Lipase: protein that hydrolyses lipids

Polymerase: protein that builds polymers

Ligase: protein that ligates DNA fragments

Proteinase or protease: protein that hydrolyses proteins

DNase: protein that hydrolyses DNA

RNase: protein that hydrolyses RNA

Naming enzymes

Quiz 1 closes tomorrow morning 9 am

Tomorrow 4 pm in T4 Prac room: safety and lab induction by Vance Lawrence

Basic methods

PCR and mutation

Lecture 4

Adapted from David Tscharke @ RSB

Lecture overview

Hybridisation

-Melting temperature

Cutting DNA

-Restriction endonucleases

Polymer chain reaction (PCR)

-hybridisation

-DNA amplification

-mutation

Watson and Crick

Nucleic acid base-pairing relies on hydrogen bonds being stronger than the repulsive force of the –ve charge on the backbones

Base pairing is reversable

DenaturationMelting

HybridisationAnnealing

Renaturation

Manipulating base pairing

Low saltHigh tempHigh pH

Low ‘G+C’

High saltLow temp

High ‘G+C’

Hybridisation jargon I

Tm: temperature at which hybrids are 50% melted-Equilibrium point between melting and annealing

Hybridisation jargon II

Stringency: ease at which hybrids form-Stringent conditions favour fidelity

Tm is used to standardize stringency

There are two rules to work out Tm

-one for short lengths of DNA-one for longer (> 30 bp) lengths

Coming to a tute near you soon!

Primer design

Calculating Tm (in oC)

For fragments > 30 bp• DNA-DNA hybrids:

– Tm = 16.6log[Na+] + 0.41(%G+C) + 81.5

• RNA-RNA hybrids:

– Tm = 79.8 + 18.5log[Na+] - 0.584(%G+C) + 11.8(%G+C)2

• DNA-RNA– The average of DNA-DNA and RNA-RNA

For short DNA (oligonucleotides)• Rule of thumb: 4 (# of C or G) + 2 (# of A or T)

– Assumes physiological salt (0.9% NaCl or ~100 mM)

Stringency and fidelity

mismatches tolerated hi-fidelity

DNA sequence(A)

Non-stringent (Tm – 30 ºC) Stringent (Tm – 15 ºC)

Alberts

temperature

rises

DNA sequences(A – F)

The key is to bias the outcome

If you want highly stringent hybridisation- keep temperature high- in some applications can use lower salt- in some applications can add formamide- can sometimes choose sequence

If you want ‘sloppy’ hybridisation- use lower temperature

PCR

Revolutionized molecular biology

PCR is a polymerase-based method

Polymerases need?

DNApol

3’ 5’

5’ 3’

- Primers

- dNTPs (dATP, dCTP, dGTP, dTTP)

- The right buffer / temperature conditions

Same goes for PCR

Both strands of DNA are copied in PCR

5’ 3’

3’ 5’

+ 2 primers+ polymerase+ dNTPs

3’ 5’

5’ 3’

Denature

The copying is repeated…Old and new DNA strands can be templates

Denature Primers, pol, dNTPs all still there!

original template

original template

orig.

orig.

The primers define the length of the copies made from the new templates

PCR is a dance with 3 steps

Time (min)

Temperature(ºC)

1 2 3 4 5 6 7

50

60

70

80

90

100

Adapted Brown 9.6

Annealing

Denaturation

Extension

What kind of enzyme works at 72 oC?In the beginning, PCR used Klenow subunit-C-terminal part of E. coli Pol I-Not heat stable-DNA synthesis done at 37 oC-More had to be added in every cycle

The breakthrough came from Thermus aquaticus-Likes it hot-Has a polymerase that works best at 72 oC = Taq-Allowed automation of PCR-Higher stringency for primer binding-Taq named ‘molecule of the year’ in 1989 by Science

Theory versus realityDNA amplification by PCR is not exponential-Approaches exponential for first ~20 cycles

Number of cycles0 10 20 30 40

Amount ofPCR

product

Limitations to amplificationLimitation of primer or nucleotides-Amount of primers and nucleotides in the reaction mix can become exhausted

Lifetime of the polymerase-Even Taq doesn’t like 94 oC for too long

Competition between template and primer-Newly synthesised DNA strands compete with the primers for annealing to the DNA for use as template

Limitations associated with TaqOnly good for relatively short stretches-Error rate is about 1 in 9,000 nucleotides-5 kb is about the limit for Taq

PCR products have errors-Errors made in early cycles are multiplied-1 in every 300 bp by the end of 30 cycles

Both problems arise because Taq lacks ‘proof-reading’ ability-3’ → 5’ exonuclease activity to remove misincorporated bases-Some errors cause Taq to stall

Alternatives to TaqA variety of thermostable polymerases that have proof-reading ability have been found-Essential if fidelity of sequence is important

Taq remains the most commonly used polymerase for PCR-Cheap, robust

Vent is a polymerase with 3’→5’ proof-reading -Similar cost as Taq but 10-fold higher fidelity

Phusion is a polymerase with 3’→5’ proof-reading-50-fold lower error rate than Taq-Can amplify 10 kb plasmids reliably-3 times more expensive than Taq

Controls for PCRPCR turns a few copies into hundreds of millions

Any error made in the beginning is also amplified

Contamination of product into reagents is a hazard-A big issue in diagnostic and forensic applications-Separate rooms can be used for DNA extraction, reaction preparation and analysis of products-Be skeptical of PCR-based claims

A ‘water’ control is essential if you are claiming detection of a DNA sequence by PCR

For preparative PCR, contamination is less of an issue-e.g. just making more of a particular DNA sequence

Parameters that affect PCR

Primers and annealing temperature most important

Easy when starting from plasmid rather than genomic DNA

EVERYTHING!

Choosing the right parameters

Too short = lack of specificity-A given 8-mer appears ~46,000 times / genome by chance

Too long = annealing temperature becomes too high-Also… longer primers are more likely to have errors-…and you’ll go broke (oligos are charged by the bp)

17 – 25 bp is usually good

Want Tm to be around 55 – 65 oC-Tm more important than G+C content

- Choose closer to 50% G+C if you have the choice- 3’-end should be a G or C if possible

Avoid runs (AAAAA or CCCC) and self-complementarity

Choosing the right primer pair

Naming is with respect to the sequence of the TOP strand-Primers (like all DNA) written 5’ → 3’-Sense primer will have the same sequence as the top strand-Anti-sense primer will be the complement of the top strand

Match Tm

-Compensate for GC differences by changing lengths

Avoid pairs that bind to each other

5’

3’

3’

5’

Sense, 5’ or forward primerBinds to the BOTTOM strand

Anti-sense, 3’ or reverse primerBinds to the TOP strand

Choosing the right annealing temperature

Too low promotes promiscuous priming-Non-specific products

Too high and you get no priming

Rough calculation of Tm (in oC)4x(# of G or C) + 2x(# of A or T)

Annealing temperature is generally between Tm and Tm – 5 oC

Can have only one annealing temperature!- Must be OK for both primers

The problem of mispriming in early cycles

This wrong DNA now has a perfect primer sequence on the endWill propagate as efficiently as the desired product in future cycles

CGTTGCTGATAGGATC

GCA CGA TAT CTAGT G

Primer

Template(wrong) T

CGTTGCTGATAGGATC

GCAACGACTATCCTAG

Primer

Template

Refinements

For fidelity It’s most important to reduce mispriming in early cycles: Hot-start - combine reagents cold and start the first cycle by placing sample in a well that has been pre-heated at 94 oC - stops mispriming as the sample warms up in first cycle

PCR success / failure

Well designed primers, good quality template-Little trouble-Little need for optimisation or refinement-It just works

Bad primers or tricky templates (e.g. high G=C)-Big trouble-Lots of optimization-Much misery!

Summary

PCR is a powerful technique that allows amplification of a chosen sequence of DNA-Each new strand of DNA can become a template

The power of PCR is also its Achilles heel-Controls without input template are important-Taq is an error-prone enzyme-Errors in early cycles are amplified

Good primers and the right annealing temperature are the key to successful PCR-Adequate Tm for primers, suitable annealing temperature

Changing the nucleotide sequence by PCR

New restriction sites

Site-directed mutagenesis

PCR can add new ends to insert

The 5’ end of a PCR primer does not need to match the template

AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCTCCTTACGCGATTACTGACAGG

CGAGAATTC

3’ 5’

5’

3’

New ends by PCR

Add useful restriction sites to the 5’ end of primers-Make sure the Tm of the template-specific part is still OK-If adding RE, need extra bases so the RE site is not right on the end

Always:purify PCR product (agarose gel)purify linearized vector (agarose gel)

AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCTCCTTACGCGATTACTGACAGG

CGAGAATTC

3’ 5’

5’

3’

EcoRI

Protein mutation by PCR I

Selectively replace a codon for a new one

PCR with mutation primers-Mismatch at the mutation site

z

2 PCR reactions1.Red primers2.Blue primers

z

z

z

z

z

z

Protein mutation by PCR II

- Amplification of full-length product

Mixing and annealing the PCR products

During 3rd PCR with the original terminal primers-Primer extension completes one of the duplexes

z

Protein mutation by PCR III

Good mutation primers -have about 1.5 times more nucleotides downstream than upstream of the mutation site-match the Tm of the other primers -end with a G or C at the 3’ end

z

AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT5’ 3’ GCGATTACTGAACAGCCTGTA 5’3’

PCR primers

$0.4 per nucleotide

Up to 30mer is usually reliable

Up to 60mer may be OK-Longer sequences need gel purification-Much longer sequences need confirmation by sequencing

A good primer makes a GC base pair at the 3’ end

Summary

PCR for changing DNA and mutating proteins-Primer design

Add/insert/delete nucleotides

-Only Tm of matching segments matters

-Inserts and deletions of any length possible