrence of drug resistance phenomena in these species. Thus far, in vitro susceptibility testing for Malassezia spp. has not yet been standardized, thus resulting in lack of clinical breakpoints. Although the variable azoles susceptibility of Malassezia depends on the different test conditions (e.g., culture medium, inoculum size and end-point determination), the low activity of fluconazole, voriconazole and echinocandins against Malassezia spp. seems to be a common finding regardless of the in vitro protocol employed. Conclusion: The scanty literature showing the occurrence of Malassezia infections mainly in hospitalized patients, the low specificity and sensitivity of different blood culture systems used to diagnose Malassezia related sepsis, the lack of standardized methods for in vitro antifungal susceptibility

testing as well as the lack of study confirming the drug resistance phenomena in these yeasts

10

species call for further studies aiming to realize guidelines on the diagnosis and management of Malassezia related diseases.

10.20-10.40 What do dermatologists use and what is needed to initiate therapy and

assess efficacy in Malassezia related skin diseases? D.M.L. Saunte1, R.J. Hay2 1Zealand University Hospital, ROSKILDE, Denmark 2Kings College, LONDON, United Kingdom Objectives: This study was initiated on behalf of European Dermatology and Venereology TASK force to focus on the current usage of mycological diagnostics by dermatologists about both the optimal tests and what they actually use in their daily current practice. It also investigates if it is necessary to differentiate between initial diagnostic tests and treatment follow-up. This presentation focus on the Malassezia related questions. Methods: An online questionnaire was distributed among 62 members of the EADV mycology Task Force and other dermatologists with a special interest in mycology. Results: A total of 38 completed the survey. Non-responders were mainly histopathologists or specialised in general nail disorders and were therefore not able to answer questions about Malassezia. When

pityriasis versicolor is suspected the clinical picture was rated as the main criterion for diagnosis, but for confirmation direct microscopy was the main diagnostic tool and the same was true for the evaluation of treatment response In patients where Malassezia folliculitis is suspected the majority of dermatologist wanted direct

microscopy of the specimen before initiation of treatment, but for treatment assessment the clinical response was the main evaluation. Conclusion: Identification to genus or species level is not important for dermatologist when Malassezia related

diseases are suspected. Direct microscopy was thought to be sufficient for fungal identification. Direct microscopy is regarded as a point of care test and training in direct microscopy is considered a requirement for dermatologists.

10.40-11.00 Coffee 11.00-11.15 A rapid molecular assay for direct quantification of Malassezia

pachydermatis in otic swabs G. Castellá, L. Puig, F.J. Cabañes Universitat Autònoma de Barcelona, BELLATERRA, Spain Objectives: The objectives of the present work were to develop a real time PCR assay (qPCR) based on SYBR Green for detection and quantification of M. pachydermatis yeasts and validate the assay with swabs obtained from the external ear canal of healthy dogs and dogs with otitis. Methods: The qPCR was developed following the defined criteria of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines A primer pair specific for M. pachydermatis was designed by comparison of β-tubulin gene sequences of Malassezia species. Fifteen M. pachydermatis strains were tested in order to ensure amplification of all genotypes. Also, strains from different Malassezia species were tested to assess the specificity of the qPCR. To validate the assay, swabs from the external ear canal of healthy dogs and dogs with otitis were analysed by qPCR. The presence and amount of M. pachydermatis yeasts of external ear canal

swabs were also assessed by plate counting and cytological examination. Results: The primers developed amplified a 61 bp amplicon with no similarity to the dog genome. A BLAST search showed no significant similarity to other commensal and pathogenic bacteria or fungi that can be found on the ear canal of dog. The primers consistently amplified the DNA from all tested M. pachydermatis strains. Melting curve analyses yielded a single peak in all M. pachydermatis strains

11

at 79.3-80.4ºC of melting temperature depending on the genotype. The standard curve yielded r2 values superior to 0.990 in all runs, and slope values of approximately -3.40. The limit of quantification was established in 0.18 ng/reaction, equivalent to 1.8·104 genome equivalents (gEq). Swabs from dogs without otitis yielded no growth of M. pachydermatis or plate counts ranging from 1 to 8 CFU/plate and negative cytological examination in most of the samples. In swabs from dogs with otitis, 1-5 M. pachydermatis cells/field were observed in the cytological examination while ≥10 CFU/plate were obtained in culture. Swabs from healthy dogs yielded quantification values of ≤2.0·104 gEq in the qPCR while quantification values of ≥2.2·105 gEq were obtained in swabs from dogs with otitis. Conclusion: We developed for the first time a qPCR assay that provides accurate quantification of M. pachydermatis yeasts from swab samples from dogs. With the described method, in a few hours it is possible to achieve accurate quantification of M. pachydermatis. The application of the developed method on clinical cases could improve the diagnosis of otitis by M. pachydermatis on dogs, and consequently lead to a more accurate treatment that would enhance the prognosis of the affected animals.

11.15-11.30 Molecular identification and speciation of Malassezia and its susceptibility

pattern P.N Romald, A.J Kindo, M.L Verraragavan Sri Ramachandra Medical College and Research Institute, CHENNAI, India

Objectives: The objectives of this study are: Epidemiology - To know the age, sex and site of prevalence of Malassezia infection. Anti-fungal susceptibility -To identify the most effective anti-fungal drugs to treat infections caused by Malassezia and to obtain their MIC (minimum inhibitory concentration) values. Molecular study -To do DNA extraction, Polymerase chain reaction (PCR) and sequence the extracted genome, thereby identifying and speciation of Malassezia. Methods: Malassezia species were isolated from the skin scrapping’s of the patients with hypo/hyper pigmented lesions in the Dermatology OPD of our tertiary care hospital/medical centre for a period of two years from July 2016 to Feb 2018.Microscopic Examination of 10% KOH treated scrapping’s were done. KOH positive samples were cultured on Modified Dixons agar (MDA) and Sabouraud’s Dextrose Agar (SDA) with olive oil overlay and incubated at 32oC.Gram stain, Catalase and Urease test was performed. Stock cultures were made and refrigerated. Epidemiology - Among the samples obtained in our tertiary care hospital for a period of two years,

the commonest age of Malassezia infection ,the sex in which the infection predominates and the site of maximum predilection were analysed. Anti-fungal susceptibility- was done by broth Micro- dilution method in accordance with CLSI

M27-A3 guidelines. Since Malassezia’s are lipid dependant yeast, RPMI 1640 was added with glucose, peptone, ox bile, malt extract, glycerol, Tween 40, Tween 80 and chloramphenicol. Stock inoculum was prepared. Anti-fungal stock solutions of drugs were prepared and stored at - 700C. Micro titre plates with 96 wells were incubated for 4 days at 32oC. Growth and sterility control wells were included in each test. MIC values to anti-fungal drugs - Fluconazole, Ketoconazole, Miconazole, Clotrimazole and Terbinafine were obtained as MIC 50 and MIC90 (where 50% and 90% inhibition of growth was seen). Molecular study-DNA was extracted from culture and stored at -20O C until used as a template for

amplification.DNA was amplified using ITS-1 and ITS-4 primer and Malassezia specific primer ITSIF-N (GGATCATTAGTGATTGCCTTTATA) and ITS4-R (TCCTCCGCTTATTGATATG).Sanger’s sequencing and NCBI blast was done. Results: Of the 88 samples collected 78 showed meat ball and spaghetti appearance on microscopic examination (85%); 65 samples grew on MDA. Some samples even grew more than one species of Malassezia; 50 samples grew on SDA with olive oil overlay; 1 sample grew on SDA without olive oil. Growth on Modified Dixons agar was faster than SDA with Olive Oil overlay. Gram stain performed showed-spherical/oval/sympodial buddings. All samples were catalase and Oxidase positive. Predominant age group- 10-20yrs and 20-30 yrs. Sex predominance is almost equal with little male predominance. Commonest site -Scalp, Neck and Shoulder, Hip and inner thigh RPMI1640 with added supplements were standardised The AFST reports are awaited Molecular Methods were standardised and DNA Extracted and stored for Amplification. Waiting for Sequence Reports, Blasting and Speciation.

12

Conclusion: Speciation and anti-fungal susceptibility testing of Malassezia will help the clinician to choose the most appropriate drug to treat Malassezia infections and have good patient compliance Picture 1: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_1_422097_daf23ee3-60bc-4470-8d43-c8bb97b4b228.jpg Caption 1: Epidemiological result,culture and microscopy Picture 2: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_422097_daf23ee3-60bc-4470-8d43-c8bb97b4b228.jpg Caption 2: Standardization of Molecular study

11.30-11.45 Understanding the mechanism of action of the anti-dandruff agent zinc

pyrithione against Malassezia restricta M. Park1, Y. Cho2, Y.W. Lee3, W.H. Jung1 1Chung-Ang University, ANSEONG, South Korea 2Korea Polar Research Institute, INCHEON, South Korea 3Konkuk University, SEOUL, South Korea Objectives: Dandruff is known to be associated with Malassezia restricta, which is the most frequently isolated fungus from human skin. To treat the disease, zinc pyrithione (ZPT) has been used as an anti-dandruff ingredient in various anti-dandruff shampoos. There have been several studies that have investigated the mechanism of ZPT; however, they mainly used a non-pathogenic model yeast Saccharomyces cerevisiae and a different Malassezia species M. globosa whose contribution to dandruff is known to be minimal. The aim of the current study was to understand how ZPT inhibits the growth of M. restricta. Methods: We analyzed the intracellular metal contents of ZPT-treated M. restricta cells. The transcriptome profile of the ZPT-treated cells was also compared with that of untreated cells. The transcriptome changes caused by the ZPT treatment were confirmed by expression analysis of the proteins and by assessing the enzymatic activities. Results: Our data show that the ZPT treatment dramatically increased the intracellular zinc levels along with a small increase of the intracellular copper content in M. restricta. This result was different from what was shown in the study using S. cerevisiae. However, similar to what was found in a previous study, our transcriptome analysis showed that ZPT inhibits Fe-S cluster synthesis in M. restricta. Apart from the above findings, we observed that ZPT treatment causes a significant reduction in the expression of lipases whose activities are believed to contribute to the survival and virulence of M. restricta on human skin. Conclusion: Overall, the results of our study suggest that at least three inhibitory mechanisms may be associated with the action of ZPT against M. restricta: i) an increase in the intracellular zinc levels, ii) the inhibition of the Fe-S cluster synthesis, and iii) a decrease in lipase expression

11.45-12.00 Epidemiological cutoff values for four clinical antifungal drugs against

Malassezia furfur. Preliminary estimated data F.R. Rojas, M.A. Sosa, J.E. Mussin, W. Latorre, L. Alegre, G.E. Giusiano Instituto de Medicina Regional, RESISTENCIA, Argentina Rojas Objectives: To estimate epidemiological cutoff values (ECVs) of fluconazole (FZ), voriconazole (VZ), itraconazole (IZ) and amphotericin B (AB) for Malassezia furfur isolates. Methods: Minimal inhibitory concentration (MIC) of FZ, VZ and AB against 63 M. furfur clinical isolates was

determined according to CLSI M27”A3 reference document, with some modifications for support optimal growth of these lipo-dependent yeasts. ECVs were calculated using ECOFFinder MS Excel spreadsheet calculator considering the modal MIC, the MIC distribution, the assumption that the wild type (WT) population should cover three to five 2-fold dilutions around the modal MIC and that the ECV should include at least 95% of WT organisms. Strains with MICs ≤ ECVs were classified as WT strains, and those with MICs > ECVs were classified as non-WT strains. Results:

13

All MIC distributions covered three to five 2-fold dilution steps surrounding the modal MIC. Table 1 shows the ECVs for FZ, VZ, IZ and AB against 63 M. furfur isolates. Conclusion: The role of the ECV is to distinguish WT from non-WT isolates. Non-WT isolates harbor intrinsic or acquired resistance mechanisms, which most often correlate with high MIC above the ECV, for the species/agent corresponding. These values do not categorize a fungal isolate as susceptible or resistant as breakpoints do, that is because do not take into account antifungal agent pharmacology and clinical studies. These cut off values may, with due caution, aid physicians in managing mycosis by species where breakpoints are not available, as in the case of Malassezia genus. Certain conditions had not been fulfilled when this statistical analysis was applied in the estimation of M. furfur ECVs, such as the number of strains studied and number of contributing laboratories. The strict requirements and difficulties to growth and maintenance of Malassezia yeasts lead to a few susceptibility studies carried out, mainly using a microdilution method based on the CLSI methodology. Moreover, the few research groups studying Malassezia susceptibility do not used the same methodology, limiting comparison of the results and making difficult to perform collaborative studies. Anyway, this study presents the first approach to estimate ECVs for M. furfur. Malassezia furfur yeasts showed high ECVs for FZ and AB. These are first-line drugs for treatment of systemic infection by Malassezia species. These high values could indicate intrinsic resistance of this species or potentially harbor acquired resistance mechanisms. Molecular techniques would allow validating these ECVs estimated from phenotypic data. Use a standardized technique is the first requirement in order to optimize the susceptibility data collection of these fastidious yeasts; in addition, molecular studies on mechanisms of resistance need to be examined. Collaborative investigations are required that allow set up susceptibility cut-off values of these Malassezia yeasts. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_1_435681_35635284-

3934-47c9-9e81-be3bc19e120f.jpg 12.00-12.15 In vivo effectiveness of a saturated boric acid solution on Malassezia

pachydermatis canine external otitis M.P. García-Jiménez, A.M Calderón-Hernández, B. Vargas-Leitón, A.M Urbina-Villalobos National University of Costa Rica, HEREDIA, Costa Rica Objectives: The aim of this study was to evaluate the effectiveness of a saturated boric acid solution (SBAS) on the reduction of clinical signs and Malassezia pachydermatis population in dogs with confirmed external otitis (EO). Methods: A triple blind experiment under a Completely Randomized Design with Repeated Measures was performed, in a sample of 20 canines with EO perpetuated by M. pachydermatis. Cases were confirmed by clinical methods (at least one sign of otitis graduated as I, II or III) and laboratory methods (presence of ›10 yeasts / 40x / 5 random fields in the Gram stain and ›70 yeast CFU on the SDA culture). The external ear canals of all dogs were cleaned once a day during a week with the SBAS. A group of ten animals randomly received oral ketoconazole and the other group of dogs randomly received placebo. On day eight all dogs were examined for clinical signs and mycological tests were repeated. The data were analyzed by Analysis of Variance. Results: In both groups of treated dogs clinical signs disappeared and no side effects were evident. Significant reduction of ear wax (P‹0.001), number of yeasts in the Gram stain (P‹0.001) and number of CFU (P‹0.001) were demonstrated in both groups. There were no differences between the treatments on the ear wax (P=0.18) and on yeasts number in the Gram stain (P=0.32) but the reduction of yeast CFU in the group treated with the SBAS and oral placebo was higher than the group treated with oral ketoconazole (P‹0.01). Conclusion: This study confirms that the cleaning protocol using SBAS for seven days was effective to eliminate the clinical signs and reduce yeast population in dogs with EO perpetuated by M. pachydermatis. The easy application, low cost and the efficacy of the SBAS represent an alternative to ketoconazole for the treatment of EO perpetuated by this yeast.

14

12.15-12.30 A Taqman-based qPCR assay for the detection of Malassezia spp. from

clinical material A.A. Stavrou1, B. Theelen1, F. Hagen1, T. Dawson2, T. Boekhout1 1Westerdijk Institute, UTRECHT, Nederland 2Institute of Medical Biology A*STAR, SINGAPORE, Singapore

Objectives: Malassezia species are lipid-dependent human and animal skin commensal yeasts and responsible for a variety of pathologies in humans from minor skin disorders to life-threatening fungemia. Malassezia furfur and Malassezia pachydermatis are the most common species that have been

associated with blood infections in humans receiving parenteral nutrition, particularly neonates and immunocompromised or immunosuppressed individuals. Malassezia infections are underdiagnosed and the true prevalence unclear as the standard microbiology media do not contain lipids, which is essential for growth. Here we present a qPCR assay for the detection of Malassezia species

directly from blood samples. Methods:

A region of the ribosomal DNA including 18S, internal transcribed spacer 1, 5.8S, internal transcribed spacer 2 and partial 26S was assessed for the development of primers/probes. This region from 83 ascomycetous and basidiomycetous yeasts and fungi causing blood infection and close relatives including the 18 described species in the genus Malassezia were aligned using MAFFT. Upon inspection of the alignment an appropriate region was chosen and 5 different combinations of primers/probes were designed with Primer 3 plus. Preliminary testing showed only one of the combinations to be promising for further testing. Primer efficiency, sensitivity and specificity was tested using pure DNA from yeast cultures. In the future our main goal is to extend the experiments towards clinical diagnostics. Animal blood (sheep) will be spiked with different concentrations of Malassezia cells to reassess the assay in the presence of high background DNA. All the described Malassezia species will be tested with consideration for potential differences in the detection between haploids and hybrids and with focus on human bloodstream infections. Results: The qPCR efficiency and sensitivity was tested using the haploid M. furfur CBS 14141. Efficiency is

found to be 96.4% and within the proposed range of efficiency of 90%-110%. The assay detects all the Malassezia spp. associated with human blood infection, M. furfur, M. pachydermatis and M. sympodialis and up till now 7 more species out of the 11 tested overall. Specificity of the primers appears high as for non-Malassezia a weak positive signal is only generated at the last 5 cycles (late Cp call). Conclusion: The final aim is to validate this assay in the clinic. A fast, reliable tool for the detection of Malassezia spp. from blood will overcome the misdiagnosis of such infections and will significantly decrease the time of a correct diagnosis which is of crucial importance to the timely treatment of critically-ill patients.

12.30-14.00 Lunch and posters Thursday afternoon, July 5 Theme Host Microbe and Biochemistry 14.00-14.30 Keynote

Malassezia sympodialis - host/microbe interactions A. Scheynius Karolinska Institutet, STOCKHOLM, Sweden Objectives, methods, results: Malassezia is a dominant commensal fungi in the human skin mycobiome but is also associated with common skin disorders including atopic eczema (AE). More than 50 % of AE-patients have specific IgE and T-cell reactivity towards Malassezia sympodialis, which is one of the most frequently isolated species from both AE patients and healthy individuals (Saunders CW et al

15

2012). Through long-read DNA sequencing of M. sympodialis (ATCC 42132), we recently obtained a gap-free genome assembly comprising eight nuclear and one mitochondrial chromosome (Zhu Y et al 2017). Proteomics data could be readily integrated with transcriptomics data in standard

annotation tools. This increased the number of annotated protein-coding genes by 14% (from 3612 to 4113), compared to using transcriptomics evidence alone. Manual curation further increased the number of protein-coding genes by 9%. All of these genes have RNA-seq evidence and 87% were confirmed by proteomics. The M. sympodialis genome assembly and annotation is at a quality yet

achieved only for a few eukaryotic organisms, and constitutes an important reference for future host-microbe interaction studies. We have found that M. sympodialis secretes nanosized exosome-like vesicles, designated MalaEx, that carry allergens and can induce inflammatory cytokine responses (Gehrmann U et al 2011). To elucidate M. sympodialis host-microbe interactions we assessed whether small RNAs are present in MalaEx and, if so, whether the levels of these RNAs differ in MalaEx isolated from M. sympodialis cultured at normal skin pH compared to the higher pH on the skin of AE patients. From small RNA sequence data, we identified a set of reads with well-defined start and stop positions, in a length range of 16 to 22 nucleotides (Rayner S et al 2017). Bioinformatics analysis indicated that these RNA features appear to have an RNAi-independent route for biogenesis. No significant differences were observed between the MalaEx and their cargo of small RNAs isolated from M. sympodialis cultured at the two different pH levels indicating that they are not influenced by the

elevated pH level observed on the AE skin. We further explored how MalaEx are involved in host-microbe interactions by comparing protein content of MalaEx with that of the parental M. sympodialis yeast cells, and by investigating interactions of MalaEx with cells in the skin. iTRAQ based quantitative proteomics identified 2439 proteins of which 110 were enriched in MalaEx. Among the MalaEx enriched proteins were two of the major M. sympodialis allergens, Mala s 1 and s 7. Functional experiments indicated an active binding and internalization of MalaEx into primary human keratinocytes and monocytes, and using super-resolution fluorescence 3D-SIM imaging MalaEx were found in close proximity of the nuclei. Conclusion: Our results provide new insights into host-microbe interactions, supporting that MalaEx may have a role in the sensitization and maintenance of inflammation in AE by containing enriched amounts of allergens and with their ability to interact with skin cells. By understanding the role of M. sympodialis and MalaEx in the pathogenesis of AE, novel prevention strategies and potential therapeutic targets may arise.

14.30-14.45 Characterization of some virulence factors in Malassezia spp

L. Angiolella1, V. Tedesco1, G. Giusiano2 1Università di Roma „La Sapienza„, ROMA, Italy 2Universidad Nacional del Nordeste, CONICET, RESISTENCIA, Argentina Objectives: The main objectives of this work was to evaluate “in vitro” the hydrophobicity levels, the adherence on a plastic surface and the biofilm formation of 51 clinical isolates of Malassezia Methods: 32 furfur, 10 M. sympodialis, 5 M. globosa, 2 M. slooffiae, 1 M. restricta and 1 M. pachydermatis, were all clinical isolates tested. M. furfur and M. sympodialis references strains were also included. In order to examine the adherence capacity to plastic surface, the yeasts were grown for 72 h at 32°C in Leeming-Notman modified broth, washed twice with sterile PB and then resuspended at 37°C in RPMI 1640 modified for Malassezia plus 10% FBS at 7.5 × 10²cells/ml. After incubation for

3 h at 37°C in six-well polystyrene plates followed by extensive washing, 1 ml of Leeming-Notman Agar medium modified was poured into each well and let solidify. After incubation for 72 h at 37°C, colonies were counted and the results were expressed as a percentage of the inoculum size. Cellular surface hydrophobicity (CSH) levels were determined by two-phase system. The biofilm formation was determined by tetrazolium salt (XTT) reduction assay. Results: All isolates of Malassezia spp. were hydrophobic, adherent and producers of biofilm on abiotic surfaces with different capacity. In particular, hydrophobicity was variable and ranged from 24 ± 0.1 % for M. pachydermatis to 69.50 ± 14.6 % for M. restricta. Similar values were observed for M. furfur and M. globosa. Adherences values also display variability, with ranges between 8.4 ± 1.1 % for M. pachydermatis to 85.00 ± 2.3 % for M. restricta. High values of adherence were obtained for M. globosa (65.22 ± 3.5). In addition, the no lipid-dependent yeast M. pachydermatis showed low values of adherence and hydrophobicity respect to the other Malassezia species. All Malassezia

16

spp. were able to form biofilm on surface, ranged from 0.179 ± 0.13 % for M. slooffiae to 0. 574 ± 0.20 % for M. furfur. Except for M. pachydermatis, similar values were reported for the other Malassezia species tested

Conclusion: Our results suggest that all clinical isolates of Malassezia spp. were hydrophobic. Since the hydrophobicity is an important factor to adherence, varying degrees of success on abiotic surface were obtained. These characteristics are also involved in the high ability to form biofilm observed in this study. These important virulence factors could be responsible of this yeast changing from a commensal to a pathogenic status. The revision of the genus Malassezia has opened up new questions about the pathogenicity of Malassezia species.

14.45-15.00 Lipidomic analyses of Malassezia reveals the presence of branched fatty

acid esters of hydroxy fatty acids (FAHFAs) A.M. Celis1, H. De Cock2, S. Triana3, J. Cardona1, S. Restrepo1, A. Gonzalez1, H.A.B. Wösten2 1Universidad de los Andes, BOGOTÁ, Colombia 2Utrecht University, UTRECHT, Netherlands 3European Molecular Biology Laboratory, HEIDELBERG, Germany Objectives: Lipids are important for different biological functions such as a formation of biological membranes, energy source, protein modifiers and signaling that might have a role in host–pathogen interaction. The lipid-dependent Malassezia species are part of the normal human and animal mycobiota but are also associated with a variety of dermatological diseases and fungemia. Research in this genus has hardly focused on lipid metabolism and knowledge in this area is very limited. The purpose of this study is to characterize the total lipidome of M. furfur and M. pachydermatis grown in complex medium (mDixon). Methods: M. furfur and M. pachydermatis were growth in mDixon broth. The cell pellet was collected,

lyophilized and completely used for lipidomic analysis. Lipid extraction and analysis were performed by the West Coast Metabolomic Center (University of California at Davis) using an Agilent 1290 Infinity LC system. Lipidomic analyses resulting from quintuple biological replicates were plotted in R using the ggplot library. Results: Lipidomic analysis revealed the presence of fatty acids, phospholipids as well as triglycerides (TGs) but sterol esters (SEs) were not detected which was consistent with our previous analysis on purified lipid droplets. Remarkably, we identified the presence of branched fatty acid esters of hydroxy fatty acids (FAHFAs), this novel class of lipids have been recently reported to have anti-inflammatory effects. The presence of these lipids in Malassezia shed new light in lipid research of these yeasts. FAHFAs could contribute mechanisms involved in Malassezia commensalism and pathogenicity. Conclusion: Lipid composition of M. furfur and M. pachydermatis was rather similar to lipid compositions reported for other yeast like S. cerevisiae but deviates especially in absence of sterol esters and presence of FAHFAs. The presence of a novel class of FAHFAs is remarkable and these lipids might play a role in anti-inflammatory effects when growing on the host. Lipidomics together with genomic analysis and reconstitution of metabolic pathways are powerful tools to shed light on the lipid pathways in Malassezia spp.

15.00-15.15 Characterization of Acyl-CoA Synthetase Faa1p Involved in Fatty Acid

Utilization of Malassezia spp. T. Tenagy1, M. Ishiai2, S. Iwatani2, S. Kajiwara2 1Tokyo Institute of Technology, YOKOHAMA, Japan Objectives: Malassezia spp. are opportunistic fungal pathogens causing dandruff, pityriasis versicolor, seborrheic dermatitis, atopic dermatitis, and other skin diseases. This fungus can not synthesize fatty acids de novo due to the lack of the gene encoding fatty acid synthase (FAS). Thus,

17

Malassezia spp. commensally grow in a lipid-rich environment such as skin, scalp and other sebaceous areas of human and homothermic animals. One of the pathogenicity traits of Malassezia spp. is the lipase secretion for lipid degradation into

fatty acids, which then cause irritation of the host’s skin. Some fatty acids will also be consumed and utilized for the growth of this fungus. Before a fatty acid can be metabolized in any metabolic pathways, it has to be activated into the acyl-CoA ester by acyl-CoA synthetases (ACSs). However, how fatty acid is activated and utilized in Malassezia spp. remains unclear. Here, we observed the characteristics of Faa1p, one of the major fatty acid activators, in M. globosa, M. pachydermatis, and M. sympodialis. Methods: Orthologs of Saccharomyces cerevisae ACSs in Malassezia spp. were searched using protein

BLAST analysis from NCBI. Transcriptional expression of Malassezia ACS genes in various medium containing fatty acid was analyzed by qRT-PCR. The candidate FAA1 genes of M. globosa CBS7966T, M. pachydermatis CBS 1879NT, and M. sympodialis CBS 7222T were expressed in S. cerevisiae Δfaa1Δfaa4, then analyzed for their growth at 30°C in the medium containing 5 μg/ml cerulenin (a FAS inhibitor) and 0.5 mM long-chain fatty acids. Minimum inhibitory concentration (MIC) of triacsin C, as an ACS inhibitor, was analyzed to figure out its effect to Malassezia. To know whether this drug can block the function of Malassezia Faa1p inS. cerevisiae mutant, triacsin C was also supplemented in cerulenin and fatty acid-containing medium. Results: We found the orthologs of S. cerevisiae Faa1p in the genome of M. globosa (MGL_3626), M. pachydermatis (Malapachy_0054), and M. sympodialis (MSY001_1358), each with query cover more than 85% and identity more than 35%. Transcript level of these genes was induced by the presence of fatty acids. The expression of these Malassezia FAA1 genes restored the growth of S.cerevisiae Δfaa1Δfaa4on medium containing cerulenin supplemented with myristic acid (C14:0), palmitic acid (C16:0), and oleic acid (C18:1). Surprisingly, the S. cerevisiae mutant expressed with M. globosa and M. pachydermatis FAA1 could grow better than the wild-type on cerulenin medium containing lauric acid (C12:0). Supplementation of triacsin C inhibited the growth of M. pachydermatis in YPD medium at 5μM. This drug also blocked the rescue of M. globosa, M. pachydermatis, and M. sympodialisFaa1p in S. cerevisiae Δfaa1Δfaa4. Conclusion: Faa1p candidates of M. globosa, M. pachydermatis, and M. sympodialis have similar function with that of S. cerevisiae for utilization of myristic acid, palmitic acid, and oleic acid. The ability to utilize

lauric acid and susceptibility to triacsin C were revealed as the additional characteristics of Malassezia Faa1p unlike S. cerevisiae Faa1p.

15.15-15.30 Tea 15.30-16.00 Keynote

The multi-purpose biological functions of Malassezia metabolites on the skin include and potent antifungal activity. G. Gaitanis1, P. Magiatis2, E. Melliou2, N. Mexia2, I. Bassukas1, A. Velegraki2 1University of Ioannina, IOANNINA, Greece 2University of Athens, ATHENS, Greece Objectives: Aim of this study was to screen Malassezia indoles for in vitro antifungal activity against a selection

of commensal and opportunistic pathogenic fungi. Methods: Forty stock fungal strains (Hellenic Collection of Pathogenic Fungi-UOA/HCPF) were tested against 8 Malassezia indoles including the 5 previously isolated from diseased skin [malassezin,

pityriacitrin, indolo-3,2b -carbazole (ICZ), indirubin, and formyl-indolo - 3,2 b - carbazole (FICZ)] and 3 modified ones. The tested strains included 27 yeasts (Malassezia N=9; Cryptococcus N=10; Candida N=7; Yarrowia lipolytica N=1) and 13 moulds (Aspergillus N=7; Exophialla N=2; Fusarium N=2; Rhizopus N=2). For the broth microdilution method the CLSI M27-A3 and M38-A2 guidelines

were followed. Group susceptibility against each of the indoles was evaluated with the Kruskal-

18

Wallis and U Mann-Whitney tests including 33 strains (Y. lipolytica and Rhizopus, Fusarium and Exophiala were excluded due to small numbers). Results: The MIC values ranged for FICZ and ICZ 2-32μg/ml, indirubin 0.5-32 μg/ml, malassezin 0.125-32 μg/ml and pityriacitrin 4-32μg/ml . Over all tested strains and indolic substances median log2MIC was 4. Indirubin (median log2MIC=3) was the most potent antifungal agent and the only one that differed significantly in activity from any of the other ones. The highest median MIC(log2MIC=5) was found for FICZ. Regarding susceptibility by fungal genera two groups were discerned: Malassezia with Candida and Cryptococcus with Aspergillus. Conclusion: Malassezia-associated indoles demonstrate wide antifungal activity at clinically significant levels.

Thus their biological significance is not restricted to the activation of the aryl-hydrocarbon receptor and the modification of inflammatory pathways, but are also implicated in the modulation of fungal populations on the skin surface. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_1_452631_0775e99b-

f69d-4f06-bbe6-12aef0d09c81.png 16.00-16.15 New developments for therapeutic treatment of skin infections caused by

Malassezia spp. H. De Cock1, I.D. Valdes1, M. Rosa1, M. Morren2, S. Boerefijn3, B. Kraak3, J. Dijksterhuis3, A.M. Celis1, S. Triana4, H.A.B. Wösten1, H.P. Haagsman1, M. Van Eijk1 1Utrecht University, UTRECHT, Nederland 2Universiteit Utrecht, UTRECHT, Nederland 3Westerdijk Institute, UTRECHT, Nederland 4Universidad de Los Andes, BOGOTÁ, Colombia Objectives: The skin functions in the innate defense against pathogens due to its low water content, acidic pH, its microbiota, antimicrobial peptides and antimicrobial lipids (i.e. free fatty acids). We explored the potential of a novel therapeutic approach using antimicrobial peptides (AMPs) and fatty acids to fight fungal infections. AMPs (12-50 amino acids) are important effector molecules of the innate immune system of vertebrates and invertebrates with a broad spectrum activity against viruses, bacteria and fungi. Here we investigated whether new cathelicidin-inspired AMPs (termed ‘PepBiotics’, patent pending) can be used to fight skin infections due to Malassezia spp. These

yeasts have been associated with superficial skin infections like dandruff, pityriasis versicolor and seborrheic dermatitis, an important and common abnormal skin condition affecting about 1-3% of the population. All Malassezia species are characterized by lipid-dependency due to the lack of cytosolic fatty acid synthase and require lipids from the host for growth. Reconstitution of the lipid-synthesis pathways of Malassezia species in silico predicted amongst others defects in the assimilation of palmitic acid in M globosa, M. sympodialis, M. pachydermatis, and an atypical isolate of M. furfur, but not in M. furfur. We investigated whether FAs might have lipotoxic effects on Malassezia spp via physiological characterization in chemically defined media (MM) using different lipid sources. Methods: Inhibition of growth by ‘PepBiotics’ of Malassezia furfur isolates (DTO 383-D8 and 338-D9) in minimal medium with Tween 60 and olive oil as lipids was determined by plating and counting CFU/mL. Growth on FAs in liquid MM: Malassezia strains were first grown for 7 days at 33ºC in

lipid-rich mDixon medium. To prevent subsequent growth in MM due to the presence of residual lipids we performed a two-phase growth in MM. First, cells were diluted into MM containing defined lipid sources. After 3 days, these cells were diluted again in fresh MM with lipid components. Growth was monitored for 7 days by determining OD 600 nm and/or CFU by plating on mDixon plates. Results: M. furfur could assimilate palmitic acid and oleic acid as well as all Tween variants. The atypical M. furfur strain could assimilate only Tween 80, Tween 20, and oleic acid. M. pachydermatis, M. globosa, and M. sympodialis were able to grow in the first step in MM but not in the second step in MM with any of the lipid sources tested. Only M. furfur was able to maintain growth in MM with palmitic acid. Both M. pachydermatis and atypical M. furfur could sustain growth in MM with a

19

mixture of palmitic acid and oleic acid. ‘PepBiotics’were shown to be strongly fungicidal (≤ 1 μM) for two isolates of Malassezia furfur. Conclusion: 1. ‘PepBiotics’were shown to be fungicidal for M. furfur 2. Palmitic acid is fungicidal for a subset of Malassezia spp but not for M. furfur 3. ‘PepBiotics’ as well as FAs that induce lipid toxicity and do not affect the skin cells and microbiome harmony have a potential use as new therapeutics

16.15-16.30 Type 17 immunity controls Malassezia skin infection

F. Sparber1, C. De Gregorio2, S. Mertens1, M. Glatz3, F. Sallusto2, S. LeibundGut-Landmann1 1University of Zurich, ZURICH, Switzerland 2Institute for Research in Biomedicine, BELLINZONA, Switzerland 3Universitätsspital Zurich, ZURICH, Switzerland Objectives: The fungal microbiota of the mammalian skin is dominated by commensal fungi of the genus Malassezia. Accumulating evidence suggests that Malassezia is involved in the development and/or exacerbation of diverse skin disorders including pityriasis versicolor, dandruff, seborrhoeic eczema and atopic dermatitis. However, the causal relationship between Malassezia and the majority of these diseases remains unclear. A prerequisite for understanding the impact of Malassezia on skin pathologies is to increase the knowledge about the complex interplay between this fungus and the skin immune system. Here, we developed a novel model of Malassezia skin infection in mice to study the mammalian immune response to Malassezia and decipher the cellular and molecular mechanisms underlying fungal control in the skin in vivo. Methods: Experimental infection of mice was induced by epicutaneous application of Malassezia spp. onto unperturbed or tape-stripped ear skin. Fungal colonization was assessed by enumeration of colony-forming units in the infected skin tissue. The local immune response was determined by analyzing skin pathology, tissue cytokine induction and immune cell infiltration. The T cell response against Malassezia spp. was assessed by flow cytometry following antigen-specific re-stimulation of skin-draining lymph node cells. Human memory T cells were also analyzed for their Malassezia-responsiveness. Results: Topical application of several different Malassezia species onto the ear skin of wild type mice resulted in a high level of fungal colonization and a robust host response to the fungus, characterized by skin thickening and infiltration of inflammatory leukocytes. Skin inflammation was further augmented by tape-stripping of the ears prior to infection, indicating that Malassezia has the

potential to promote skin inflammation under atopic skin conditions such as barrier deficiency. Infected animals showed activation of type 17 immunity, as evidenced by local IL-17 cytokine production in the infected tissue and by increased frequencies of Th17 cells in the draining lymph nodes. Consistently, we found that Malassezia-specific memory T cells in healthy human individuals that respond to several different Malassezia spp. belong predominantly to the Th17 subset. Underlining the relevance of IL-17 in maintaining fungal colonization, IL-17-deficient mice are unable to prevent Malassezia overgrowth in the ear skin. Conclusion: Together, our results demonstrate a critical and so far unrecognized role of type 17 immunity in keeping the balance between the skin commensal Malassezia and the mammalian immune system. This is reminiscent of what is known about the IL-17 pathway in the control of other fungal com

Theme Molecular Biology, Genetics and Genomics 1 16.30-17.00 Keynote

Genomics of Malassezia and the genetics toolbox J. Heitman Duke University Medical Center, DURHAM, USA

20

Objectives: The genus Malassezia includes 17 species that form a monophyletic group of basidiomycete yeasts that are common commensals and pathogens of the skin of animals. Microbiome studies have revealed that we are colonized by multiple species, and environmental studies reveal unique associations with sponges and coral by novel taxa. These fungi are unique in that they all have lost the fatty acid synthase gene, and require lipids for axenic culture. As a consequence, they are well adapted to survive on the skin of animals, where they harvest lipids from sebaceous secretions. We seak to advance genetics and genomics approaches to understand the biology of this unique group of fungi to elucidate the basis of commensalism and pathogenesis. Methods: Genome analysis for 14 species reveals a reduced genome size (7 to 9 MB) and fewer genes compared to other related fungi (Ustilago, Cryptococcus). Long read sequencing technologies (PacBio) combined with proteomics has enabled a complete chromosome assembly to be generated for a representative species. In parallel with advancing genomics resources for this species complex, advances in genetics include transformation and gene disruption via homologous recombination by transkingdom DNA transfer by Agrobacterium. Results: These advances are enabling insights into the nature of antifungal drug targets, and genes and gene products required for physiological properties likely necessary for colonization and virulence, and analysis of genes that have been horizontally acquired from commensal skin bacteria. Ongoing studies seek to define the nature of the centromeres, definition of the karyotype and chromosomal translocations, and the possibility of an extant sexual cycle. Conclusion: Analysis of the mating type loci has revealed a novel configuration, termed pseudobipolar, in which the loci encoding homeodomain transcription factors (HD) and the pheromone/pheromone receptors (PR) are genetically linked, but recombination between the loci can still occur. This may represent an evolutionary transitional intermediate between the tetrapolar and bipolar mating type configurations.

Friday morning, July 6 Theme Molecular Biology, Genetics and Genomics 2

9.30-9.45 Strategies to study and model skin disease

K. Boonekamp

Hubrecht Institute, UTRECHT, The Netherlands

Introduction: Recent advances in biomedical research have allowed culture of primary tissue from healthy individuals and patients. In addition to current skin culture techniques that support studying skin and its diseases we aim to expand the tools in the skin field to allow growth of primary cells in a defined culture medium without the presence of feeder cells. Methods: In our group we use organoid technology to culture several types of tissue. By using purely primary cells, a defined culture medium and a supporting matrix can maintain and expand murine skin cells in vitro. Results: Murine skin derived organoids can be grow for long term and are genetically stable over time. They show characteristics of interfollicular epidermis and maintain these features over time. Organoid cultures can be genetically altered via lentiviral- transduction using CRISPR/CAS9 technology. Conclusions:

We can grow murine skin cells in vitro in a three-dimensional culture system for long term

9.45-10.00 Sex in Malassezia

Q.-M. Wang Institute of microbiology, CAS, BEIJING, China

21

Objectives: Malassezia species are associated with a number of skin disorders and systemic diseases for humans and animals. The mating for most of pathogenic fungi play an important role in pathogenesis. However, the sexual cycle of Malassezia is till mysterious at present. Here we explore the life cycle of the species of Malassezia furfur.

Methods: The morphology of yeast cells was visualized by conventional light microscopy, fluorescence cytometry and electron microscopy. Genome was assembled by spades software with default parameters. Results: Two different mating types were found for M. furfur during the population genomic analyses. In those Chinese isolates of M.furfur, the complementary haploid cells can conjugate and give rise to diploid cells, which were certified by fluorescence cytometry, or to somewhat short hyphae without clamp connections. Two different Pra gene (Pra1 and Pra2) were amplified by the PCR from the diploid cells. Teliospores and basidia were not observed, however, four daughter cell can form from the mother (diploid) cells. Only one type of Pra (Pra1 or Pra2) gene were identified from the single daughter cell and many loci recombination occur in the genome of the daughter cells. Conclusion: The above data indicated that M. furfur can undergo mating and form a simple life cycle comparing its closely related plant pathogen Ustilago maydis. This special life cycle of M.furfur may adapt to the skin niche of humans and animals.

10.00-10.15 Horizontal gene transfer in the skin fungus Malassezia: NO resistance is

mediated by a bacterial flavohemoglobin G. Ianiri Duke university, DURHAM, USA Objectives: The skin of humans and animals is colonized by numerous microganisms that comprise the skin microbiome. They mainly include both commensal and pathogenic fungi and bacteria that share the same ecological niche and established intense interactions. Malassezia species are the most abundant fungal skin inhabitant of all warm-blooded animals. Previous genomics studies revealed the presence of genes of bacterial origins in the Malassezia genus likely acquired through horizontal gene transfer, including the flavohemoglobin-encoding gene YHB1. The aims of the present study are to 1) use functional genetics to characterize the role of the bacterial YHB1 gene in Malassezia sympodialis, and 2) identify additional Malassezia species-specific horizontal gene transfer events. Methods: A recently-developed Agrobacterium tumefaciens transconjugation approach was used for targeted deletion of the bacterial YHB1 gene in M. sympodialis, and for the following functional complementation using GFP-tagged proteins. The yhb1? mutant and the complementing strains were subjected to in vitro and in vivo phenotypic characterization. Bioinformatics approaches were carried out to elucidate the evolution and phylogeny of the flavohemoglobin in the whole Malassezia genus, and to identify additional species-specific horizontal gene transfer events. Results: In the present study, using targeted gene deletion and complementation in M. sympodialis, we

demonstrated that the bacterial Yhb1 is a cytoplasmic protein required for nitric oxide detoxification and nitrosative stress resistance under aerobic conditions. Moreover, analysis of the available Malassezia genomes identified two different flavohemoglobin-encoding genes (YHB1 and YHB101) present as a single copy in different species, and further analyses revealed that both were acquired through two independent horizontal gene transfer events from different donor bacteria that are part of the mammals' microbiome. Similar to Yhb1, the flavohemoglobin-encoding gene YHB101 rescues the sensitivity of the M. sympodialis yhb1? deletion mutant to nitrosative stress-inducing agents, and it localizes to the cytoplasm. Both flavohemoglobin-encoding genes are predicted to play a role in the pathogenic interaction of Malassezia with the host. Lastly, additional genus- and species- specific horizontal gene transfer events were identified. Conclusion: In conclusion this study demonstrates that two different Malassezia flavohemoglobins were acquired through independent horizontal gene transfer likely to overcome nitric oxide toxicity and nitrosative stress generated by host cells. Moreover, the presence of several other additional genes

22

acquired through horizontal gene transfer from bacteria suggests that these events shaped Malassezia genomes and may have contributed to its evolutionary trajectory as the main fungal skin inhabitant.

10.15-10.30 The genomic tandem quadruplication is associated with ketoconazole

resistance of Malassezia pachydermatis M. Park1, Y. Cho2, S.Y. Hwang3, 4, W.H. Jung1, 4 1Chung-Ang University, ANSEONG, South Korea 2Korea Polar Research Institute, INCHEON, South Korea 3Haemaru Small Animal Research Institute, SUNGNAM, South Korea Objectives: Malassezia pachydermatis is a commensal yeast found on the skin of dogs. However, M. pachydermatis is also considered an opportunistic pathogen and is associated with various canine

skin diseases including otitis externa and atopic dermatitis, which usually require treatment using an azole antifungal drug such as ketoconazole. In this study, we isolated a ketoconazole resistant M. pachydermatis from the external ear canal of a dog with otitis externa and analyzed its resistance mechanism. Methods: To understand the ketoconazole resistance of the clinical isolate M. pachydermatis KCTC 27587, the whole genome of the yeast was sequenced using the PacBio platform and compared with M. pachydermatis type strain CBS 1879.

Results: We found that an ~84 kb region in chromosome 4 of M. pachydermatis KCTC 27587 was tandemly quadruplicated. The region contains 52 protein coding genes including the homologs of ERG4 and ERG11 whose overexpression is known to be associated with azole resistance.

Conclusion: Our data suggest that the quadruplication of the ~84 kb region may be the cause of the ketoconazole resistance in M. pachydermatis KCTC 27587.

10.30-10.45 Coffee 10.45-12.30 General discussion/Roundtable Moderators G. Gaitanis & T. Boekhout

Please send your questions, remarks, discussion points to t.boekhout@westerdijkinstitute.nl before June 22 !

23

Posters Manipulating Malassezia: a fluorescent marker for cell tracking J. Goh1, G. Ianiri2, F. Yang3, J. Heitman2, T. Dawson1 1Institute of Medical Biology, A*STAR, SINGAPORE, Singapore 2Duke University Medical Center, DURHAM, USA 3Temasek Life Sciences Laboratory, SINGAPORE, Singapore Objectives: Mammalian skin is the primary defence against invasive pathogenic microorganisms and simultaneously is host to a wealth of commensal microbes. Genomic and culture-based methodologies reveal lipophilic Malassezia spp. as the

most abundant and dominant amongst the wide diversity of fungal communities on human skin. While Malassezia is commonly accepted as commensal, they are also identified as the prime culprit in skin abnormalities such as seborrhoeic dermatitis and pityriasis versicolor. However, the exact role Malassezia play in triggering the host immune response is still not well understood. In this study, we have aimed to fluorescently tagged Malassezia furfur to enable study of its interactions in animal models and host immune cells. Methods: Transformation of Malassezia furfur was accomplished using Agrobacterium tumefaciens by the method of Ianiri et al, harbouring a plasmid containing mCherry fluorescent protein and an antibiotic resistance cassette. To ensure stable integration and expression of the modified genotype, successful clones were continuously passaged over 4 weeks before verification with PCR and fluorescent microscopy against parental Malassezia. Results: Over 20 Malassezia furfur clones have the mCherry gene successfully incorporated in its genome, showing that Agrobacterium tumefaciens-mediated transformation is a versatile and functional tool in genetically manipulating Malassezia. Conclusion: Malassezia furfur can acquire and stably express genomically incorporated exogenous DNA without compromising cell growth. Future and on-going work includes generating other fluorescent tags e.g. GFP and YFP in laboratory and primary strains, including physiologically relevant Malassezia such as M. globosa, M. restricta and M. sympodialis. We are also interested in generating M. furfur targeted gene knockouts to study specific physiological roles in the interaction of M. furfur interaction with human skin. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_1_425682_7a3f1f8d-6e64-4d06-8bca-4f635571a39c.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8MAL/add_425682_7a3f1f8d-6e64-4d06-8bca-4f635571a39c.png Extracellular nanovesicles released from the commensal yeast Malassezia sympodialis are enriched in allergens and interact with cells in human skin C. Johansson1, H. Vallhov1, H. Johansson1, T. Holm1, U. Gehrmann1, A. Andersson1, H. Blom2, M. Carroni3, J. Lehtiö1, A. Scheynius1 1Karolinska Institutet, STOCKHOLM, Sweden 2Royal Institute of Technology, STOCKHOLM, Sweden 3Cryo-EM National Facility, STOCKHOLM, Sweden Objectives: Atopic dermatitis (AD) is a complex inflammatory skin disorder, which affects 15 to 20% of young children and up to 3% of adults. While the pathogenesis of the disease still remains unclear, studies suggest that a genetic predisposition in combination with environmental factors facilitate the development of AD. A defective skin barrier in turn might assist the entry of microorganisms, such as the commensal yeast Malassezia sympodialis present on the skin. Thirteen Malassezia allergens have been identified so far. We have previously found that M. sympodialis releases nanosized extracellular vesicles, designated MalaEx, which are carriers of small RNAs and allergens, and that they can induce inflammatory cytokine responses in human blood cells. To receive new insights into the morphology of MalaEx and to further explore how MalaEx are involved in host-microbe interactions we here compared the protein content of MalaEx with that of the parental yeast cells, and investigated interactions of MalaEx with cells in human skin. Methods: MalaEx were prepared from M. sympodialis culture supernatants by serial ultracentrifugation. The vesicles was

visualized with cryo-electron tomography. iTRAQ based quantitative proteomics was used to map the protein content

24

in lysates from MalaEx and whole M. sympodialis cells, respectively. Functional experiments was performed as co-culture of MalaEx with human primary keratinocytes and monocytes, whereafter interactions were visualized by confocal laser-scanning microscopy and with super-resolution fluorescence structured illumination microscopy (3D-SIM). Results: Cryo-electron tomography revealed a heterogeneous population of MalaEx. iTRAQ based quantitative proteomics identified in total 2439 proteins in all replicates of which 110 were enriched in MalaEx compared to the yeast cells. Among the MalaEx enriched proteins were two of the major M. sympodialis allergens, Mala s 1 and s 7. Functional experiments indicated an active binding and internalization of MalaEx into human keratinocytes and monocytes, and MalaEx were found in close proximity of the nuclei using super-resolution fluorescence 3D-SIM imaging. Conclusion: Our results provides new insights into host-microbe interactions, supporting that MalaEx may have a role in the sensitization and maintenance of inflammation in AE by containing enriched amounts of allergens and with their ability to interact with skin cells. Mating type and population genomics in Malassezia Q.-M. WANG, K. Li, X.-L. ZHANG Institute of Microbiology, CAS, BEIJING, China Objectives: The yeast species of Malassezia, belonging to the Ustilaginomycotina, are known as normally skin resident of humans and animals and also associated with a number of skin disorders and systemic diseases for their hosts. The mating of Malassezia may play an important role in pathogenesis. However, only Malassezia sympodialis was reported to have two different mating-type and suggested to be a pseudo-bipolar mating systems, the complementary mating type in other sixteen species of Malassezia are still unclear at present. Here we explored the mating type for all most species of Malassezia by genomic population method. Methods: Genome was assembled by spades software with default parameters. The genes were annotated by a combination of

four independent ab initio predicators Augustus, GeneMark (Version 4.30), SNAP24, and Glimmer.25. Finally, EVidenceModeler (EVM) to compute weighted consensus gene structure annotations. The maf gene identification was done by Fgenesh services online. Results: More than 300 strains of Malassezia, including M. dermatis, M. furfur, M. globosa, M. japonica, M. obtusa, M. pachydermatis, M. restricta, M. slooffiae, M. sympodialis and M. yamatoenis, have been isolated from healthy and clinical patients in China. M. globosa and M. restricta are dominant in the samples from most provinces of China, but M. furfur and M. slooffiae are most frequently isolated from those samples in Tibet, China. The following studies of population genomics of those isolates showed that M. furfur, M. globosa, M. restricta and M. slooffiae have two different mating types. Conclusion: Our results indicated that M. furfur, M. globosa, M. restricta and M. slooffiae may undergo a sexual reproduction as suggested for M. sympodialis. Those new isolates with different mating type and their genomic data will help us to explore the life cycle and virulence potential of this genus in the future.