Lipase and protease double deletion mutant of Pseudomonas ...
Transcript of Lipase and protease double deletion mutant of Pseudomonas ...
![Page 1: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/1.jpg)
1
Lipase and protease double deletion mutant of Pseudomonas 1
fluorescens suitable for extracellular protein production 2
3
4
Myunghan Son1§, Yuseok Moon2§, Mi Jin Oh1, Sang Bin Han1, Ki Hyun Park1, Jung-Gon 5
Kim1, and Jung Hoon Ahn1* 6
7
§These authors contributed equally to this work. 8
1Korea Science Academy of KAIST, #899, Tanggam 3-Dong, Busanjin-Gu, Busan, 614-822, South Korea 9
2Department of Microbiology and Immunology, Medical Research Institute, Pusan National University School 10
of Medicine, Yangsan, 626-870, South Korea 11
12
*Corresponding author: 13
Jung Hoon Ahn, Ph.D. 14
Korea Science Academy of KAIST, 15
#899, Tanggam 3-Dong, Busanjin-Gu, 16
Busan, 614-822, South Korea 17
E-mail: [email protected] 18
Phone: 82-51-606-2335 19
Fax: 82-51-891-0004 20
21
Keywords: deletion mutant, lipase, protease, Pseudomonas fluorescens, ABC transporter, protein manufacturing 22
factory (PMF) 23
24
Running title: ΔtliAΔprtA deletion mutant of Pseudomonas fluorescens 25
26
Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02476-12 AEM Accepts, published online ahead of print on 5 October 2012
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 2: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/2.jpg)
2
ABSTRACT 27
Pseudomonas fluorescens, a widespread Gram-negative bacterium, is an ideal protein manufacturing factory 28
(PMF) because of its safety, robust growth, and high protein production. P. fluorescens possesses a type I 29
secretion system (T1SS), which mediates secretion of a thermostable lipase (TliA) and a protease (PrtA) through 30
its ATP binding cassette (ABC) transporter. Recombinant proteins in P. fluorescens are attached to the C-31
terminal signal region of TliA for transport as fusion proteins to the extracellular medium. However, intrinsic 32
TliA from the P. fluorescens genome interferes with detection of the recombinant protein and the secreted 33
recombinant protein is hydrolyzed, due to intrinsic PrtA, resulting in decreased efficiency of the PMF. In this 34
research, the lipase and protease genes of P. fluorescens SIK W1 were deleted using the double recombination 35
method. Deletion mutant P. fluorescens ΔtliAΔprtA secreted fusion proteins without TliA or protein degradation. 36
Using wild type P. fluorescens as an expression host, degradation of the recombinant protein varied depending 37
on the type of culture media and aeration; however, degradation did not occur with P. fluorescens ΔtliAΔprtA 38
irrespective of growth conditions. By homologous expression of tliA and ABC transporter in plasmid, TliA 39
secreted from P. fluorescens ΔprtA and P. fluorescens ΔtliAΔprtA was found to be intact, whereas that secreted 40
from the wild type P. fluorescens and P. fluorescens ΔtliA was found to be hydrolyzed. Our results demonstrate 41
that the deletion mutant P. fluorescens ΔtliAΔprtA is a promising T1SS-mediated PMF that enhances production 42
and detection of recombinant proteins in extracellular media. 43
44
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 3: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/3.jpg)
3
INTRODUCTION 45
Pseudomonas fluorescens produces heat-stable lipases and proteases (15). These enzymes cause spoilage of 46
milk and are responsible for bitterness, casein breakdown, and ropiness of milk resulting from production of 47
slime and protein coagulation (19, 36). In contrast to these negative effects, P. fluorescens is a potential 48
expression host for a diverse range of recombinant proteins. In particular, because it does not accumulate acetate 49
during fermentation, it is conducive to high-cell density fermentation (9). Accordingly, this Gram-negative 50
psychrotropic bacterium has been developed as a high-yield protein manufacturing factory (PMF) capable of 51
producing pharmaceutical and industrial proteins (23, 37). 52
Through its ATP-binding cassette (ABC) transporter, TliDEF, P. fluorescens secretes a thermostable lipase, 53
TliA. The genes tliA and tliDEF are encoded in a gene cluster designated as the lipase/protease operon (2). 54
TliDEF includes three components, TliD, TliE, and TliF, which are ABC protein, membrane fusion protein 55
(MFP), and outer membrane protein (OMP), respectively. Several regions of the secretion/chaperone domain of 56
TliA have been isolated and defined as lipase ABC transporter recognition domains (LARDs) (10, 11, 32). For 57
example, LARD3 is a fragment of TliA, composed of its last 103 residues, and, as an attached marker, it enables 58
recognition of model proteins by ABC transporters. In general, LARD-linked proteins are secreted by TliDEF 59
because they contain parts of the TliA secretion/chaperone domain, which is responsible for secretion (32). 60
LARDs mediate export of recombinant proteins through ABC transporters; therefore, extracellular proteins are 61
conveniently produced and acquired from culture broths. 62
Unlike other Gram-negative secretory pathways, the type 1 secretion system (T1SS) is mechanistically 63
simple and primarily composed of three components of the ABC transporter (12). Thus, utilization of T1SS for 64
PMFs is ideal because proteins are secreted directly into the extracellular medium from the cytoplasm without 65
becoming trapped in the periplasm. Previous research conducted in this laboratory has resulted in successful 66
transport of several proteins through P. fluorescens T1SS by attachment of LARDs as secretion markers. A 67
number of proteins, including green fluorescent protein (GFP), epidermal growth factor (EGF), and alkaline 68
phosphatase, can be transported by P. fluorescens when LARD is attached to their C-terminal ends (32). 69
However, one shortcoming of this secretory system is that intrinsic TliA from the native chromosomal copy of 70
tilA may interfere with detection and purification of the desired LARD-linked recombinant proteins. 71
In addition to TliA, P. fluorescens SIK W1 secretes a metalloprotease, PrtA, which contains a zinc-binding 72
motif (HExxH) (35). PrtA, which is classified as a member of the serralysin subfamily (EC 3.4.24.40), shares a 73
high homology with metalloproteases of Erwinia chrysanthemi (43), P. aeruginosa (13), Serratia marcescens 74
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 4: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/4.jpg)
4
(24), and P. fluorescens CY091 (26). PrtA contains conserved Zn+2- and Ca+2-binding domains, and is highly 75
resistant to heat inactivation (26, 44). It also possesses typical C-terminal RTX motifs (GGxGxD), which 76
facilitate its export by ABC transporter. The lipase/protease operon of P. fluorescens SIK W1 is composed of 77
prtA, inh, tliDEF, and tliA, and is responsible for synthesis and export of the lipase and the protease (2). Given 78
its ability to hydrolyze environmental proteins, PrtA is presumably involved in nutrient utilization. Due to its 79
low degree of selectivity, a polypeptide of as few as six amino acids can be a substrate (28). Therefore, it is 80
believed that PrtA hydrolyzes most proteins in the extracellular media. For this reason, prtA was targeted for 81
deletion with the expectation that its deletion would result in increased production of recombinant proteins. The 82
inh, which encodes for PrtA inhibitor, was also deleted together with prtA. 83
The genomes of P. fluorescens strains Pf-5, Pf0-1, and SBW25 have been fully sequenced (33, 41). P. 84
fluorescens SIK W1 and SBW25 contain only a lipase gene and a protease gene, while P. fluorescens Pf-5 and 85
Pf0-1 possess several lipase and protease genes. Therefore, in the present study, the sole lipase (tliA) and 86
protease (prtA) genes in P. fluorescens SIK W1 were targeted for deletion. For development of a strain of P. 87
fluorescens that can serve as an efficient PMF, deletion of tliA and prtA was essential in order to maximize 88
production and detection of recombinant proteins. P. fluorescens SIK W1 was used as the target deletion strain 89
for construction of P. fluorescens ΔtliAΔprtA. Strain enhancement as an expression host was verified, and 90
secretion activities of the deletion mutant were evaluated by monitoring production of TliA and GFP-fusion 91
proteins. 92
93
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 5: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/5.jpg)
5
MATERIALS AND METHODS 94
95
Bacterial strains and growth conditions. P. fluorescens SIK W1 (KCTC 7689 from the Korea Collection for 96
Type Cultures) was used as the target strain for the deletion. E. coli XL1-Blue (Stratagene) was used as a host 97
strain for plasmid construction, and E. coli S17-1 (29) was used as a donor for delivery of plasmids to P. 98
fluorescens SIK W1 by conjugation. Each strain was cultured in lysogeny broth (LB) medium. The E. coli 99
strains were cultured at 37°C while P. fluorescens SIK W1 cells were cultured at 25°C. LB agar containing 30 100
μg/mL kanamycin was used for negative selection of deletion mutants and LB agar containing 10% sucrose was 101
used for positive selection. During conjugation, because P. fluorescens has an innate resistance to ampicillin, 50 102
μg/mL ampicillin was added in order to distinguish P. fluorescens SIK W1 cells from E. coli S17-1 cells (31). 103
LB agar with 0.5% tributyrate, on which expression of TliA is marked by the appearance of transparent haloes 104
around the colonies, was used for detection of lipase activity. Skim milk agar containing 0.5% peptone, 0.5 mM 105
CaCl2, 3% skim milk, and 1.5% agar was prepared for detection of protease activity. The skim milk solution 106
was autoclaved separately to prevent coagulation with CaCl2. 107
108
Plasmid construction for deletion mutant. The plasmids used in this study are listed along with the bacterial 109
strains and their characteristics (Table 1). Information regarding the primers is provided (Table 2). The plasmid 110
pKtliAXS was constructed by introduction of a central 521 bp-deficient tliA into pK18mobsacB (39) using the 111
following methods. The gene tliA was PCR-amplified using primers lip-s and tliA-HindIII from pTOTAL, a 112
plasmid containing the entire P. fluorescens lipase/protease operon. Then tliA was inserted into pK18mobsacB , 113
which had been digested with the restriction enzymes BamHI and HindIII for construction of pKtliA. The tliA 114
gene in pKtliA was then digested with two compatible restriction enzymes, XhoI and SalI, and the plasmid was 115
allowed to self-ligate for deletion of the central 521-bp region, yielding pKtliAXS. The plasmid pKΔprtA was 116
constructed by insertion of the 357-bp ΔprtA and 354-bp Δinh fragments of the protease inhibitor gene of P. 117
fluorescens into pK18mobsacB. The 357-bp ΔprtA fragment was amplified using primers prt-s and Δprt-Xb, and 118
the 354-bp Δinh fragment was amplified using primers Δinh-Xb and inh-HindIII. The final ΔprtA fragment 119
inserted into pK18mobsacB was designed to produce a nonfunctional fusion protein containing partial prtA and 120
inh sequences, thus avoiding a polar mutation effect on the ABC transporter gene behind inh. Standard protocols 121
were followed in performance of transformation, isolation, restriction endonuclease digestion, ligation, PCR, 122
and gel electrophoresis procedures (38). All restriction endonucleases, enzymes, and associated reagents were 123
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 6: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/6.jpg)
6
purchased from Solgent (Daejeon, South Korea), Takara Shuzo (Shiga, Japan), or Sigma-Aldrich (St. Louis, 124
MO). 125
126
Conjugation and deletion mutant selection processes. The pKtliAXS suicide plasmid contains kmR, sacB, and 127
the mob factor. Via the mob factor (39), pKtliAXS was transferred from E. coli S17-1 to P. fluorescens SIK W1 128
by conjugation, according to the procedures previously described by Miller (30). Colonies of P. fluorescens with 129
a single cross-over event were selected based on kanamycin resistance. These colonies, which had integrated 130
pKtliAXS into the genome, exhibited sucrose sensitivity (due to the presence of sacB) along with kanamycin 131
resistance. Another cross-over event was then induced in order to replace tliA with the 521 bp-deficient tliA 132
mutant and for removal of kmR and sacB from the genome. For this, a colony of single recombinant was grown 133
in a non-selective LB medium at 25°C. After one day of growth, cultures were diluted by factors of 10-4, 10-5, 134
and 10-6, spread onto 10% sucrose LB agar, and incubated for 48 h. Colonies that grew on 10% sucrose LB were 135
selected and evaluated for the absence of lipase expression. Deletion mutants were screened for kanamycin-136
sensitive and sacB-negative colonies. The ΔprtA strains were obtained using plasmid pKΔprtA. Both wild-type P. 137
fluorescens and P. fluorescens ΔtliA were used for prtA deletion, creating P. fluorescens ΔprtA, and P. 138
fluorescens ΔtliAΔprtA. Single recombinants with sacB conferred basal resistance on 10% sucrose LB agar, 139
therefore, we developed a new method in which single recombinants were cultured in 10% sucrose LB medium 140
for 24 hours and then spread on LB agar after dilution. Colonies obtained after selection in 10% sucrose liquid 141
medium were mostly wild-type or double recombinant. 142
143
Verification of the deletion of tliA and prtA. To verify successful construction of P. fluorescens ΔtliA deletion 144
mutant, the genomes of wild-type P. fluorescens, single recombinant 1, single recombinant 2, and P. fluorescens 145
ΔtliA were PCR-amplified using T-PCR1 and T-PCR2 (Fig. 1). Two primers, lip-s and tliA-HindIII, which were 146
used for pKtliAXS construction, were used for the T-PCR1 procedure. The primers start-tliF and tliA-HindIII 147
were used for T-PCR2. The lip-s primer anneals to the first part of tliA, and start-tliF anneals to the first part of 148
tliF in the P. fluorescens genome. Another two sets of PCR protocols were similarly designed in order to verify 149
prtA deletion. The genomes of wild-type P. fluorescens, two single recombinants, and P. fluorescens ΔprtA were 150
PCR-amplified using P-PCR1 and P-PCR2 (Fig. 4). Two primers (prt-s and inh-HindIII), which were used for 151
pKΔprtA construction, were used for P-PCR1, and the primers 5’-UTR-prt and inh-HindIII were used for P-152
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 7: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/7.jpg)
7
PCR2. The prt-s primer anneals to the first part of prtA, and 5’-UTR-prt anneals to the 5’ region of prtA in the P. 153
fluorescens genome. 154
155
Expression of GFP fusion proteins. The ABC transporter gene of P. fluorescens, tliDEF, was inserted into 156
pDSK-519 (20) for construction of pDX. In addition, the coding sequences for TliA, GFP-LARD3, and GFP-157
TliA were inserted into the KpnI-SacI site of pDX downstream of tliDEF for construction of pDX-TliA, pDX-158
GFP-LARD3, and pDX-GFP-TliA, respectively. LARD3 or TliA was inserted into the C-terminal of GFP, 159
resulting in GFP-LARD3 and GFP-TliA, respectively. The constructed plasmids were delivered into P. 160
fluorescens by conjugal transfer or electroporation. P. fluorescens containing these plasmids were cultured in 161
test tubes containing 8 mL LB or 2× LB medium at 25°C until a stationary phase was reached. This less aerated 162
condition was used for culture of wild-type P. fluorescens and P. fluorescens ΔtliA. To maintain expression of 163
fusion proteins by the pDSK519 derivatives, 60 μg/mL kanamycin was added to the medium. IPTG does not 164
affect protein expression in P. fluorescens; therefore, it was not used (1). 165
166
SDS-PAGE and western blot analysis. Western blot analysis was performed using anti-LARD antibodies to 167
measure expression and secretion of TliA (11). The cells were grown under conditions described earlier in the 168
Materials and Methods section. The cultures were centrifuged twice at 13,000 rpm for 10 minutes in order to 169
separate the cell pellet from supernatant, and expression and secretion of the recombinant proteins were 170
analyzed in the pellet and supernatant, respectively. Proteins in the pellet (cells) or supernatant (extracellular 171
medium) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in 10% 172
polyacrylamide gels according to the method developed by Laemmli (22). The proteins were transferred onto a 173
nitrocellulose membrane (Amersham), incubated with the primary and secondary antibodies, and were detected 174
using an enhanced chemiluminescence system (Pierce, IL). Fifteen microliters of the cell pellet or supernatant, 175
equivalent of 15 μL OD600~3.0 culture broth (0.045 OD600 equivalent) were loaded on 10% (v/v) SDS-PAGE 176
and western blotting was performed as previously described (11) using anti-LARD or anti-GFP primary 177
antibodies. Proteins were stained with Coomassie Brilliant Blue for direct observation. 178
179
Trypisinization of GFP-fusion proteins. We treated GFP-fusion proteins with trypsin-EDTA (Gibco) for 180
analysis of the activity of PrtA. GFP-fusion proteins were isolated from P. fluorescens ΔtliA and P. fluorescens 181
ΔtliAΔprtA cells harboring the pDX-GFP-LARD3 and pDX-GFP-TliA, respectively. Cells were cultured in 8 182
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 8: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/8.jpg)
8
mL LB medium at 25°C with shaking (150 rpm) until a stationary phase was reached. After centrifugation, 500 183
μL of supernatant was treated with 50 μL 0.5% Trypsin-EDTA at 25°C for 3 hours. The reaction was terminated 184
by addition of SDS-PAGE sample buffer and heating for 10 minutes in boiling water. Western blotting was 185
performed using anti-GFP antibodies for analysis of treated proteins. 186
187
Lipase activity assay. Secretion of TliA from the four P. fluorescens strains, wild-type, ΔtliA, ΔprtA, and 188
ΔtliAΔprtA, was measured. Strains transformed with pAJH10, which expresses tliDEF and tliA, were cultured in 189
test tubes containing 3 mL of LB medium at 25°C. The supernatant was centrifuged twice and lipase activity 190
was measured using a pH-STAT (842 STAT Titrando, Metrohm). In addition, the supernatant was removed and 191
incubated for 15 hours at 25°C, and measurement of lipase activity was performed every 5 hours to assess the 192
degradation of TliA. For measurement of lipase activity, an olive oil emulsion was titrated with a 10 mM NaOH 193
solution. Because lipase hydrolyzes triglycerides and releases free fatty acid, the 10 mM NaOH solution was 194
added in order to maintain the pH at 8.5. A mixture containing 10 mL olive oil, 90 mL 10% Arabic gum, and 195
200 mL of a salt solution was emulsified for 10 min using a blender. The salt solution contained 20 mM CaCl2, 196
0.6 M NaCl, and 1 mM sodium taurocholate. Lipase solution (1-30 μL) was injected into 40 mL of the olive oil 197
emulsion, and the pH-STAT titrated the olive oil emulsion with 10 mM NaOH at pH 8.5 and 45°C for 3 minutes. 198
The titration results were converted into lipase activity; one unit was defined as the release of 1 μmol of fatty 199
acid per minute under the experimental conditions (5). 200
201
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 9: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/9.jpg)
9
RESULTS 202
Construction and verification of P. fluorescens ΔtliA. Many cases of milk spoilage have reportedly been 203
attributed to the thermostable lipase produced by P. fluorescens SIK W1 (3, 4). In a previous report, the P. 204
fluorescens SIK W1 thermostable lipase/protease operon containing prtA, inh, tliD, tliE, tliF, and tliA was 205
cloned and sequenced (2). This operon enables secretion of protease (PrtA) and lipase (TliA) by P. fluorescens 206
SIK W1 into the extracellular medium by action of the ABC transporter TliDEF. In this study, the lipase gene, 207
tliA, in the lipase/protease operon of P. fluorescens SIK W1 was targeted for deletion. A 521 bp central deletion 208
was successfully substituted in place of the genomic tliA, resulting in ΔtliA (Fig. 1A). 209
To verify successful construction of the deletion mutant, the genomes of wild-type P. fluorescens, 210
single recombinants 1 and 2 (vector-inserted genomes shown in Fig. 1A), and P. fluorescens ΔtliA were PCR-211
amplified using T-PCR1 primers (Fig. 1B). As expected, only 521 bp-deficient tliA (907 bp) was amplified from 212
P. fluorescens ΔtliA, while only intact tliA (1,428 bp) was amplified from the wild-type strain. Both fragments 213
were found in single recombinants 1 and 2. Additional PCR amplification using T-PCR2 primers resulted in 214
production of a 2,920-bp fragment from the single recombinant 1, suggesting that the truncated tliA was inserted 215
downstream of the genomic tliA (Fig. 1C). On the other hand, use of the identical PCR amplification procedure 216
resulted in a 2,399-bp fragment from single recombinant 2, indicating that ΔtliA was inserted upstream of 217
genomic tliA. When cultured on tributyrate LB agar for phenotypic evaluation, formation of large haloes was 218
observed around the wild-type colonies, while no halo developed around the P. fluorescens ΔtliA colonies (Fig. 219
1D). In addition, neither wild-type nor P. fluorescens ΔtliA cells grew in the presence of kanamycin, whereas 220
the two single recombinants exhibited robust growth (Fig. 1E). These results indicated the successful 221
construction of P. fluorescens ΔtliA. 222
223
Expression and secretion of TliA by P. fluorescens ΔtliA. Western blot analysis was performed using anti-224
LARD antibodies in order to examine expression and secretion of TliA in wild-type P. fluorescens and P. 225
fluorescens ΔtliA (Fig. 2). When both were grown on tributyrate agar, extracellular lipase activity was detected 226
around the wild-type colonies but not around P. fluorescens ΔtliA colonies (Fig. 1D). However, when these cells 227
were analyzed by western blot, the lipase was undetectable in both the cells and the media (Fig. 2, lanes 1 and 2). 228
To increase secretion of TliA, ABC transporter was supplemented by transforming the cells with pDX, which 229
encodes TliDEF. Transformation with pDX resulted in an increase in the level of TliA in the extracellular 230
medium for the wild-type P. fluorescens cells, whereas extracellular TliA was absent in the medium harboring P. 231
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 10: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/10.jpg)
10
fluorescens ΔtliA cultures (Fig. 2, lanes 3 and 4). Supplemented ABC transporter enabled TliA secretion in wild 232
type P. fluorescens through substrate binding and protection (25, 32). To determine whether recombinant 233
proteins were secreted without TliA by P. fluorescens ΔtliA, GFP-LARD3 fusion protein was co-expressed with 234
TliDEF. For construction of GFP-LARD3, LARD3 was attached to the C-terminal end of GFP. As expected, 235
secretion of TliA along with GFP-LARD3 was observed in wild-type P. fluorescens, but only GFP-LARD3 was 236
secreted in P. fluorescens ΔtliA (Fig. 2, lanes 5 and 6). 237
In an additional experiment, expression of GFP-LARD3 and GFP-TliA fusion proteins was observed in 238
wild-type P. fluorescens and P. fluorescens ΔtliA together with TliDEF (Fig. 3). For construction of GFP-TliA, 239
TliA was attached to the C-terminal end of GFP. Wild-type P. fluorescens cells transformed with pDX-GFP-240
LARD3 or pDX-GFP-TliA secreted only TliA into the LB broth (Fig. 3A). Both fusion proteins were detected 241
along with TliA when wild-type P. fluorescens was cultured in 2× LB broth (Fig. 3B). This was consistent with 242
the previously observed increase in the level of recombinant proteins following the switch of culture medium 243
from LB to 2× LB (32). On the other hand, P. fluorescens ΔtliA cells harboring pDX-GFP-LARD3 secreted 244
GFP-LARD3 without TliA into 2× LB medium (Fig. 3C, lane 2). However, P. fluorescens ΔtliA transformed 245
with pDX-GFP-TliA still produced both TliA and GFP-TliA in the extracellular medium (Fig. 3C, lane 3). 246
When the same extracellular medium was analyzed with anti-GFP antibodies, monomeric-sized GFP (26.8 kDa) 247
was detected. Because the cytoplasm contained only the intact GFP-TliA, it appeared that GFP-TliA was 248
degraded into GFP and TliA during or after secretion (data not shown). 249
250
Construction of P. fluorescens ΔprtA. To evaluate the effects of prtA deletion mutant on secretion and 251
degradation of the GFP fusion proteins, P. fluorescens SIK W1 genome was also substituted with ΔprtA, 252
deleting prtA and inh genes from the lipase/protease operon (Fig. 4A). The prtA gene was targeted in wild-type 253
cell and P. fluorescens ΔtliA for construction of P. fluorescens ΔprtA and P. fluorescens ΔtliAΔprtA, 254
respectively. PCR techniques performed to verify tliA deletion were also used to assess prtA deletion. Wild-type 255
P. fluorescens, two single recombinants, and P. fluorescens ΔprtA were PCR-amplified. As expected, 256
amplification of only ΔprtA (725 bp) was observed in P. fluorescens ΔprtA, while amplification of only the 257
intact prtA (1,870 bp) was observed in the wild-type cells. Both fragments were found in single recombinants 1 258
and 2 (Fig. 4B). Additional PCR analysis with P-PCR2 primers amplified a 749-bp fragment from single 259
recombinant 1, implying that prtA was inserted downstream of the intrinsic ΔprtA gene (Fig. 4C). On the other 260
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 11: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/11.jpg)
11
hand, PCR amplification using an identical protocol produced a 1,912-bp fragment from single recombinant 2, 261
indicating that prtA was inserted upstream of the intrinsic ΔprtA. When grown on skim milk agar, formation of 262
haloes was observed around the wild-type colonies while no halo was observed among the P. fluorescens ΔprtA 263
colonies (Fig. 4D). Single recombinant 2 colonies also developed small haloes, suggesting that expression of the 264
intact prtA was controlled by the prtA promoter. Neither wild-type nor P. fluorescens ΔprtA cells grew in the 265
presence of kanamycin, whereas the two single recombinants showed vigorous growth (Fig. 4E). These results 266
indicated that the deletion procedure we performed resulted in successful production of P. fluorescens ΔprtA 267
and P. fluorescens ΔtliAΔprtA strains. 268
269
Export of GFP fusion proteins from P. fluorescens ΔtliAΔprtA. As previously mentioned, extracellular GFP-270
LARD3 and GFP-TliA secreted from either wild-type P. fluorescens or P. fluorescens ΔtliA were degraded. 271
Consequently, a parallel experiment was performed with P. fluorescens ΔtliAΔprtA to determine whether these 272
recombinant proteins were intact in the absence of PrtA (Fig 5). Using P. fluorescens ΔtliA as an expression host, 273
GFP-LARD3 and GFP-TliA were hydrolyzed completely in LB medium and to a lesser but significant degree in 274
2× LB medium (Fig. 5). This explained the comparative increase in the level of recombinant proteins following 275
the switch of culture medium from LB to 2× LB, which had been observed in our previous research (32). In 276
contrast, degradation did not occur with P. fluorescens ΔtliAΔprtA in both LB and 2× LB medium either aerated 277
or less aerated. In general, wild type P. fluorescens and P. fluorescens ΔtliA showed higher production of 278
recombinant proteins in less-aerated conditions. Based on these results, it was concluded that PrtA produced by 279
P. fluorescens hydrolyzed GFP-recombinant proteins upon secretion, and that the decline of recombinant protein 280
level was caused by PrtA. 281
Results of western blotting with anti-GFP antibodies showed that GFP-TliA was degraded into GFP in P. 282
fluorescens ΔtliA but not in P. fluorescens ΔtliAΔprtA (Fig. 6A, lanes 2 and 4). Extracellular GFP-LARD3 283
produced by P. fluorescens ΔtliA was also partially degraded into GFP while both GFP-LARD3 and an 284
intermediate form (molecular weight between those of GFP and GFP-LARD3) were observed with P. 285
fluorescens ΔtliAΔprtA (Fig. 6A, lanes 1 and 3). For an unknown reason, the intermediate form shortened at the 286
C-terminus was produced, supposedly by cytosolic proteases released during cell lysis. Monomeric GFP was not 287
detected in P. fluorescens ΔtliAΔprtA cultures; only GFP-LARD3 and the intermediate form were found in the 288
extracellular medium. These results supported the hypothesis that GFP-fusion proteins produced by P. 289
fluorescens ΔtliA were hydrolyzed by PrtA. 290
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 12: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/12.jpg)
12
We treated the supernatant containing GFP-fusion proteins obtained from P. fluorescens ΔtliAΔprtA cultures 291
with 0.05% trypsin-EDTA (Fig. 6B). While the intact form was observed in the absence of trypsin-EDTA, the 292
GFP-fusion proteins were hydrolyzed into GFP following treatment. GFP released upon hydrolysis by PrtA was 293
not further degraded by treatment with trypsin-EDTA (data not shown). Trypsinization mimicked the hydrolysis 294
of GFP-fusion proteins by PrtA. The link between GFP and the C-terminal signal peptide, which was derived 295
from the secretion/chaperone domain of TliA, was a common target of both PrtA and trypsin. 296
297
Lipase production in P. fluorescens ΔtliAΔprtA. The lipase in P. fluorescens ΔprtA culture exhibited an 298
increased stability compared to that in the culture harboring the wild type. Extracellular media from wild-type P. 299
fluorescens and P. fluorescens ΔprtA, both harboring tliDEF and tliA in plasmid, were incubated at 25°C, 300
followed by measurement of lipase activity (Fig. 7A). Lipase activity in the culture harboring wild-type P. 301
fluorescens decreased by 440 U/mL within a 15-hour period; however, lipase activity in P. fluorescens ΔprtA 302
culture decreased only by 196 U/mL during the same period. On average, the lipase activity of P. fluorescens 303
ΔprtA showed a rate of decrease of 1.43% per hour. The rate was much higher for wild-type P. fluorescens (4.60% 304
per hour). These results suggest that extracellular PrtA fostered the declination of P. fluorescens lipase activity, 305
presumably by hydrolyzing the lipase. 306
Four P. fluorescens strains supplemented with tliDEF and tliA were cultured, and the lipase activity in each 307
culture was monitored for five days (Fig. 7B). Maximum lipase activities were observed on the second day, and 308
were higher for P. fluorescens ΔprtA (913 U/mL) and P. fluorescens ΔtliAΔprtA (1029 U/mL), compared with 309
wild-type P. fluorescens (804 U/mL) and P. fluorescens ΔtliA (755 U/mL). In addition, the lipase activity in the 310
culture media of P. fluorescens ΔprtA and P. fluorescens ΔtliAΔprtA remained at around 300-400 U/mL, even 311
after five days of incubation, while it showed a decline to below 100 U/mL in media from wild-type P. 312
fluorescens and P. fluorescens ΔtliA cultures. 313
Although the rate of decrease was less than that of TliA from wild-type P. fluorescens and P. fluorescens 314
ΔtliA, the lipase activity of TliA from P. fluorescens ΔprtA and P. fluorescens ΔtliAΔprtA did show a decrease 315
over time, especially after three days of culture (Fig. 7B). However, results of SDS-PAGE analysis showed that 316
the amount of TliA did not decrease after the third day (Fig. 7C). Therefore, the decrease in lipase activity 317
appeared to be caused mainly by inactivation of TliA rather than by its degradation. The relatively rapid 318
decrease of lipase activity in wild-type P. fluorescens and P. fluorescens ΔtliA may have been caused by the 319
combination of hydrolysis and denaturation. Overall, P. fluorescens ΔprtA and P. fluorescens ΔtliAΔprtA showed 320
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 13: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/13.jpg)
13
higher lipase concentration, compared to wild-type P. fluorescens and P. fluorescens ΔtliA, mainly due to the 321
prtA deletion. 322
323
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 14: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/14.jpg)
14
DISCUSSION 324
In this study, we constructed a double deletion mutant, P. fluorescens ΔtliAΔprtA, lacking both tliA and prtA 325
genes. The deletion procedure was not detrimental to the mutants and they retained the characteristics of the 326
parental cells. Lipase and protease activities of P. fluorescens ΔtliAΔprtA were not observed when the cells were 327
cultured on substrate plates or when the extracellular medium was analyzed. The deletion mutant P. fluorescens 328
ΔtliA eliminated the drawback of detection of endogenous TliA along with the recombinant proteins, and this 329
enhanced detection of recombinant proteins produced by this deletion mutant. As expected, prtA deletion mutant 330
lessened the degradation of recombinant proteins or lipase in the culture medium. PrtA appeared to 331
preferentially hydrolyze exposed peptide bonds, including the one linking GFP and LARD. However, after a 332
long period of time, it also digested TliA and probably GFP or other proteins. Increased stability against protein 333
degradation in P. fluorescens ΔprtA could lead to much higher accumulation of target proteins in PMFs, 334
resulting in high concentrations of secreted proteins during long periods of incubation. 335
P. fluorescens is a saprophytic bacterium commonly isolated from soil, water, and the surfaces and tissues of 336
plants and animals (34). The ubiquitous nature of P. fluorescens on the surface of plants typically grown for 337
human consumption suggests that this bacterium has been widely consumed by humans (7). In addition, 338
extensive pathogenicity and toxicology studies have demonstrated the safety of P. fluorescens. The safety of P. 339
fluorescens for use in industrial applications has also been verified by the ability of these cells to produce 340
generally-recognized-as safe (GRAS) α-amylase (23) and several EPA-registered bioinsecticides (9). P. 341
fluorescens can be cultivated at high densities in a bioreactor and can tolerate a wide range of fermentation 342
conditions (40, 42). In addition, these bacteria can produce larger quantities of recombinant proteins in a form 343
more soluble than proteins produced by E. coli (9). The benign nature, robust growth, and high level production 344
of recombinant proteins make P. fluorescens ideal for production of recombinant proteins. However, 345
manufacture of recombinant protein is limited to cytoplasmic and periplasmic production. Therefore, for easy 346
and cost-effective protein recovery, extracellular secretion into the growth medium is needed (9). 347
There are at least six specialized secretion systems in Gram-negative bacteria, including the ABC transporter 348
(type I secretion system, T1SS), Sec/Tat (T2SS), flagella/pathogenesis (T3SS), conjugation/virulence (T4SS), 349
autotransporter (T5SS), and the recently identified Hcp/VgrG (T6SS) systems (8, 21). Among these, P. 350
fluorescens has three secretion systems (T1SS, T2SS, and T5SS), which are capable of transporting proteins 351
across both inner and outer membranes of Gram-negative bacteria (27). In contrast to T1SS, other secretion 352
systems are associated with a large number of proteins. For example, 12-16 proteins are required for transport 353
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 15: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/15.jpg)
15
through the bacterial outer membrane by T2SS, and more than 10 Sec and other related proteins are involved in 354
transport through the inner membrane by T5SS (17). The ABC secretion system provides efficient transport of 355
proteins through the inner and outer membranes simultaneously and is mechanistically simple, being composed 356
only of three protein components. By attachment of signal sequences recognized by ABC transporters, 357
recombinant proteins can be secreted into the extracellular medium for cost-effective protein recovery. The P. 358
fluorescens ΔtliAΔprtA cells constructed in this study can be used as a PMF by supplementing homologous 359
ABC transporter for enhanced production of extracellular protein. These cells will maintain recombinant 360
proteins secreted by ABC transporter, thereby maximizing the merits of P. fluorescens as an expression host. 361
Of particular interest, secretion of fusion proteins was observed with wild-type P. fluorescens only when the 362
host was cultured in 2× LB broth. For example, when cultured in 2× LB, GFP-LARD3 and GFP-TliA were 363
secreted by wild-type P. fluorescens and P. fluorescens ΔtliA, whereas they were undetectable when the cells 364
were cultured in normal LB broth. Through comparison of P. fluorescens ΔprtA with the wild-type cells, we 365
concluded that PrtA was secreted into normal LB broth and hydrolyzed the recombinant proteins; however, 366
suppressed production of PrtA was observed in 2× LB medium. GFP with C-terminal tags appeared to contain 367
an exposed labile peptide bond, which was degraded by PrtA. Use of P. fluorescens ΔtliAΔprtA alleviates the 368
restriction on media concentration, allowing the use of LB medium instead of 2× LB medium. However, on 369
hindsight, because the C-terminal secretion signal may interfere with GFP, decreasing its fluorescence, 370
production of free GFP by promoting PrtA-mediated hydrolysis might be beneficial (11). 371
Previously, it was reported that homologous expression of lipase genes in P. fluorescens decreases with 372
increased aeration (1). The recombinant lipase was likely to be degraded by some proteases that are produced 373
under aerobic conditions. Previous studies have shown that aeration increases production of lipase and protease 374
in P. fluorescens (6, 14, 18). In addition, aeration has a negative effect on recombinant protein production via 375
the Hly secretion system (16). The effect of oxygen on PrtA in secretion systems has not been determined; 376
therefore, further research on the involvement of PrtA in aeration-related protein is anticipated. Both expression 377
and degradation of target protein affect extracellular accumulation of the protein. PrtA, whose production is 378
increased by aeration, appears to be a major factor in decrease of protein accumulation. 379
In summary, removal of functional tliA and prtA from the genome of P. fluorescens resulted in production of 380
recombinant proteins without the interference of TliA and with the ensured protection from PrtA hydrolysis. 381
The result showing that fusion proteins were produced in 2× LB broth and not in normal LB medium was found 382
to be caused by PrtA. Regulation of PrtA production mediated by aeration and other degenerating factors that 383
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 16: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/16.jpg)
16
decreased TliA activity need further investigation. P. fluorescens ΔprtA and P. fluorescens ΔtliAΔprtA will 384
serve as tools for further exploration of these phenomena. Absence of the major degradation factor PrtA will 385
allow us to obtain a more general understanding of how secreted proteins are processed in extracellular medium. 386
Use of the P. fluorescens ΔtliAΔprtA strain simplified purification of recombinant proteins, and generated a 387
higher protein production yield. From this research, we expect that the double deletion mutant P. fluorescens Δ388
tliAΔprtA will be used as a PMF using ABC transporters. 389
390
391
392
ACKNOWLEDGMENTS 393
We are very grateful to YW Park and CS Kwon for their critical review of this manuscript. We would also like 394
to thank Minsu Ko for providing us with pKmobsacB. Our study was supported by the R&E program, Korean 395
Ministry of Education, Science and Technology. 396
397
398
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 17: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/17.jpg)
17
REFERENCES 399
1. Ahn, J. H., J. G. Pan, and J. S. Rhee. 2001. Homologous expression of the lipase and ABC transporter 400
gene cluster, tliDEFA, enhances lipase secretion in Pseudomonas spp. Appl Environ Microbiol 67:5506-11. 401
2. Ahn, J. H., J. G. Pan, and J. S. Rhee. 1999. Identification of the tliDEF ABC transporter specific for 402
lipase in Pseudomonas fluorescens SIK W1. J Bacteriol 181:1847-52. 403
3. Andersson, R. E. 1980. Microbial lipolysis at low temperatures. Appl Environ Microbiol 39:36-40. 404
4. Andersson, R. E., G. Danielsson, C. B. Hedlund, and G. Svensson. 1981. Effect of a heat-resistant 405
microbial lipase on flavor of ultra-high-termperature sterilized milk. J Dairy Sci 64:375-379. 406
5. Andersson, R. E., C. B. Hedlund, and U. Jonsson. 1979. Thermal inactivation of a heat-resistant lipase 407
produced by the psychotrophic bacterium Pseudomonas fluorescens. J Dairy Sci 62:361-367. 408
6. Birkeland, S. E., L. Stepaniak, and T. Sorhaug. 1985. Quantitative studies of heat-stable proteinase from 409
Pseudomonas fluorescens P1 by the enzyme-linked immunosorbent assay. Appl Environ Microbiol 49:382-410
7. 411
7. Bradbury, J. F. 1986. Guide to the plant pathogenic Bacteria. CAB International Mycological Institute 412
Kew, UK. 413
8. Cascales, E. 2008. The type VI secretion toolkit. EMBO Rep 9:735-41. 414
9. Chew, L. C., T. M. Ramseier, D. M. Retallack, J. C. Schneider, C. H. Squires, and H. W. Talbot. 2005. 415
Pseudomonas fluorescens. Wiley-VCH, Weinheim. 416
10. Choi, H. J., J. H. Ahn, S. H. Park, K. H. Do, J. Kim, and Y. Moon. 2012. Enhanced wound healing by 417
recombinant Escherichia coli Nissle 1917 via human epidermal growth factor receptor in human intestinal 418
epithelial cells: therapeutic implication using recombinant probiotics. Infect Immun 80:1079-87. 419
11. Chung, C. W., J. You, K. Kim, Y. Moon, H. Kim, and J. H. Ahn. 2009. Export of recombinant proteins 420
in Escherichia coli using ABC transporter with an attached lipase ABC transporter recognition domain 421
(LARD). Microb Cell Fact 8:11. 422
12. Delepelaire, P. 2004. Type I secretion in gram-negative bacteria. Biochim Biophys Acta 1694:149-61. 423
13. Duong, F., A. Lazdunski, B. Cami, and M. Murgier. 1992. Sequence of a cluster of genes controlling 424
synthesis and secretion of alkaline protease in Pseudomonas aeruginosa: relationships to other secretory 425
pathways. Gene 121:47-54. 426
14. Fox, P. F., and L. Stepaniak. 1983. Isolation and some properties of extracellular heat-stable lipases from 427
Pseudomonas fluorescens strain AFT 36. J Dairy Res 50:77-89. 428
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 18: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/18.jpg)
18
15. Frank, J. F. 1997. Milk and dairy products. , p. 101-116. In M. P. B. Doyle, L. R.; Montville, T. J. (ed.), 429
Food microbiology: fundamentals and frontiers. ASM Press, Washington, DC. 430
16. Hahn, H. P., and B. U. von Specht. 2003. Secretory delivery of recombinant proteins in attenuated 431
Salmonella strains: potential and limitations of Type I protein transporters. FEMS Immunol Med Microbiol 432
37:87-98. 433
17. Henderson, I. R., F. Navarro-Garcia, M. Desvaux, R. C. Fernandez, and D. Ala'Aldeen. 2004. Type V 434
protein secretion pathway: the autotransporter story. Microbiol Mol Biol Rev 68:692-744. 435
18. Jaspe, A., P. Palacios, L. Fernandez, and C. Sanjose. 2000. Effect of extra aeration on extracellular 436
enzyme activities and ATP concentration of dairy Pseudomonas fluorescens. Lett Appl Microbiol 30:244-8. 437
19. Jay, J. M. 2000. Taxonomy, role, and significance of microorganisms in food. , p. 13-37. In J. M., M. J. Jay, 438
Loessner, and D. A. Golden (ed.), Modern Food Microbiology. Aspen Publishers, Gaithersburg MD. 439
20. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad-host-range plasmids for 440
DNA cloning in gram-negative bacteria. Gene 70:191-7. 441
21. Kostakioti, M., C. L. Newman, D. G. Thanassi, and C. Stathopoulos. 2005. Mechanisms of protein 442
export across the bacterial outer membrane. J Bacteriol 187:4306-14. 443
22. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. 444
Nature 227:680-5. 445
23. Landry, T. D., L. Chew, J. W. Davis, N. Frawley, H. H. Foley, S. J. Stelman, J. Thomas, J. Wolt, and D. 446
S. Hanselman. 2003. Safety evaluation of an alpha-amylase enzyme preparation derived from the archaeal 447
order Thermococcales as expressed in Pseudomonas fluorescens biovar I. Regul Toxicol Pharmacol 448
37:149-68. 449
24. Letoffe, S., P. Delepelaire, and C. Wandersman. 1991. Cloning and expression in Escherichia coli of the 450
Serratia marcescens metalloprotease gene: secretion of the protease from E. coli in the presence of the 451
Erwinia chrysanthemi protease secretion functions. J Bacteriol 173:2160-6. 452
25. Letoffe, S., P. Delepelaire, and C. Wandersman. 1996. Protein secretion in gram-negative bacteria: 453
assembly of the three components of ABC protein-mediated exporters is ordered and promoted by substrate 454
binding. EMBO J 15:5804-11. 455
26. Liao, C. H., and D. E. McCallus. 1998. Biochemical and genetic characterization of an extracellular 456
protease from Pseudomonas fluorescens CY091. Appl Environ Microbiol 64:914-21. 457
27. Ma, Q., Y. Zhai, J. C. Schneider, T. M. Ramseier, and M. H. Saier, Jr. 2003. Protein secretion systems 458
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 19: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/19.jpg)
19
of Pseudomonas aeruginosa and P. fluorescens. Biochim Biophys Acta 1611:223-33. 459
28. Marokhazi, J., N. Mihala, F. Hudecz, A. Fodor, L. Graf, and I. Venekei. 2007. Cleavage site analysis of 460
a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a 461
highly sensitive and specific substrate. FEBS J 274:1946-56. 462
29. Mazodier, P., R. Petter, and C. Thompson. 1989. Intergeneric conjugation between Escherichia coli and 463
Streptomyces species. J Bacteriol 171:3583-5. 464
30. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, [Cold Spring 465
Harbor, N.Y.]. 466
31. Pappas, G., V. Karavasilis, L. Christou, and E. V. Tsianos. 2006. Pseudomonas fluorescens infections in 467
clinical practice. Scand J Infect Dis 38:68-70. 468
32. Park, Y., Y. Moon, J. Ryoo, N. Kim, H. Cho, and J. H. Ahn. 2012. Identification of the minimal region in 469
lipase ABC transporter recognition domain of Pseudomonas fluorescens for secretion and fluorescence of 470
green fluorescent protein. Microb Cell Fact 11:60. 471
33. Paulsen, I. T., C. M. Press, J. Ravel, D. Y. Kobayashi, G. S. Myers, D. V. Mavrodi, R. T. DeBoy, R. 472
Seshadri, Q. Ren, R. Madupu, R. J. Dodson, A. S. Durkin, L. M. Brinkac, S. C. Daugherty, S. A. 473
Sullivan, M. J. Rosovitz, M. L. Gwinn, L. Zhou, D. J. Schneider, S. W. Cartinhour, W. C. Nelson, J. 474
Weidman, K. Watkins, K. Tran, H. Khouri, E. A. Pierson, L. S. Pierson, 3rd, L. S. Thomashow, and J. 475
E. Loper. 2005. Complete genome sequence of the plant commensal Pseudomonas fluorescens Pf-5. Nat 476
Biotechnol 23:873-8. 477
34. Rainey, P. B., and M. J. Bailey. 1996. Physical and genetic map of the Pseudomonas fluorescens SBW25 478
chromosome. Mol Microbiol 19:521-33. 479
35. Rawlings, N. D., and A. J. Barrett. 1995. Evolutionary families of metallopeptidases. Methods Enzymol 480
248:183-228. 481
36. Ray, B. 1996. Spoilage of Specific food groups., 3rd ed. CRC Press, Boca Raton, FL. 482
37. Retallack, D. M., H. Jin, and L. Chew. 2012. Reliable protein production in a Pseudomonas fluorescens 483
expression system. Protein Expr Purif 81:157-65. 484
38. Sambrook, J., and D. W. Russell. 2001. Molecular cloning : a laboratory manual, 3rd ed. Cold Spring 485
Harbor Laboratory Press, Cold Spring Harbor, N.Y. 486
39. Schafer, A., A. Tauch, W. Jager, J. Kalinowski, G. Thierbach, and A. Puhler. 1994. Small mobilizable 487
multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of 488
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 20: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/20.jpg)
20
defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69-73. 489
40. Schneider, J. C., A. F. Jenings, D. M. Mun, P. M. McGovern, and L. C. Chew. 2005. Auxotrophic 490
markers pyrF and proC can replace antibiotic markers on protein production plasmids in high-cell-density 491
Pseudomonas fluorescens fermentation. Biotechnol Prog 21:343-8. 492
41. Silby, M. W., A. M. Cerdeno-Tarraga, G. S. Vernikos, S. R. Giddens, R. W. Jackson, G. M. Preston, X. 493
X. Zhang, C. D. Moon, S. M. Gehrig, S. A. Godfrey, C. G. Knight, J. G. Malone, Z. Robinson, A. J. 494
Spiers, S. Harris, G. L. Challis, A. M. Yaxley, D. Harris, K. Seeger, L. Murphy, S. Rutter, R. Squares, 495
M. A. Quail, E. Saunders, K. Mavromatis, T. S. Brettin, S. D. Bentley, J. Hothersall, E. Stephens, C. 496
M. Thomas, J. Parkhill, S. B. Levy, P. B. Rainey, and N. R. Thomson. 2009. Genomic and genetic 497
analyses of diversity and plant interactions of Pseudomonas fluorescens. Genome Biol 10:R51. 498
42. Squires, C. H., D. M. Retallack, L. C. Chew, T. M. Ramseier, J. C. Schneider, and H. W. Talbot. 2004. 499
Heterologous Protein Production in P. fluorescens. BioProcess International:54-8. 500
43. Wandersman, C., P. Delepelaire, S. Letoffe, and M. Schwartz. 1987. Characterization of Erwinia 501
chrysanthemi extracellular proteases: cloning and expression of the protease genes in Escherichia coli. J 502
Bacteriol 169:5046-53. 503
44. Zhang, W. W., Y. H. Hu, H. L. Wang, and L. Sun. 2009. Identification and characterization of a 504
virulence-associated protease from a pathogenic Pseudomonas fluorescens strain. Vet Microbiol 139:183-8. 505
506
507
508
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 21: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/21.jpg)
21
TABLE 1. Bacterial strains and plasmids used in this study 509
Strain or Plasmid Relevant characteristics Source or Reference
Strains
E. coli
XL1-Blue recA1, hsdR17(rk –, mK +), supE44, lac, [F', proAB + lacIq,
lacZ ΔM15::Tn10(TetR)]
Stratagene
S17-1 thi pro res– mod+ SmR TpR recA1 RP-4-2[Tc::Mu; Km::Tn7] (29)
P. fluorescens SIK W1 Wild-type of P. fluorescens identified in milk (5)
Plasmids
pTOTAL tliDEF and tliA (2)
pK18mobsacB KmR, sacB, lacZα, mob (39)
pKtliA pK18mobsacB with BamHI-HindIII fragment of tliA This study
pKtliAXS
pKΔprtA
tliA central XhoI-SalI fragment deleted from pKtliA
Partial prtA and partial inh inserted in pK18mobsacB
This study
This study
pDX tliDEF, KmR in pDSK519 This study
pDX-TliA tliDEF, tliA, KmR in pDSK519 This study
pDX-GFP-LARD3 tliDEF, gfp-lard3, KmR in pDSK519 This study
pDX-GFP-TliA
pAJH10
tliDEF, gfp-tliA, KmR in pDSK519
tliDEF, tliA, KmR in pDSK519, tliA strongly expressed
This study
(1)
510 511
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 22: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/22.jpg)
22
TABLE 2. Primers used in this study 512
Start and stop codons are italicized and restriction enzyme sites are underlined. 513 514 515
Name Sequence Feature/usage
lip-s GGATCCATGGGTGTATTTGACTACAAG tliA start codon/ΔtliA verification (T-PCR1)
tliA-HindIII AAGCTTACTGATCAGCACACCCTCG tliA last codon/ΔtliA verification (T-PCR1 & 2)
start-tliF ATGAGATCGCTGCTTATTGC tliF start codon/ΔtliA verification (T-PCR2)
prt-s GGATCCATGTCAAAAGTAAAAGAGCAGG prtA start codon/ΔprtA verification (P-PCR1)
Δprt-Xb TCTAGACTCAGTGAAGGTCACGTTGG prtA coding region/ΔprtA amplification
Δinh-Xb TCTAGACAATCGATCGCCTGCGCTG inh coding region/Δinh amplification
inh-HindIII AAGCTTCTAAGGCACGCGGTGTAATA inh stop codon/ΔprtA verification (P-PCR1 & 2)
5’-UTR-prt GGGGTTCCTATCGATCAAAAC 5’ UTR of prtA/ΔprtA verification(P-PCR2)
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 23: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/23.jpg)
23
FIGURE CAPTIONS 516
517
FIG. 1. Construction and verification of the P. fluorescens ΔtliA mutant. A. The deletion process and locations of 518
primer-specific sequences used for PCR verifications. B. PCR products amplified from four different P. 519
fluorescens chromosomes by T-PCR1 primers. The expected lengths are indicated in A. C. PCR products 520
amplified by T-PCR2 primers. D. Lipase plate containing the lipase substrate tributyrate and 50 μg/mL 521
ampicillin. E. LB plate containing 30 μg/mL kanamycin and 50 μg/mL ampicillin. P. fluorescens has innate 522
resistance to ampicillin. Samples: 1, wild-type (Type 1); 2, single recombinant 1 (Type 2); 3, single recombinant 523
2 (Type 3); and 4, ΔtliA mutant (Type 4). 524
525
FIG. 2. Deletion verification by western blot analysis. Intracellular expression (from cell pellet) and 526
extracellular secretion (from supernatant) of TliA were detected using anti-LARD antibodies. Lanes: 1, wild-527
type P. fluorescens; 2, P. fluorescens ΔtliA; 3, wild-type P. fluorescens containing pDX; 4, P. fluorescens ΔtliA 528
containing pDX; 5, wild-type P. fluorescens containing pDX-GFP-LARD3; and 6, P. fluorescens ΔtliA 529
containing pDX-GFP-LARD3. P. fluorescens harboring pDX-GFP-LARD3 were cultured in 2× LB medium 530
(lanes 5 and 6). 531
532
FIG. 3. Export of GFP-TliA and GFP-LARD3 from wild-type P. fluorescens and P. fluorescens ΔtliA. Fusion 533
proteins in extracellular medium were detected using anti-LARD antibodies. A. wild-type P. fluorescens 534
cultured in LB medium. B. wild-type P. fluorescens cultured in 2× LB medium. C. P. fluorescens ΔtliA cultured 535
in 2× LB medium. Lanes: 1, pDX-TliA; 2, pDX-GFP-LARD3; and 3, pDX-GFP-TliA. 536
537
FIG. 4. Construction and verification of P. fluorescens ΔprtA mutant. A. The overall deletion process and 538
location of primer-specific sequences used for PCR verifications. B. PCR products amplified from four different 539
P. fluorescens chromosomes by P-PCR1 primers. The expected lengths are indicated in A. C. PCR products 540
amplified by P-PCR2 primers. D. Skim milk agar containing 50 μg/mL ampicillin. E. Skim milk agar containing 541
30 μg/mL kanamycin and 50 μg/mL ampicillin. P. fluorescens has innate resistance to ampicillin. Samples: 1, 542
wild-type (Type 1); 2, single recombinant 1 (Type 2); 3, single recombinant 2 (Type 3); and 4, ΔprtA mutant 543
(Type 4). 544
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 24: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/24.jpg)
24
545
FIG. 5. Export of TliA, GFP-LARD3, and GFP-TliA from P. fluorescens ΔtliA and P. fluorescens ΔtliAΔprtA. P. 546
fluorescens ΔtliA was cultured in either 8 ml LB or 2× LB. P. fluorescens ΔtliAΔprtA was cultured in 4 ml LB, 547
which was well-aerated. Fusion proteins in extracellular medium were detected using anti-LARD antibodies. 548
Lanes: 1, pDX-TliA; 2, pDX-GFP-LARD3; and 3, pDX-GFP-TliA. The corresponding locations for GFP-TliA 549
(77.4 kDa), TliA (49.9 kDa), GFP-LARD3 (38.2 kDa) are indicated with arrows. 550
551
FIG. 6. Hydrolysis of GFP-LARD3 and GFP-TliA secreted from wild-type P. fluorescens and P. fluorescens 552
ΔprtA. Fusion proteins in extracellular medium were detected using anti-GFP antibodies. A. GFP-LARD3 and 553
GFP-TliA secreted into extracellular medium from P. flourescens ΔtliA and P. fluorescens ΔtliAΔprtA. B. 554
Extracellular GFP-LARD3 and GFP-TliA from P. fluorescens ΔtliAΔprtA treated with trypsin-EDTA. The 555
corresponding locations of GFP-TliA (77.4 kDa), TliA (49.9 kDa), GFP-LARD3 (38.2 kDa), intermediate-sized 556
(~34 kDa, indicated with *), and GFP (26.8 kDa) are indicated with arrows. 557
558
FIG. 7. Comparison of lipase production by wild-type P. fluorescens and deletion mutants. P. fluorescens 559
harboring pAJH10 was cultured in 3 mL LB at 25°C with shaking (160 rpm). A. Lipase activity as a function of 560
incubation time of the extracellular medium from wild-type P. fluorescens (●) and P. fluorescens ΔprtA (△). B. 561
Lipase activity as a function of culture time of wild-type P. fluorescens (●), P. fluorescens ΔtliA (■), P. 562
fluorescens ΔprtA (△), and P. fluorescens ΔtliAΔprtA (○). C. SDS-PAGE analysis of TliA at daily intervals over 563
five days of cultivation. Analysis of culture supernatants from wild-type P. fluorescens, P. fluorescens ΔtliA, P. 564
fluorescens ΔprtA, and P. fluorescens ΔtliAΔprtA was performed using SDS-PAGE. Culture supernatant (16 μL) 565
was loaded onto SDS-PAGE gels and stained with Coomassie Brilliant Blue. 566
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 25: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/25.jpg)
Type 1
Type 4
single recombinant 1Type 2
T-PCR1T-PCR2
1,428bp 907bp2,920bp
single recombinant 2Type 3
T-PCR1T-PCR2
907bp 1,428bp2,399bp
A B C
D E1
2
3
4
1
2
3
4
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 28: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/28.jpg)
24h inSucrose liquid medium
(in Case I)
pKΔprtA
Type 3P-PCR1P-PCR2
1,870bp 725bp1,912bp
single recombinant 2
Type 2P-PCR1P-PCR2
725bp 1,870bp749bp
single recombinant 1
Type 1
Type 4
(bp) 1 2 3 4
1,870
725
(bp) 1 2 3 4
1,912
749
A B C
D E1
2
3
4
1
2
3
4
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from
![Page 30: Lipase and protease double deletion mutant of Pseudomonas ...](https://reader033.fdocuments.in/reader033/viewer/2022051522/5891c0f21a28ab60308b8a60/html5/thumbnails/30.jpg)
GFP-tliA, 77.4 kDa
GFP-LARD3, 38.2 kDa
*GFP, 26.8 kDa
LARD3 LARD3TliA TliA - -+ +
GFP-LARD3
Trypsin
Protein
GFP fusion
GFP-TliA
A B
on April 2, 2018 by guest
http://aem.asm
.org/D
ownloaded from