Magnesium ions enhance the transfer of human papillomavirus E2 protein from non-specific to specific...

Article No. jmbi.1999.3314 available online at http://www.idealibrary.com on J. Mol. Biol. (1999) 294, 885±896

Magnesium Ions Enhance the Transfer of HumanPapillomavirus E2 Protein from Non-specific toSpecific Binding Sites

Hannah Lewis and Kevin Gaston*

Department of BiochemistrySchool of Medical SciencesUniversity of Bristol, BristolBS8 1TD, UK

E-mail address of the [email protected]

Abbreviations used: HPV, humanLCR, long control region; BPV-1, bo1; DBD, DNA-binding domain; EBNvirus nuclear antigen 1; E2, HPV 16

0022-2836/99/490885±12 $30.00/0

The human papillomavirus 16 E2 protein binds to four speci®c DNAsequences present within the HPV 16 genome and regulates viral geneexpression and DNA replication. However, the E2 protein can also bindtightly to non-speci®c DNA sequences. Here, we show that in bindingreactions which contain an excess of non-speci®c DNA, magnesium ionsenhance the binding of E2 to its speci®c sites. In contrast, in the absenceof non-speci®c DNA, magnesium ions have no effect on the binding ofE2 to speci®c sites. Although these data suggest that magnesium ionsdecrease the binding of E2 to non-speci®c DNA, gel retardation assaysshow that these ions have no effect on the binding of E2 to short non-speci®c DNA fragments and have only a minor effect on the binding ofE2 to long non-speci®c DNA fragments. We also show that the bindingof E2 to long fragments of non-speci®c DNA is highly cooperative. TheE2-non-speci®c DNA complexes formed in the absence of magnesiumions are highly stable. However, the addition of speci®c DNA to E2-non-speci®c DNA complexes formed in the presence of magnesium ionsrapidly results in the formation of E2-speci®c DNA complexes. Our datasuggest that magnesium ions facilitate the transfer of E2 from non-speci®c binding sites to speci®c binding sites, and help to explain howE2 is able to direct human papillomavirus transcription and DNA replica-tion in intact cells.

# 1999 Academic Press

Keywords: papillomavirus; E2; DNA binding; sequence-speci®city;facilitated transfer
*Corresponding author
Introduction

The recognition of speci®c DNA sequences bytranscription factors is often the principal controlpoint in the regulation of gene expression. Formost, if not all transcription factors, the number ofspeci®c binding sites on DNA is tiny compared tothe number of possible non-speci®c binding sites.Thus, to understand how genes are regulated, we®rst need to understand how transcription factorsdifferentiate between speci®c and non-speci®cDNA sequences. We have been studying the E2protein from human papillomavirus (HPV) type16. The HPV 16 E2 protein binds to four speci®c

ing author:

papillomavirus;vine papillomavirus-A1, Epstein-BarrE2 protein.

sites within the HPV 16 genome and regulatesviral gene expression and DNA replication(reviewed by Thierry, 1996). However, the E2 pro-tein also binds tightly to non-speci®c DNAsequences (Sanders & Maitland, 1994).

Papillomaviruses are DNA tumour viruses thatinfect epithelial cells and induce the formation ofhyperproliferative lesions (also known as warts).There are at least 95 distinct types of human papil-lomavirus, some of which produce lesions thathave the potential to undergo malignant trans-formation (van Ranst et al., 1996). HPV types 16and 18, for example, play a primary role in thedevelopment of cervical cancer (reviewed by zurHausen, 1991). In HPV 16, transcription of the viralgenes is under the control of a single promoterlocated at the 30 end of a 1 kb long control region,or LCR (Smotkin & Wettstein, 1996). The LCR con-tains numerous binding sites for both viral and cel-lular proteins. These include: four binding sites forthe E2 protein, a single binding site for the viral E1

# 1999 Academic Press

mailto:[email protected]

http://www.idealibrary.com

886 Sequence-speci®c DNA Binding by the E2 Protein

protein, and multiple binding sites for more than adozen different cellular transcription factors(O'Connor et al., 1996).

The HPV 16 E2 protein binds as a dimer toinverted repeats that conform to the consensussequence 50AACCGN4CGGTT 30 (Thain et al.,1997). The protein consists of two domains, anN-terminal transcription activation domain and aC-terminal DNA binding/dimerisation domain,that are thought to be separated by a ¯exible hinge(Giri & Yaniv, 1988). The HPV 16 E2 protein sharesa high degree of sequence similarity with thebovine papillomavirus-1 (BPV-1) E2 protein, andthe structures of the C-terminal DNA-bindingdomains (DBDs) from both of these proteins havebeen determined by X-ray crystallography (Hegdeet al., 1992; Hegde & Androphy, 1998). The twosubunits of the E2 dimer form two halves of a b-barrel. Each half of the barrel carries two surface a-helices, and in the crystal structure of the BPV-1 E2DBD-DNA complex, one a-helix from each half-barrel makes speci®c contacts with the base-pairsin two successive major grooves of the DNA.Further evidence to support this mode of DNA rec-ognition comes from both biochemical and geneticexperiments. For example, DNase I footprintingreveals that the BPV-1 E2 DBD protects around22 bp of DNA centred on the consensus sequence50ACCN6GGT 30, a degenerate version of the HPV16 E2 consensus site (Moskaluk & Bastia, 1988). Inaddition, genetic studies have shown that amutation from arginine to alanine at position 304of the HPV 16 E2 protein leads to a loss of speci-®city at the ®rst and last positions of the HPV 16E2 binding site (Thain et al., 1997). Only one otherprotein has been shown to recognise DNA usingthis type of DNA binding/dimerisation domain.The crystal structure of the DNA-binding domainfrom the Epstein-Barr virus nuclear antigen 1(EBNA1) protein shows that the core of the EBNA1DBD is structurally identical with the E2 DBD(Bochkarev et al., 1995, 1996). However, theEBNA1 core region appears to make no sequence-speci®c DNA contacts. Instead, each half-barrel ofthe EBNA1 DBD carries an additional surface a-helix and an N-terminal extended polypeptidechain that together mediate sequence-speci®c con-tacts via major and minor groove interactions,respectively (Bochkarev et al., 1996).

The E2-DNA interaction is facilitated by changesin both DNA and protein conformation. The bind-ing of both BPV-1 E2 and HPV 16 E2 to their rec-ognition sites induces a signi®cant DNA bend(Moskaluk & Bastia, 1988; Thain et al., 1997). Thecrystal structure of the BPV-1 E2-DNA complexshows that the DNA is wrapped around the pro-tein and that the overall DNA bend angle isaround 50 � (Hegde et al., 1992; Rozenberg et al.,1998). Gel retardation assays using circularly per-muted DNA fragments, have shown that the HPV16 E2 protein induces a DNA bend of around 60 �when it binds to a speci®c site (Thain et al., 1997).The binding of BPV-1 E2 DBD to speci®c DNA

sequences has recently been shown to result in asigni®cant rearrangement of the protein subunits(Hegde et al., 1998). This change in protein confor-mation brings the recognition helices into closecontact with the exposed edges of base-pairs in themajor groove. The binding of EBNA1 to speci®cDNA sequences is also accompanied by signi®cantchanges in DNA conformation (Bochkarev et al.,1996, 1998). The DNA in the EBNA1-DNA com-plex is wrapped around the protein to give anoverall bend angle of around 50 �. The core regionof the EBNA1 DBD undergoes little conformationalchange on binding to DNA. However, theextended polypeptide chains that form minorgroove contacts with the EBNA1 binding site werenot present in the EBNA1 DBD fragment used todetermine the structure of the unbound protein(Bochkarev et al., 1995). These extended chains arewrapped around the DNA in a manner whichsuggests that correct folding of these regions mustaccompany DNA binding.

The binding of BPV-1 E2 to DNA fragments car-rying multiple speci®c recognition sites is a highlyco-operative process, and DNA-bound BPV-1 E2dimers associate to form DNA loops (Spalholzet al., 1988; Monini et al., 1991; Knight et al., 1991).E2 dimers have also been shown to bind coopera-tively with other DNA-binding proteins. Forexample, the E2 and E1 proteins from severalpapillomaviruses have been shown to interact andthis interaction results in enhanced DNA binding(Frattini & Laimins, 1994). BPV-1 E2 also interactsdirectly with the transcription factor Sp1. The E2-Sp1 interaction brings about increased DNA bind-ing and mediates the formation of DNA loopsbetween suitably spaced Sp1 and E2 binding sites(Li et al., 1991). Similarly, BPV-1 E2 has beenshown to interact with the TATA box-binding pro-tein and again, this interaction results in increasedDNA binding (Rank & Lambert, 1995; Steger et al.,1995). Here, we show that the binding of HPV 16E2 protein to non-speci®c DNA is also highly co-operative. We show that magnesium ions bringabout a change in the nature of the E2-non-speci®cDNA complex and that this change facilitatessequence-speci®c DNA binding.

Results

The HPV 16 E2 protein (hereinafter referred tosimply as E2) binds to four speci®c sites within theHPV 16 LCR. Somewhat surprisingly, previousstudies have reported widely different apparentequilibrium constants (Keq(app)) for the binding ofE2 to these sites. For example, the values reportedfor the apparent equilibrium constant for the bind-ing of E2 to the most promoter-proximal E2 bind-ing site in the HPV 16 LCR (E2 site 1 or E2(1) inour nomenclature) vary from around 10ÿ7 M toaround 10ÿ10 M. These large variations appear tobe a consequence of whether the experiments wereperformed in the absence or presence of non-

Figure 1. Magnesium ions appear to enhance thespeci®c binding of E2. (a) A representative gel retar-dation experiment. Increasing concentrations of E2DBD

(from 0.13 nM to 130 nM) were incubated with labelledE2(1) and non-speci®c competitor DNA (80 ng/ml poly-(dI.dC)) in the absence or presence of 5 mM MgCl2(lanes 2-9 and lanes 11-18, respectively). After 20 min-utes at 20 �C, free and bound labelled DNA were separ-ated on a 5 % polyacrylamide gel and visualised byautoradiography. (b) A graph showing the binding ofE2DBD to E2(1) in the absence (®lled circles) or presence(open circles) of 5 mM MgCl2. At each protein concen-tration, the amount of free and bound DNA was deter-mined using a PhosphorImager and the percentage oflabelled DNA bound ([bound labelled DNA/(boundlabelled DNA � free labelled DNA)] � 100) is plottedagainst the amount of E2DBD added. The data are themean and standard deviation from four separate exper-iments and were used to determine the apparent equili-brium constants shown in Table 1 (when error barscannot be seen they are smaller than the symbols).

Sequence-speci®c DNA Binding by the E2 Protein 887

speci®c competitor DNA. Thus, in the absence ofnon-speci®c DNA, the E2 protein binds to E2(1)with a Keq(app) of 9 � 10ÿ11 M (Sanders & Maitland,1994), whereas in the presence of non-speci®cDNA, E2 binds to the same site with a Keq(app) of2 � 10ÿ7 M (Thain et al., 1997). As might beexpected from these results, E2 binds tightly tonon-speci®c DNA sequences (Keq(app) 2 � 10ÿ9 M)(Sanders & Maitland, 1994). Bearing in mind thatin a cell the concentration of non-speci®c DNA ismuch higher than the concentration of speci®c E2binding sites, it is dif®cult to understand how E2 isable to discriminate between different DNAsequences. To gain a better understanding of howE2 recognises speci®c sites, we have performedin vitro DNA binding assays in the absence andpresence of non-speci®c DNA, and in the absenceand presence of divalent cations. Since previouswork has shown that the isolated E2 DBD is themajor determinant of DNA binding af®nity andspeci®city, and that this domain is relatively easyto purify, we have used a truncated E2 fragment(E2DBD) in these experiments (Sanders & Maitland,1994; Thain et al., 1997). E2DBD consists of the C-terminal 86 amino acid residues of E2.

Magnesium ions appear to enhance specificE2-DNA interactions

Increasing amounts of puri®ed E2DBD wereadded to a mixture of labelled oligonucleotides car-rying E2 site 1 and an excess of unlabelled non-speci®c DNA, in either the absence or presence ofMgCl2. After 20 minutes at 20 �C, free and boundlabelled DNA were separated by polyacrylamidegel electrophoresis and visualised by autoradiog-raphy (Figure 1(a)). The binding of E2DBD results inthe formation of a single retarded band (indicatedby the arrowhead). The quantity of free and boundDNA was determined using a PhosphorImager.Shorter or longer incubation times (ten and 40 min-utes, respectively) did not result in the appearanceof more bound DNA, suggesting that equilibriumhad been reached (data not shown). The exper-iment was repeated four times and binding curves®tted to the data (Figure 1(b)). Since the resultingbinding curves appeared to describe the datawithin experimental error, they were used to calcu-late the apparent equilibrium constant in theabsence and presence of magnesium ions (Table 1).As can be seen from the data, magnesium ionshave a dramatic effect on the binding of E2DBD toDNA. Under the conditions used in these exper-iments, magnesium ions appear to stronglyenhance the binding of E2 DBD to speci®c DNAsequences.

The binding of E2DBD to specific and non-specific oligonucleotides

There are several possible explanations for theapparent increase in speci®c DNA binding activityseen in the presence of magnesium ions. One possi-

Table 1. The binding of E2DBD to HPV 16 E2 site 1

Apparent equilibrium constanta

(nM)

ÿMg2� 300 � 20�Mg2� 14 � 4.4

a The apparent equilibrium constant (Keq(apparent)) was obtained

using the equation:

�boundDNA� � �maximum boundDNA�� protein�=�protein� � Keq�apparent�

When [DNA]5Keq, the apparent equilibrium constant is equalto the protein concentration at half maximum DNA binding.The values shown are derived from four independent experi-ments.

Figure 2. Magnesium ions have no effect on the bind-ing of E2 to short DNA fragments. (a) Increasing con-centrations of E2DBD (from 0.13 nM to 130 nM) wereincubated with labelled E2(1) in the absence of non-speci®c competitor DNA, in the absence (®lled circles)or presence (empty circles) of 5 mM MgCl2. The percen-tage of DNA bound was determined exactly asdescribed in the legend to Figure 1. Mean and standarddeviation from three separate experiments. When errorbars cannot be seen they are smaller than the symbols.(b) Increasing concentrations of E2DBD (from 0.13 nM to130 nM) were incubated with a labelled YY1 bindingsite in the absence (®lled circles) or presence (opencircles) of 5 mM MgCl2. The percentage of DNA boundwas obtained from (total DNA ÿ free DNA)/totalDNA � 100. The data are the mean and standarddeviation from three separate experiments. When errorbars cannot be seen they are smaller than the symbols.


bility is that magnesium ions might tighten thebinding of E2 to its speci®c recognition sites. Alter-natively, magnesium ions might weaken the bind-ing of E2 to non-speci®c DNA sequences. To testthe ®rst possibility, we assayed the binding ofE2DBD to E2 site 1 in the absence of non-speci®ccompetitor DNA. Increasing concentrations ofE2DBD were incubated with labelled oligonucleo-tides carrying E2(1), either without or with MgCl2.The results of this experiment are shown graphi-cally in Figure 2(a). In the absence of non-speci®cDNA, magnesium ions have no effect on the bind-ing of E2 to speci®c DNA. In both the absence andpresence of magnesium, there is a slight thresholdin the build up of E2DBD-DNA complexes at lowprotein concentrations. At low concentrations theE2DBD has been reported to exist as an unfoldedmonomer, and under these conditions DNA bind-ing and protein folding might be coupled events(Mok et al., 1996). However, magnesium ions donot affect this threshold phase.

To test whether magnesium ions have an effecton the binding of E2 to non-speci®c DNA, weassayed the binding of E2DBD to a non-speci®clabelled oligonucleotide. Increasing amount ofE2DBD were incubated with a labelled oligonucleo-tide that carries a binding site for the transcriptionfactor YY1 and lacks E2 sites. The binding of E2 tothis oligonucleotide did not result in the formationof a discrete retarded band after gel electrophoresis(as in Figure 1) but instead produced a smear,possibly due to dissociation of the non-speci®ccomplexes within the gel matrix (data not shown).To quantify the binding of E2 to this sequence wetherefore determined the amount of free DNA ateach concentration of E2DBD (Figure 2(b)). Surpris-ingly, the binding of E2DBD to this non-speci®c oli-gonucleotide was the same in both the absence andpresence of magnesium ions. The same result wasobtained using a labelled oligonucleotide carryinga binding site for the transcription factor Sp1 (datanot shown). Interestingly, there is also a slightthreshold in the build up of E2DBD-non-speci®cDNA complexes at low protein concentrations.However, as shown in Figure 2(a), magnesiumions do not seem to effect this threshold phase.

Taken together, these data suggest that mag-nesium ions have little or no effect on the bindingof E2 to speci®c, or non-speci®c, short DNA frag-ments. Since the experiments described in the pre-vious section clearly demonstrated that in the

Figure 3. Magnesium ions facilitate the dissociationof E2-non-speci®c DNA complexes. (a) A schematicrepresentation of the experiment. E2DBD (10 nM) wasincubated with 16mg of unlabelled plasmid pAT153b for20 minutes at 20 �C. Labelled E2 site 1 (E2(1)) was thenadded and at time intervals beginning at t � 0, aliquotsof the mixture were removed and loaded onto a running5 % non-denaturing polyacrylamide gel. (b) The graphshows the apparent dissociation of E2DBD-non-speci®cDNA complexes in the absence (®lled circles) or pre-sence (open circles) of 5 mM MgCl2. The percentage ofE(1) bound to E2DBD ([bound labelled DNA/(boundlabelled DNA � free labelled DNA)] � 100) is plottedagainst time after the addition of the labelled DNA.Since labelled E2 site 1 is in excess over E2DBD, theamount of labelled DNA bound to protein only reachesaround 20 % of the total labelled DNA. The data are themean and standard deviation from three separate exper-iments and were used to determine the apparentdissociation rate shown in Table 2. When error bars can-not be seen they are smaller than the symbols.


presence of non-speci®c DNA, magnesium ionsenhance binding to speci®c sites, we next looked atthe effects of magnesium on the binding of E2 tolong DNA molecules.

The apparent dissociation rate of non-specificE2-DNA complexes

To investigate the stability of the interactionbetween E2 and non-speci®c DNA, we ®rst incu-bated E2DBD with an excess of non-speci®c plasmidDNA to form non-speci®c complexes, and thenchallenged these complexes with a labelled speci®cE2 binding site. The non-speci®c plasmid used inthis experiment was a derivative of pAT153 thatdoes not contain E2 binding sites; pAT153b (Taylor& Halford, 1989). The labelled speci®c DNA wasE2 site 1. At time points after the addition of thelabelled DNA, aliquots of the mixture wereremoved and loaded onto a running non-denatur-ing polyacrylamide gel. Figure 3(a) shows a sche-matic of this experiment and Figure 3(b) shows agraphical representation of the results. In theabsence of magnesium ions, very little E2DBD

leaves the non-speci®c DNA and binds to thespeci®c DNA. However, in the presence of mag-nesium ions, E2DBD-speci®c DNA complexesappear rapidly. These data imply that the E2-non-speci®c DNA complexes formed in the presence ofmagnesium ions are less stable than the non-speci®c complexes formed in the absence of mag-nesium ions. The long half-life of the non-speci®ccomplexes formed in the absence of magnesiumions (several days) suggests that the binding reac-tions containing non-speci®c DNA described in theprevious sections, could not have reached equili-brium after 20 minutes. This means that at shorttime points (less than several hours), as increasingamounts of E2 are added to a mixture of speci®cand non-speci®c DNA, the amount of speci®c com-plex formed is determined by the ratio of the for-ward rate constants for speci®c and non-speci®cbinding. In this case, equilibrium can only bereached after prolonged incubations during whichtime there is slow dissociation from non-speci®cDNA followed by re-association with eitherspeci®c sites or other non-speci®c sites. The differ-ence in the apparent equilibrium constants deter-mined in the absence and presence of magnesiumions can therefore be explained by the effect theseions have on the non-speci®c complexes. Presum-ably, in the presence of magnesium ions, E2 bindsavidly to both non-speci®c and speci®c DNA butthe transfer of E2 from non-speci®c DNA tospeci®c DNA appears to result in an enhancementof binding to speci®c sites.

Since the binding of free E2 to its speci®c siteoccurs within seconds (data not shown), the rate atwhich the speci®c E2-DNA complex appears inFigure 3 can be considered to be the apparent dis-sociation rate for the E2-non-speci®c DNA com-plex. Although our data suggest that magnesiumions increase the rate at which E2 dissociates from

non-speci®c DNA, it is important to point out thatthe apparent dissociation rate is not necessarilyrelated to the real dissociation rate. The real dis-sociation rate refers to the breakdown of the pro-tein-DNA complex and should be independent ofthe nature of the non-speci®c DNA. In contrast, theapparent dissociation rate can be in¯uenced byseveral factors including, for example, whether ornot the non-speci®c DNA facilitates the transfer ofthe protein from one site to another (see, forexample, Fried & Crothers, 1984). To examinefurther the escape of E2 from non-speci®c com-


plexes we therefore looked at the dissociation ofE2DBD from a variety of non-speci®c DNAs. Non-speci®c DNA fragments were generated by restric-tion digestion of pAT153b or by using non-speci®coligonucleotides. The dissociation of E2DBD fromeach non-speci®c DNA was assayed exactly asdescribed above, with the dissociation of E2DBD

from intact pAT153b repeated on each gel as aninternal control. As can be seen from the data inTable 2, the rate at which E2DBD leaves non-speci®cDNA is dependent upon the exact nature of thenon-speci®c DNA species. Thus, although E2DBD

leaves circular pAT153b DNA fairly rapidly, E2DBD

leaves a short DNA fragment (516 bp) at a muchincreased rate. These data demonstrate that theescape of E2 from non-speci®c DNA cannot bedescribed by a simple ®rst-order reaction and thusthe rate of appearance of the speci®c complexre¯ects an apparent (rather than actual) dis-sociation rate.

Interestingly, the data in Table 2 also show thatthe complexes formed between E2DBD and shortnon-speci®c oligonucleotides are much more stablethan the complexes formed between E2DBD andlong non-speci®c DNAs. This suggests that thenon-speci®c complexes formed between E2DBD andlong DNA molecules are qualitatively differentfrom the non-speci®c complexes formed betweenE2DBD and short oligonucleotides. These datamight help to explain why magnesium ions appearto have no effect on the binding of E2DBD to shortnon-speci®c oligonucleotides (see Figure 2(b)) but adramatic effect on the stability of some E2DBD-non-speci®c DNA complexes (Figure 3(b)).

The apparent dissociation rate of specific E2-DNA complexes

The experiments described in the previous sec-tion suggest that magnesium ions affect the inter-action between E2 and long non-speci®c DNAmolecules. To con®rm and extend this conclusion,we next looked at the apparent dissociation rate ofspeci®c E2-DNA complexes in both the absenceand presence of magnesium ions. In order to dothis, E2DBD was ®rst incubated with labelled oligo-nucleotides carrying E2(1) to form speci®c com-plexes. The speci®c complexes were thenchallenged by the addition of an excess of non-speci®c DNA (the plasmid pAT153b). At timepoints after the addition of non-speci®c DNA,

Table 2. The dissociation of E2DBD-non-speci®c DNAcomplexes in the presence of magnesium ions

Non-specific DNA speciesApparent dissociation rate

(�10ÿ2 sÿ1)

Circular pAT153b 7.0 � 1.2Linear pAT153b (3666 bp) 5.0 � 0.41535 bp linear fragment 4.8 � 0.7516 bp linear fragment 3.1 � 0.420 bp linear fragment 14.0 � 5.8

aliquots of the mixture were removed and loadedonto a running non-denaturing polyacrylamidegel. Figure 4(a) and (b) show a schematic of thisexperiment and a graphical representation of theresults, respectively. In the absence of magnesiumions the speci®c E2-DNA complexes appear to dis-sociate with a half-life of over two hours. In con-trast, in the presence of magnesium the speci®ccomplexes dissociate with a half-life of around45 minutes. This effect of magnesium ions couldnot be eliminated by increasing the ionic strengthof the binding reaction; increasing the KCl concen-tration to 100 mM decreased the half-life of thespeci®c complexes to around one hour in theabsence of magnesium ions and around three min-utes in the presence of magnesium ions(Figure 4(c)). Although the data seem to imply thatE2DBD binds to speci®c DNA sequences less tightlyin the presence of magnesium ions, the exper-iments shown in Figure 2(a) indicate that this isunlikely to be the case. Instead, the difference inthe apparent stability of the speci®c complexes inthe absence and presence of magnesium ions mustbe due to the effects of these ions on non-speci®cbinding to the competitor DNA. These datasuggest that non-speci®c DNA actively removesE2DBD from speci®c sites and that the rate of thisfacilitated transfer is increased by magnesium ions.This would also explain why the apparentdissociation rate of non-speci®cally bound E2varies depending on the exact nature of thenon-speci®c DNA (as shown in Table 2) and whymagnesium ions dramatically reduce the half-lifeof non-speci®c complexes (as seen in Figure 3).

The binding of E2 to long fragments of non-specific DNA

All of the experiments described above wouldseem to indicate that magnesium ions alter thenature of the non-speci®c E2-DNA complex. Toexamine the non-speci®c binding of E2DBD to longDNA molecules in more detail, we labelled a194 bp DNA fragment obtained by restrictiondigestion of pAT153b. Increasing amounts of theE2DBD were incubated with this labelled non-speci®c DNA fragment in either the absence or pre-sence of magnesium ions. After 20 minutes at20 �C, free and non-speci®cally bound labelledDNA were separated by polyacrylamide gel elec-trophoresis, visualised by autoradiography, andquanti®ed using a PhosphorImager. In both theabsence and presence of magnesium ions, theaddition of increasing amounts of E2DBD results inthe formation of multiple protein-DNA complexes(shown in Figure 5(a)). At low protein concen-trations, a single retarded species is formed(Figure 5(a), lanes 2 and 11), whereas at higherprotein concentrations, up to nine distinct com-plexes can be visualised (Figure 5(a), lanes 5 and13). The simplest explanation for this result is thatmultiple E2DBD dimers bind to the non-speci®cDNA fragment resulting in the formation of mul-

Figure 4. Magnesium ions appear to de-stabilisespeci®c E2-DNA complexes. (a) A schematic represen-tation of the experiment. E2DBD (26 nM) was incubatedwith labelled E2(1) for 20 minutes at 20 �C. An excess ofunlabelled non-speci®c plasmid DNA (150 mg ofpAT153b) was then added and at time intervals begin-ning at t � 0 aliquots of the mixture were removed andloaded onto a running non-denaturing 5 % polyacryl-amide gel. (b) The graph shows the apparent dis-sociation of E2DBD-E2(1) speci®c DNA complexes in theabsence (®lled circles) or presence (open circles) of5 mM MgCl2. The percentage of E(1) bound ([boundlabelled DNA/(bound labelled DNA � free labelledDNA)] � 100) is plotted against time after the additionof the unlabelled competitor DNA. The data are themean and standard deviation from three separate exper-iments. When error bars cannot be seen they are smallerthan the symbols. (c) The experiment shown in (b) wasrepeated with 100 mM KCl in the binding buffer.

Figure 5. The binding of E2 to a 194 bp non-speci®cDNA fragment. (a) Increasing concentrations of E2DBD

(10, 20, 30, 40, 50, 60, 70, and 80 nM) were incubatedwith a labelled 194 bp non-speci®c DNA fragment inthe absence or presence of 5 mM MgCl2 (lanes 2-9 andlanes 11-18, respectively). After 20 minutes at 20 �C, freeand bound DNA were separated on a 5 % polyacryl-amide gel and visualised by autoradiography. (b) Thegraph shows the total amount of labelled non-speci®cDNA bound to E2DBD in the absence (®lled circles) andpresence (open circles) of 5 mM MgCl2. The percentageof labelled DNA bound ([bound DNA/(bound DNA �free DNA)] � 100) is plotted against the concentration ofE2DBD. Mean and standard deviation from ®ve separateexperiments. When error bars cannot be seen they aresmaller than the symbols.


tiple complexes with between one and nine boundproteins. This suggests that each non-speci®callybound dimer of E2DBD occupies about 22 bp ofDNA. Interestingly, this is the length of the DNaseI footprint formed when E2 binds to a speci®c site


(Moskaluk & Bastia, 1988). At high protein concen-trations a single retarded complex is formed andsigni®cant levels of labelled DNA are retained inthe wells of the gel (Figure 5(b)). However, since atthese protein concentrations we see no aggregationwhen E2 binds to speci®c DNA sequences(Figure 1(a)), the material in the wells probablycomprises sandwich complexes in which morethan one molecule of DNA is bound non-speci®-cally to multiple interacting E2 proteins.

In both the absence and presence of magnesium,the bound species changes from a complex with asingle E2DBD dimer bound to a completely satu-rated complex containing approximately nineE2DBD dimers over a fairly narrow range of E2DBD

concentrations (50 nM to 60 nM E2DBD minusmagnesium ions and 30 nM to 40 nM E2DBD plusmagnesium ions, respectively). This rapid changein occupancy suggests that the binding of E2DBD tonon-speci®c DNA is cooperative. This is illustratedgraphically in Figure 5(b) where the total boundDNA has been plotted against E2 concentration.As can be seen from the data in Figure 5, mag-nesium ions have a small stimulatory effect on thetotal sum of binding of E2DBD to non-speci®c DNA.Similar results were obtained when increasingamount of E2DBD were incubated with a labelled120 bp non-speci®c DNA fragment. However, inthis case only ®ve dimers of E2DBD bound to thenon-speci®c DNA (data not shown). Note that thelong half-life of the non-speci®c complexes formedin the absence of magnesium ions means that thesebinding reactions could not have reached trueequilibrium after 20 minutes.

The binding of E2 to speci®c DNA sequenceshas been shown to induce a signi®cant bend in theDNA. Bent DNA fragments migrate more slowlythrough non-denaturing polyacrylamide gels thando straight DNA fragments of the same size. Sincethe migration rate of a DNA fragment is deter-mined by the end-to-end distance rather than thecontour length of the DNA, the precise location ofthe bend within the DNA fragment determines theextent to which its migration is retarded (Liu-Johnson et al., 1986). Thus, a bend in the middle ofa long DNA fragment produces a molecule thatmigrates more slowly than a fragment of the samesize which contains a bend of the same angle nearone end. By de®nition, non-speci®c DNA bindingoccurs at random positions along a DNA fragment.If non-speci®cally bound E2DBD induced the for-mation of a signi®cant DNA bend, the non-speci®cbinding of one dimer of E2DBD would be expectedto result in the formation of a random collection ofDNA conformations, each with a different electro-phoretic mobility. Similarly, if there were a hierar-chy of non-speci®c sites (or, more accuratelyperhaps, pseudo-speci®c sites), any DNA bendingin the non-speci®c/pseudo-speci®c complexeswould result in the formation of a series of irregu-larly spaced bands; the binding of each new E2protein would result in a complex with either fas-ter or slower mobility depending on the phasing of

the bend angles (see for comparison Zinkel &Crothers, 1987). Figure 5(a) shows that the non-speci®c binding of one dimer of E2DBD actuallyresults in the formation of a single retarded bandand that the binding of subsequent dimers ofE2DBD results in the formation of regularly spaceddiscrete bands. These data strongly suggest thatthe DNA in the E2DBD-non-speci®c DNA complexis not bent.

Discussion

In principle, a protein such as E2 could pick outits speci®c binding sites by simple diffusion inthree dimensions. Two facts suggest that this is notthe case: ®rst, the concentration of speci®c bindingsites is low, and second, the speci®c binding sitesare buried within a mass of non-speci®c sites. Inorder to reach speci®c sites quickly, a two-step pro-cess is required; initial non-speci®c binding fol-lowed by transfer of the protein from one site toanother by one-dimensional diffusion (reviewed byVon Hippel & Berg, 1989). Here, we have shownthat magnesium ions greatly increase the bindingof E2 to speci®c DNA sequences but only in thepresence of excess non-speci®c DNA. Divalent cat-ions have previously been shown to enhance thesequence-speci®c DNA binding activity of severalproteins. For example, magnesium ions enhancesequence-speci®c DNA binding by the phage T7RNA polymerase (Ujvari & Martin, 1997). How-ever, in the case of E2, the enhancement of speci®cbinding does not result from a direct effect of mag-nesium ions on the binding of the protein to its tar-get site.

Since magnesium ions have no effect on theinteraction of E2 with speci®c DNA (shown inFigure 2(a)), the overall enhancement of speci®cDNA binding brought about by these ions couldbe due to a decrease in the af®nity of this proteinfor non-speci®c DNA. However, we have shownthat magnesium ions also have no effect on thebinding of E2 to short fragments of non-speci®cDNA. Several DNA-binding proteins, includingEscherichia coli RNA polymerase, bind preferen-tially to the ends of DNA fragments. To avoid thiscomplication we looked at the binding of E2 tolong molecules of non-speci®c DNA. Surprisingly,magnesium ions brought about a slight increase inthe binding of E2 to a 194 bp non-speci®c DNAfragment. In contrast, the presence of magnesiumions dramatically increases the apparent dis-sociation rate of non-speci®c E2-DNA complexes.The apparent dissociation rate determined in theseexperiments varies depending on the exact natureof the non-speci®c DNA. This suggests that thenon-speci®c DNA plays an active role in the dis-sociation process; facilitating the transfer of non-speci®cally bound E2 dimers. Since magnesiumions do not seem to decrease the binding of E2 tonon-speci®c DNA, the simplest explanation for theincrease in binding to speci®c sites seen in the pre-


sence of non-speci®c DNA, is that these ionsincrease the rate at which E2 is transferred fromnon-speci®c sites to speci®c sites (or to other non-speci®c sites). This model is shown schematicallyin Figure 6. Thus, in binding reactions containingboth non-speci®c and speci®c DNA, E2 initiallybinds more-or-less equally to both DNAs. How-ever, in the presence of magnesium ions E2 israpidly transferred from non-speci®c to speci®cDNA. This model explains the lack of an effect ofmagnesium ions on the binding of E2 to speci®cDNA sequences in the absence of non-speci®cDNA and the dramatic effect these ions have onthe apparent stability of E2-non-speci®c DNA com-plexes.

The transfer of DNA-binding proteins from onesite to another can occur via a variety of mechan-isms: sliding or linear diffusion, cycles of dis-sociation and re-association to nearby DNAsequences on the same DNA molecule (also knownas hopping), or direct transfer (Von Hippel & Berg,1989). Tetrameric DNA binding proteins, such asthe Lac repressor or the restriction endonucleaseS®I, can probably be directly transferred from onenon-speci®c site to another via transient inter-actions of their DNA-binding domains with twodistant DNA sequences (Fickert & MuÈ ller-Hill,1992; Wentzell & Halford, 1998). However, likemany transcription factors, the E2 protein isdimeric and therefore has only one DNA-bindingdomain. How then can non-speci®c DNA facilitatethe transfer of E2 from one DNA to another orbetween distant sites on the same DNA molecule ?One possibility is that protein-protein interactionscould facilitate the transfer. In keeping with thisview we have shown that the binding of E2 tonon-speci®c DNA is cooperative. Transientprotein-protein interactions between these non-

Figure 6. A schematic summary of the main con-clusions from this work. Dimers of E2 are representedby ®lled circles, speci®c E2 binding sites are representedby ®lled boxes, and non-speci®c DNA is represented bythe thin line. In the absence of magnesium ions, E2binds tightly and cooperatively to non-speci®c sites andis transferred to speci®c sites very slowly. In the pre-sence of magnesium ions, E2 binds tightly and coopera-tively to non-speci®c DNA but the transfer of E2 tospeci®c sites is rapid. The lengths of the arrows rep-resent the rate of transfer of E2.

speci®cally bound E2 dimers might increase therate at which E2 locates its speci®c sites. Mag-nesium ions might in¯uence the cooperativity ofnon-speci®c binding and this could result in anincrease in the rate at which E2 is transferred tospeci®c sites. E2 has been shown to interact with anumber of DNA-binding proteins including thetranscription factor Sp1 (Li et al., 1991). Althoughthese protein-protein interactions are undoubtedlyimportant for transcriptional regulation, they couldalso facilitate the transfer of E2 from non-speci®cbinding sites to speci®c binding sites. Since mosttranscription factors make protein-protein inter-actions with other DNA-binding proteins, this pro-tein-mediated facilitated transfer might be animportant mechanism in the targeting of these pro-teins to their speci®c target sites. Protein-proteininteractions between speci®cally bound transcrip-tion factors are thought to result in an increase inthe local concentration of each protein near itspartner's binding site (reviewed by Rippe et al.,1995). Protein-mediated facilitated transfer wouldresult in a similar increase in the local concen-tration of the non-speci®cally bound transcriptionfactor near the binding site of the speci®callybound partner. This could target non-speci®callybound transcription factors to enhancer and pro-moter sequences that typically contain complexarrays of transcription factor binding sites.

The binding of E2 to a speci®c site induces theformation of a DNA bend of approximately 60 �(Moskaluk & Bastia, 1988; Thain et al., 1997). Incontrast, we have shown that the binding of E2 tonon-speci®c DNA does not result in signi®cantDNA bending. Several other DNA-binding pro-teins appear to induce changes in DNA bendingduring the formation of speci®c complexes. Forexample, the restriction enzyme EcoRV has alsobeen shown to induce a signi®cant DNA bendwhen bound at a speci®c site, but not when boundat non-speci®c sites (Winkler et al., 1993). Similarly,the trp repressor induces DNA bending when itbinds speci®cally at the trp operator but not whenit binds non-speci®cally to the same DNA sequence(Zhang et al., 1994). Although these changes inDNA conformation certainly allow the formationof additional protein-DNA contacts and therebystabilise DNA binding, there is considerable evi-dence to suggest that these changes might them-selves play important biological roles. For example,DNA bending induced by the transcription factorE2F is thought to be important for the transcrip-tional activity of the E2F1 promoter (Cress &Nevins, 1996). In a comparable example, the bind-ing of EBNA1 to the Epstein-Barr virus latent ori-gin of replication induces a change in DNAstructure that might be required for DNA replica-tion (Bochkarev et al., 1998). Thus the change inDNA conformation brought about by the speci®cbinding of E2 to its recognition sites probablyplays an important role in the regulation of HPVgene expression and/or DNA replication.

E2(1) 50 TTGAACCGAAACCGGTTAGT 3030 AACTTGGCTTTGGCCAATCA 50

YY1 50 CTAGACCGCCGCCATCGCACCCGGCC 3030 TGGCGGCGGTAGCGTGGGCCGGAGCT 50

Sp1 50 AGTCCCAACCAGAGCCCCAACCCCGGCTCC 3030 TCAGGGTTGGTCTCGGGGTTGGGGCCGAGG 50


In conclusion, we have shown that the HPV 16E2 protein binds tightly to non-speci®c DNAsequences and that this binding does not induce achange in DNA conformation. Non-speci®callybound E2 protein then transfers to speci®c sites,probably via a mechanism that involves both directtransfer and sliding. Once a speci®c site has beenlocated signi®cant changes occur in both DNA andprotein conformation and these changes mediateDNA recognition. Although magnesium ions havelittle or no effect on the binding of E2 to speci®csites, these ions dramatically enhance the rate atwhich E2 locates these sequences. Since DNA isassociated with a high local concentration of mag-nesium ions in vivo, our data help to explain howthe E2 protein regulates HPV 16 gene expressionand DNA replication in living cells.

Materials and Methods

Protein used in this study

E2DBD corresponds to the C-terminal 86 amino acidresidues of the HPV16 E2 protein and was preparedby S. Billet. The E2DBD protein was expressed inE. coli XL1-blue cells using the vector pKK-E2DBD

(Webster et al., 1999) and puri®ed as follows: E. coliXL1-blue cells containing pKK-E2DBD were grown toan A600 nm of 0.5 and then protein expression wasinduced by adding 1 mM IPTG. After incubation at37 �C overnight, the cells were harvested by centrifu-gation, resuspended in 50 mM Tris-acetate-EDTAbuffer (pH 7.5) containing 1 mM MgCl2 and 1 % (v/v)2-mercaptoethanol, and then lysed by sonicationat 4 �C. The lysate was cleared by centrifugation(15,000 g for 30 minutes at 4 �C) and then incubatedwith 0.1 % DNase I for 30 minutes at 20 �C. Afterdialysis for three hours against 50 mM phosphate buf-fer (pH 5.7) containing 1 % 2-mercaptoethanol, the cellextract was re-centrifuged and the supernatant loadedonto an S-Sepharose column equilibrated in 50 mMphosphate buffer (pH 5.7) containing 10 mM DTT.After washing with 50 column volumes of phosphatebuffer, E2DBD was eluted using a linear gradient of0.2 M-1 M NaCl in the same buffer. Pooled E2DBD

fractions were dialysed against ten volumes of 50 mMphosphate buffer (pH 5.7) containing 10 mM DTT forthree hours and then applied to a MonoS HR 16/10cation exchange FPLC column equilibrated in thesame buffer. E2DBD was eluted with a 0.1 M-1 M NaClgradient, dialysed against 25 mM sodium phosphatebuffer (pH 7.9) containing 1 mM DTT for three hours,and then snap frozen and stored at ÿ70 �C. Molecularmass was con®rmed on a VG Quattro triple quadru-pole mass spectrophotometer with electrosprayionization. Far-UV and near-UV circular dichro-ism spectroscopy on a Jobin Yvon CD6 spectro-polarimeter (0.05 cm path-length with 0.5 nm resol-ution at 1 nm/minute) con®rmed that the proteinwas folded and dimerised. The activity of the puri®edprotein was determined by comparison to previouslyprepared samples using gel retardation assays.

DNAs used in this study

The sequences of the oligonucleotides used in thiswork are shown below:

E2(1) correspond to the promoter proximal E2 bindingsite from the HPV 16 genome (nucleotides 46 to 65). YY1and Sp1 correspond to the YY1 and Sp1 binding sitesfrom the human Surf-1/Surf-2 bidirectional promoter:nucleotides �27 to �6 and ÿ46 to ÿ75 relative to themajor Surf-1 transcription start site, respectively (Cole &Gaston, 1997). Single-stranded oligonucleotides (100 ng)were 50 end-labelled with [g-32P]ATP using phage T4polynucleotide kinase in 50 mM Tris (pH 7.6), 10 mMMgCl2, 5 mM DTT, 0.1 mM spermidine HCl, and0.1 mM EDTA. Complementary oligonucleotides wereannealed in the same buffer by heating to 90 �C for oneminute and then cooling to 20 �C over 20 minutes. Unin-corporated label was removed using Sephadex G50 col-umns (Stratagene).

Unless otherwise stated, the non-speci®c competitorDNA used in these experiments was a derivative of theplasmid pAT153 (Twigg & Sherratt, 1980) that containsan 8 bp BglII linker inserted at the EcoRV site; pAT153b(Taylor & Halford, 1989). Linearised pAT153b (3666 bp)and shorter non-speci®c DNA fragments were obtainedby restriction digestion of this plasmid. The 194 bp non-speci®c DNA fragment used in gel retardation assayswas excised from pAT153b by digestion with BamHI andBglII. This fragment was puri®ed from a 2 % agarose gelby electroelution, dephosphorylated using calf alkalinephosphatase, and then 50 end-labelled with [g-32P]ATP asdescribed above.

Gel retardation assays

Labelled oligonucleotides (20,000cpm) were incubatedwith puri®ed E2DBD (in the quantities indicated in theFigures) in 20 mM Hepes (pH 7.9), 25 mM KCl, 1 mMdithiothreitol, 0.1 % (v/v) Nonidet P40, 10 % (v/v) gly-cerol, and 0.5 mg/ml bovine serum albumin. Non-speci®ccompetitor (80 ng/ml poly(dI.dC)(dI.dC)) was added tosome reactions. After 20 minutes at 20 �C the complexeswere resolved on non-denaturing 5 % polyacrylamidegels run in 1 � TBE. Free and bound labelled DNA wasvisualised by autoradiography and quanti®ed using aPhosphorImager and Molecular Dynamics ImageQuantsoftware (version 3.3). The apparent equilibrium con-stant, Keq(apparent)

, was obtained using the equation:

�boundDNA� � �maximum boundDNA�� protein�=�protein� � Keq�apparent�

When [DNA]5Keq, the apparent equilibrium constant isequal to the protein concentration at half maximumDNA binding.

The dissociation of E2DBD from non-speci®c DNAsequences was followed by adding labelled E(1) to pre-formed E2DBD-non-speci®c DNA complexes andtaking aliquots at various times for non-denaturing gelelectrophoresis. Non-speci®c DNA was incubated withE2DBD for 20 minutes at 20 �C. A sample of this mixturewas then removed and loaded onto a running non-


denaturing 5 % polyacrylamide gel. Labelled E2(1) wasthen added to the mixture and aliquots removed at timeintervals beginning at t � 0 for analysis on the same gel.

The dissociation of E2DBD from speci®c DNAsequences was followed by adding excess unlabelledDNA to pre-formed E2DBD-DNA complexes and takingaliquots at various times for electrophoresis. LabelledDNA was incubated with E2DBD for 20 minutes at 20 �C.A sample of this mixture was then removed and loadedonto a running non-denaturing 5 % polyacrylamide gel.An excess of unlabelled non-speci®c DNA was thenadded and aliquots removed at time intervals beginningat t � 0 and loaded on the same gel.

Acknowledgements

We are grateful to Professor Steve Halford, ProfessorTony Clarke, and Dr Nigel Savery for some useful dis-cussions and for comments on the manuscript. H.L. isgrateful to the UK Medical Research Council for a PhDStudentship.

References

Bochkarev, A., Barwell, J. A., Pfuetzner, R. A., Furey,W., Jr, Edwards, A. M. & Frappier, L. (1995). Crys-tal structure of the DNA-binding domain of theEpstein-Barr virus origin-binding protein EBNA1.Cell, 83, 39-46.

Bochkarev, A., Barwell, J. A., Pfuetzner, R. A.,Bochkareva, E., Frappier, L. & Edwards, A. M.(1996). Crystal structure of the DNA-bindingdomain of the Epstein-Barr virus origin-bindingprotein, EBNA1, bound to DNA. Cell, 84, 791-800.

Bochkarev, A., Bochkareva, E., Frappier, L. & Edwards,A. M. (1998). The 2.2 AÊ structure of a permanga-nate-sensitive DNA site bound by the Epstein-Barrvirus origin binding protein, EBNA1. J. Mol. Biol.284, 1273-1278.

Cole, E. G. & Gaston, K. (1997). A functional YY1 bind-ing site is necessary and suf®cient to activate Surf-1promoter activity in response to serum growth fac-tors. Nucl. Acids Res. 25, 3705-3711.

Cress, W. D. & Nevins, J. R. (1996). A role for a bentDNA structure in E2F-mediated transcription acti-vation. Mol. Cell. Biol. 16, 2119-2127.

Fickert, R. & MuÈ ller-Hill, B. (1992). How Lac repressor®nds lac operator in vitro. J. Mol. Biol. 226, 59-68.

Frattini, M. G. & Laimins, L. A. (1994). Binding of thehuman papillomavirus E1 origin-recognition proteinis regulated through complex formation with the E2enhancer-binding protein. Proc. Natl Acad. Sci. USA,91, 12398-12402.

Fried, M. G. & Crothers, D. M. (1984). Kinetics andmechanism in the reaction of gene regulatory pro-teins with DNA. J. Mol. Biol. 172, 263-282.

Giri, I. & Yaniv, M. (1988). Structural and mutationalanalysis of E2 trans-activating proteins of papillo-maviruses reveals three distinct functional domains.EMBO J. 7, 2823-2829.

Hegde, R. S. & Androphy, E. J. (1998). Crystal structureof the E2 DNA-binding domain from human papil-lomavirus type 16: Implications for its DNA bind-ing-site selection mechanism. J. Mol. Biol. 284, 1479-1489.

Hegde, R. S., Grossman, S. R., Laimins, L. A. & Sigler,P. B. (1992). Crystal structure at 1.7 AÊ of the bovinepapillomavirus-1 E2 DNA-binding domain boundto its DNA. Nature, 359, 505-512.

Hegde, R. S., Wang, A.-F., Kim, S.-S. & Schapira, M.(1998). Subunit rearrangement accompaniessequence-speci®c DNA binding by the bovine papil-lomavirus-1 E2 protein. J. Mol. Biol. 276, 797-808.

Knight, J. D., Li, R. & Botchan, M. (1991). The activationdomain of the bovine papillomavirus E2 proteinmediates association of DNA-bound dimers to formDNA loops. Proc. Natl Acad. Sci. USA, 88, 3204-3208.

Li, R., Knight, J. D., Jackson, S. P., Tjian, R. & Botchan,M. R. (1991). Direct interaction between Sp1 andthe BPV enhancer E2 protein mediates synergisticactivation of transcription. Cell, 65, 493-505.

Liu-Johnson, H.-N., Gartenberg, M. R. & Crothers, D. M.(1986). The DNA binding domain and bendingangle of E. coli CAP protein. Cell, 47, 995-1005.

Mok, Y.-K., De Prat, Gay G., Butler, P. J. & Bycroft, M.(1996). Equilibrium dissociation and unfolding ofthe dimeric human papillomavirus strain-16 E2DNA-binding domain. Protein Sci. 5, 310-319.

Monini, P., Grossman, S. R., Pepinsky, B., Androphy,E. J. & Laimins, L. A. (1991). Cooperative bindingof the E2 protein of bovine papillomavirus to adja-cent E2-responsive sequences. J. Virol. 65, 2124-2130.

Moskaluk, C. & Bastia, D. (1988). DNA bending isinduced in an enhancer by the DNA-bindingdomain of the bovine papillomavirus E2 protein.Proc. Natl Acad. Sci. USA, 85, 1826-1830.

O'Connor, M. J., Tan, S.-H., Tan, C.-H. & Bernard, H.-U.(1996). YY1 represses human papillomavirus type16 transcription by quenching AP-1 activity. J. Virol.70, 6529-6539.

Rank, N. M. & Lambert, P. F. (1995). Bovine papilloma-virus type 1 E2 transcriptional regulators directlybind two cellular transcription factors, TFIID andTFIIB. J. Virol. 69, 6323-6334.

Rippe, K., Von Hippel, P. H. & Langowski, J. (1995).Action at a distance: DNA-looping and initiation oftranscription. Trends Biochem. Sci. 20, 500-506.

Rozenberg, H., Rabinovich, D., Frolow, F., Hegde, R. S.& Shakked, Z. (1998). Structural code for DNA rec-ognition revealed in crystal structures of papilloma-virus E2-DNA targets. Proc. Natl Acad. Sci. USA, 95,15194-15199.

Sanders, C. M. & Maitland, N. J. (1994). Kinetic andequilibrium binding studies of the human papillo-mavirus type-16 transcription regulatory protein E2interacting with core enhancer elements. Nucl. AcidsRes. 22, 4890-4897.

Smotkin, D. & Wettstein, F. O. (1986). Transcription ofhuman papillomavirus type 16 early genes in a cer-vical cancer and a cancer-derived cell line andidenti®cation of the E7 protein. Proc. Natl Acad. Sci.USA, 83, 4680-4684.

Spalholz, B. A., Byrne, J. C. & Howley, P. M. (1988). Evi-dence for cooperativity between E2 binding sites inE2 trans-regulation of bovine papillomavirus type1. J. Virol. 62, 3143-3150.

Steger, G., Ham, J., Lefebvre, O. & Yaniv, M. (1995). Thebovine papillomavirus 1 E2 protein contains twoactivation domains: One that interacts with TBPand another that functions after TBP binding.EMBO J. 14, 329-340.


Taylor, J. D. & Halford, S. E. (1989). Discriminationbetween DNA sequences by the EcoRV restrictionendonuclease. Biochemistry, 28, 6198-6207.

Thain, A., Webster, K., Emery, D., Clarke, A. R. &Gaston, K. (1997). DNA binding and bending bythe human papillomavirus type 16 E2 protein: rec-ognition of an extended binding site. J. Biol. Chem.272, 8236-8242.

Thierry, F. (1996). HPV proteins in the control of HPVtranscription. In Papillomavirus Reviews: CurrentResearch on Papillomaviruses (Lacey, C., ed.), pp. 21-29, Leeds University Press, Leeds.

Twigg, A. J. & Sherratt, D. (1980). Trans-complementa-ble copy-number mutants of plasmid ColE1. Nature,283, 216-218.

Ujvari, A. & Martin, C. T. (1997). Identi®cation of aminimal binding element within the T7 RNA poly-merase promoter. J. Mol. Biol. 273, 775-781.

van Ranst, M., Tachezy, R. & Burk, R. D. (1996). Humanpapillomaviruses: a neverending story? In Papilloma-virus Reviews: Current Research on Papillomaviruses(Lacey, C., ed.), pp. 1-19, Leeds University Press,Leeds.

Von Hippel, P. H. & Berg, O. G. (1989). Facilitated tar-get location in biological systems. J. Biol. Chem. 264,675-678.

Webster, K., Parish, J., Pandya, M., Stern, P. L., Clarke,A. R. & Gaston, K. (1999). The HPV 16 E2 proteininduces apoptosis in the absence of other HPV pro-teins and via a p53-dependent pathway, J. Biol.Chem. In the press.

Wentzell, L. M. & Halford, S. E. (1998). DNA loopingby the S®I restriction endonuclease. J. Mol. Biol. 281,433-444.

Winkler, F. K., Banner, D. W., Oefner, C., Tsernoglou,D., Brown, R. S., Heathman, S. P., Bryan, R. K.,Martin, P. D., Petratos, K. & Wilson, K. S. (1993).The crystal structure of EcoRV endonuclease and ofits complexes with cognate and non-cognate DNAfragments. EMBO J. 12, 1781-1795.

Zhang, H., Zhao, D., Revington, M., Lee, W., Jia, X.,Arrowsmith, C. & Jardetzky, O. (1994). The solutionstructures of the trp repressor-operator DNA com-plex. J. Mol. Biol. 238, 592-614.

Zinkel, S. S. & Crothers, D. M. (1987). DNA bend direc-tion by phase sensitive detection. Nature, 328, 178-181.

zur Hausen, H. (1991). Human papillomaviruses in thepathogenesis of anogenital cancer. Virology, 184, 9-13.

Edited by M. Yaniv

(Received 18 May 1999; received in revised form 7 October 1999; accepted 15 October 1999)

Magnesium ions enhance the transfer of human papillomavirus E2 protein from non-specific to specific...

Documents

Transcript of Magnesium ions enhance the transfer of human papillomavirus E2 protein from non-specific to specific...