lgtABCDE Gene Cluster, Involved in Lipooligosaccharide ... › content › jb › 186 › 4 ›...

JOURNAL OF BACTERIOLOGY, Feb. 2004, p. 1038–1049 Vol. 186, No. 40021-9193/04/$08.00�0 DOI: 10.1128/JB.186.4.1038–1049.2004Copyright © 2004, American Society for Microbiology. All Rights Reserved.

The lgtABCDE Gene Cluster, Involved in LipooligosaccharideBiosynthesis in Neisseria gonorrhoeae, Contains Multiple

Promoter SequencesDerek C. Braun† and Daniel C. Stein*

Department of Cell Biology and Molecular Genetics, University of Maryland,College Park, Maryland 20742

Received 1 July 2003/Accepted 6 October 2003

Biosynthesis of the variable core domain of lipooligosaccharide (LOS) in Neisseria gonorrhoeae is mediatedby glycosyl transferases encoded by lgtABCDE. Changes within homopolymeric runs within lgtA, lgtC, and lgtDaffect the expression state of these genes, with the nature of the LOS expressed determined by the functionalityof these genes. However, the mechanism for modulating the amount of multiple LOS chemotypes expressed ina single cell is not understood. Using mutants containing polar disruptions within the lgtABCDE locus, wedetermined that the expression of this locus is mediated by multiple promoters and that disruption oftranscription from these promoters alters the relative levels of simultaneously expressed LOS chemotypes.Expression of the lgtABCDE locus was quantified by using xylE transcriptional fusions, and the data indicatethat this locus is transcribed in trace amounts and that subtle changes in transcription result in phenotypicchanges. By using rapid amplification of 5� cDNA ends, transcriptional start sites and promoter sequenceswere identified within lgtABCDE. Most of these promoters possessed 50 to 67% homology with the consensusgearbox promoter sequence of Escherichia coli.

Neisseria gonorrhoeae is an obligate human pathogen thatcauses diseases of mucosal surfaces (see reference 32 for areview). Because the gonococcus is capable of proliferating indifferent physiological milieus, it has developed a variety ofmechanisms for adapting to these environments. Lipooligosac-charide (LOS) is indispensable for disease pathogenesis. It isimmunogenic, highly pyrogenic, and responsible for the local-ized inflammation and scarring characteristic of gonococcalinfections and for the septic shock that results from dissemi-nated disease (21–23, 31, 39, 45; H. M. Harper, A. L. Padmore,W. D. Smith, M. K. Taylor, and R. Demarco de Hormaeche,unpublished results [presented at the Tenth InternationalPathogenic Neisseria Conference, Baltimore, Md.]). In addi-tion, specific chemotypes of LOS confer complement resis-tance (34) and facilitate intracellular invasion (47). LOS mol-ecules are heterogeneous, with a single cell oftensimultaneously expressing two or more chemotypes in variousproportions (2, 3, 11, 46). LOS also undergoes phase variation,and distinct LOS chemotypes are favored for survival of thegonococcus within different regions of the human body and atvarious points during the pathogenic process (15, 32, 49, 53,55). We believe that the expression of the correct LOS che-motype(s) by the gonococcus at the correct time during infec-tion is essential for establishing and maintaining infection.

Our understanding of the regulatory mechanisms that affectLOS biosynthesis and expression remains incomplete. Biosyn-thesis of the variable oligosaccharide portion of LOS is medi-

ated by seven LOS glycosyl transferase (lgt) genes (7, 13, 20).Strand slippage in homopolymeric tracts within the codingsequence of lgtA, lgtC, lgtD, and lgtG during DNA replicationleads to reading frameshifts in these genes. These changesresult in the production of inactivate glycosyl transferases, thusaltering the LOS chemotype(s) that is expressed by a given cell(7, 11, 13, 56). Gonococcal LOS expression can be furthermodified by specific environmental stimuli, suggesting that reg-ulated gene expression occurs. Gonococci grown under anaer-obic conditions or in the presence of lactate, which is normallypresent in the female genital tract, produce an altered LOSprofile (16, 30). Gonococci grown under acidic and alkalineconditions also express different LOS profiles (35). Finally,gonococci grown at different growth rates express differentLOS epitopes and possess different serum sensitivities (33).The present study investigates the transcriptional organizationof the lgtABCDE genes.

MATERIALS AND METHODS

Bacterial strains, plasmids, oligonucleotides, and culture conditions. All bac-terial strains, plasmids, and oligonucleotide primers used in the present study arelisted in Tables 1, 2, and 3. N. gonorrhoeae strains were grown in phosphate-buffered gonococcal medium (Difco) supplemented with 20 mM D-glucose andgrowth supplements (54) either in broth with the addition of 0.042% sodiumbicarbonate or on agar where they were incubated in a 37° CO2 incubator. AllEscherichia coli strains were grown in Luria-Bertani medium (43). Kanamycinwas used in growth media at a concentration of 30 �g/ml, ampicillin was used at60 �g/ml, spectinomycin was used at 50 �g/ml, and X-Gal (5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside) was used at 35 �g/ml. The optical densities ofgonococcal and E. coli cultures were determined by using a Klett-Summersoncolorimeter fitted with a green filter. One Klett unit corresponds to a culturedensity of ca. 107 CFU/ml. We used the DNA sequence numbering for the F62lgtABCDE region, as described in the National Center for Biotechnology Infor-mation database under accession number U14554 to orient our constructs, pro-moter mapping, etc., to the literature.

* Corresponding author. Mailing address: Department of Cell Biol-ogy and Molecular Genetics, University of Maryland, College Park,MD 20742. Phone: (301) 405-5448. Fax: (301) 314-9489. E-mail:[email protected].

† Present address: Department of Biology, Gallaudet University,Washington, DC 20002.

1038

on June 16, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

Chemicals, reagents, and enzymes. Restriction enzymes and T4 DNA ligasewere purchased from New England Biolabs (Beverly, Mass.). PCR buffers andenzymes and buffers for 5� rapid amplification of cDNA ends (5�-RACE) werepurchased from Invitrogen (Carlsbad, Calif.) and Roche Molecular Biochemicals(St. Louis, Mo.). All chemicals used for the present study were reagent grade orbetter and purchased from Sigma Chemical Co. (St. Louis, Mo.) unless otherwisespecified. The monoclonal antibodies (MAbs) 2-1-L8 and 17-1-L1 were gener-ously provided by Wendell Zollinger of the Walter Reed Army Institute of

Research, Washington, D.C. MAb 1B2 was a gift from J. McLeod Griffiss,University of California, San Francisco.

DNA and RNA isolation procedures. Chromosomal DNA was isolated asdescribed by Rodriguez and Tait (41). Plasmid DNA was isolated by the method ofBirnboim and Doly (8). RNA was purified chromatographically from gonococcigrown to a Klett reading of 100, by using the High-Pure RNA isolation kit (Roche).

PCR. The PCR was generally performed by using Platinum PCR Supermix(Invitrogen) or the Expand Long-Template PCR kit (Roche) according to the

TABLE 1. Plasmids used in this study

Plasmid Relevant phenotype, genotype, or description Source orreference

pGEM7Zf(�) Cloning vector Promegaa

pK18 Cloning vector 38pHP45� Source of the � interposon 37pXYLE20 pK18 containing the xylE gene from Pseudomonas putida 48pCLB2 pGEM2 with a PstI-to-AgeI chromosomal DNA fragment containing lgtABCDE

from N. gonorrhoeae FA1911

pCLB2�1 The 5� region between PstI and BsmI in pCLB2 is deleted This studypCLB2�1 lgtDfix#4 pCLB2D1 containing an engineered NruI site within the polyguanine run of

lgtD; primers LgtDfix-F and LgtDfix-R were used with a pCLB2�1 templatein a PCR; the PCR amplicon was purified, digested with NruI, and self-ligated

This study

pCLB2�1lgtDfix#4�NruI

The � interposon was liberated from pHP45� by SmaI digestion and insertedinto the NruI site of pCLB2�1

This study

pCLB2�1lgtDfix#4�EcoRV

The � interposon was liberated from pHP45� by SmaI digestion and insertedinto the EcoRV site of pCLB2�1 lgtDfix#4

This study

pLgtDE(EcoRI) Primers IgtDE-F and IgtDE-R were used to introduce an EcoRI site intopCLB2D1 lgtDfix#4; the PCR amplicon was purified, digested with EcoRI,and self-ligated

This study

pLgtDE�EcoRI pCLB2�1 lgtDfix#4 was digested with EcoRI and mixed with � interposonthat had been liberated from pHP45� by EcoRI digestion and subsequentlypurified from an agarose gel; the mixture was ligated

This study

pDCB3 A 5,243-bp amplicon containing the lgtABCDE locus was generated by ExpandLong-Template PCR (Roche) with primers JL-50 (contains a 5� EcoRI site)and JL-51 (contains a 5� BamHI site) and was cloned into the EcoRI andBamHI sites of pK18

This study

pDCB7 The 5,243-bp fragment of pDCB3 containing the lgtABCDE region was clonedinto the EcoRI and BamHI sites of pGEM7Zf(�)

This study

pDCB7�ClaI Primer ABC was used to amplify the � interposon (adds AscI, BsrGI, and ClaIsites onto the ends of the � interposon), and this fragment was cloned intothe ClaI site of pDCB7

This study

pDCB7�AscI Primer ABC was used to amplify the � interposon (adds AscI, BsrGI, and ClaIsites onto the ends of the � interposon), and this fragment was cloned intothe AscI site of pDCB7

This study

pDCB9 A 1,487-bp amplicon corresponding to bp 4316 to 5803 of the lgtABCDEregion as described earlier (20) was amplified by using primers LgtDE-F(containing a 5� EcoRI) and Got 5803-R (containing a 5� BamHI) andcloned into the EcoRI and BamHI sites of pGEM7Zf(�)

This study

pDCB10 Primers PostLgtE-F (containing a 5� KpnI and HindIII sequence) andPostLgtE-R (containing a 5� KpnI sequence) were used with a pDCB9template in a PCR to introduce a KpnI site in pDCB9

This study

pDCB10xylE Primers XylE-F and XylE-R were used to amplify the xylE gene frompXYLE20 and cloned into the KpnI and HindIII sites of pDCB10

This study

pDCB17 Primers DCB17b-F (containing a 5� KpnI-HindIII sequence) and DCB17b-R(containing a 5� KpnI sequence) were used to introduce a KpnI site inpDCB7

This study

pDCB17xylE Primers XylE-F and XylE-R were used to amplify the xylE gene frompXYLE20 and cloned into the KpnI and HindIII sites of pDCB17

This study

pDCB19 A �4,000-bp amplicon amplicon corresponding to bp 1650 to 2364 of thelgtABCDE region as described earlier (20) was amplified using primersDCB19b-F (contains a 5� EcoRI) and DCB19b-R (contains a 5�BamHI) andcloned into the EcoRI and BamHI sites of pGEM7Zf(�)

This study

pDCB19�BsrGI Primer ABC was used to amplify the � interposon (adds AscI, BsrGI, and ClaIsites onto the ends of the � interposon), and this fragment was cloned intothe BsrGI site of pDCB19

This study

pDCB19xylE Primers XylE-F and XylE-R were used to amplify the xylE gene frompXYLE20 and cloned into the KpnI and HindIII sites of pDCB19�BsrGI

This study

a Promega, Madison, Wis.

VOL. 186, 2004 CHARACTERIZATION OF lgtABCDE GENE CLUSTER 1039


.org/D

ownloaded from

http://jb.asm.org/

manufacturers’ directions. Primers were purchased from Bioserve Biotechnolo-gies (Laurel, Md.) or from Integrated DNA Technologies (Coralville, Iowa).PCRs were resolved on agarose gels containing 500 �g of ethidium bromide/mlin Tris-borate-EDTA running buffer (43).

Transformation. Competent cells of E. coli DH5-MCR were prepared by themethod of Inoue et al. (27). Recombinant DNA transformation of E. coli wasdone according to the standard heat shock protocol (43). Transformants wereverified by digestion of recovered plasmid DNA with the appropriate restrictionenzymes. Recombinant DNA transformation into N. gonorrhoeae F62 was doneby either the tube or the spot transformation method of Gunn and Stein (24).

Purification of LOS and SDS-PAGE. Gonococcal LOS was prepared fromplated cultures as described by Hitchcock and Brown (25) and diluted 1:25 inlysing buffer. The suspension was boiled for 10 min immediately before 5 �l wasloaded onto a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel. After electrophoresis, the gel was fixed overnight in a solution of40% ethanol–5% acetic acid and then oxidized in 0.83% periodic acid for 5 min.The gel was washed for 2 h in multiple changes of H2O every 20 min, stained for5 min in silver staining solution (22.5 mM NaOH, 0.42% NH4OH, 47 mMAgNO3), and rewashed for 2 h in multiple changes of H2O every 20 min. The gelwas developed (100 ml of 0.005% citric acid–0.007% formaldehyde) until thebands became sufficiently visible and then photographed.

Immunological methods. Colony blots were performed by transferring cellsgrown overnight on GCK agar onto nitrocellulose filters. The filters were airdried for 10 min and blocked with filler solution (20 mM Tris, 150 mM NaCl, 2%nonfat dry milk, 0.2% NaN3, 0.002% phenol red [pH 7.4]) for 30 min. Filterswere blotted with Whatman 3MM paper to remove cellular debris prior toincubation in primary antibody (MAb 2-1-L8 or 17-1-L1) with gentle shaking for2 h or longer. Filters were washed with Tris-buffered saline (TBS; pH 7.4) threetimes for 10 min each time. Membranes were incubated in filler solution con-taining goat anti-mouse immunoglobulin G conjugated with horseradish perox-idase for 2 h. Filters were washed three times for 10 min each time in TBS, andthe membranes were developed by incubating them in 50 ml of 50 mM Tris-HCl–1% 4-chloro-1-naphthol–0.86% H2O2 (pH 8.0).

XylE assay. Qualitative screening for XylE� colonies was performed by spray-ing plates with 50 mM catechol, followed by incubation at 37°C for as short as 1min to as long as 1 h to allow for color development. The presence of a yellowcolor indicated XylE activity. Quantitative assays were performed by inoculatingcells into 20 ml of gonococcal broth plus supplements, with growth to a Klettreading of 100 (indicating an approximate density of 109 CFU/ml). Cells wereharvested by centrifugation, washed once in 10 ml of 50 mM potassium phos-phate (pH 7.5), and resuspended in 2.5 ml of 100 mM potassium phosphate–20mM EDTA–10% (vol/vol) acetone (pH 7.2). Cells were then disintegrated withsix 10-s pulses from a sonicator (Heat Systems, Inc.) set at 40% output; duringthis process, the tube containing the sample was kept submerged in ice water.The resulting crude lysate was clarified of cell debris with two rounds of centrif-ugation, first in a swinging bucket centrifuge at 4,000 g for 5 min and then ina microfuge at 10,000 g for 10 min. The clarified lysate was stored at �80°C.Assays were performed by diluting cell extracts in assay buffer (100 mM potas-sium phosphate, 0.2 mM catechol) such that a linear change in absorbance at 375nm was seen over time. XylE activity was calculated by linear regression of theslope over six time points. One microunit of XylE activity corresponds to theformation of 1 nmol of 2-hydroxymuconic semialdehyde per min at 22°C. XylEactivity was normalized against total protein concentration, as determined by themethod of Bradford et al. (10), with bovine serum albumin (New EnglandBiolabs, Beverly, Mass.) as the standard.

5�-RACE. RACE analyses were performed essentially as described by Fro-hman et al. (18). Synthesis of cDNA was performed with 2 �g of total RNAtemplate, 12 pmol of antisense primer, and 1 U of avian myeloblastosis virusreverse transcriptase (Roche) in reaction buffer supplied by the manufacturer.The reaction was carried out for 1 h at 55°C, followed by 10 min of incubation at65°C. cDNA was purified on a Qiagen spin column according to the manufac-turer’s directions, eluted in 50 �l of 10 mM Tris-Cl (pH 8.0), and polyadenylatedwith 0.5 U of terminal transferase (Roche)/�l using the manufacturer’s reactionbuffer supplemented with 1.5 mM CoCl2 and 6.25 �M dATP. Three microlitersof polyadenylated cDNA was used in a PCR with the d(T) forward primer (seeTable 3) and a gene-specific antisense primer. The resulting products were

TABLE 2. Bacterial strains used in this study

Strain Relevant phenotype, genotype, or description Source orreference

E. coli DH5MCR F� mcrA �(mrr-hsdRMS-mcrBC) endA1 supE44 thi-1 recA1 gyrA relA1�(lacIZYA-argF)U169 deoR�80dlac�(lacZ)M15

BRLa

N. gonorrhoeaeF62 P. F. Sparlingb

F62�lgtA 239-bp ApoI deletion in lgtA; this strain produces L8LOS 47F62�lgtA�lgtE 622-bp BspEI-to-AgeI deletion in lgtE of the parent strain F62�lgtA 47F62�BsrGI F62 containing the � interposon at the BsrGI site between the stop codon

of glyS� and the start codon of lgtAThis study

F62�AscI F62 containing the � interposon within the AscI site of lgtB This studyF62�ClaI F62 containing the � interposon within the ClaI site of lgtC This studyF62�NruI F62 containing the � interposon within an engineered NruI site in the

polyguanine region of lgtDThis study

F62�EcoRV F62 containing the � interposon within the EcoRV site of lgtD This studyF62�EcoRI F62 containing the � interposon within an engineered EcoRI site between

lgtD and lgtE; the termination codon of lgtD contains part of the EcoRIrecognition sequence, and the last base of the recognition sequence is18 bp from the lgtE start codon

This study

F62LgtA(xylE) F62 with the xylE reporter gene inserted at the BsrGI site 58 bases beforethe start codon of lgtA

This study

F62LgtE(xylE) F62 with the xylE inserted into lgtE This studyF62LgtE(xylE)�BsrGI F62LgtE(xylE) containing the � interposon at the BsrGI site 58 bases

before the start codon of lgtAThis study

F62LgtE(xylE)�AscI F62LgtE(xylE) containing the � interposon within the AscI site of lgtB This studyF62LgtE(xylE)�ClaI F62LgtE(xylE) containing the � interposon within the ClaI site of lgtC This studyF62LgtE(xylE)�NruI F62LgtE(xylE) containing the � interposon within an engineered NruI

site in the polyguanine region of lgtDThis study

F62LgtE(xylE)�EcoRV F62LgtE(xylE) containing the � interposon within the EcoRV site of lgtD This studyF62LgtE(xylE)�EcoRI F62LgtE(xylE) containing the � interposon within an engineered EcoRI

site between lgtD and lgtEThis study

a BRL, Bethesda Research Laboratories.b University of North Carolina, Chapel Hill.

1040 BRAUN AND STEIN J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/

subjected to a second round of PCR with the anchor primer and a nested reverseprimer and then resolved on 3% low-melting-temperature agarose gels. Thetranscriptional start site was determined by DNA sequence analysis of the RACEproducts.

RESULTS

Analysis of transcriptional linkage by interposon mutagen-esis. The organization of the genes found in the lgt gene clustersuggested that they would be transcribed as an operon. Anal-ysis of the DNA sequence (up to 500 bp) upstream of theputative lgtA start codon failed to identify any sequences withhomology to known F 70-like promoters. This analysis dididentify a DNA sequence that might form a rho-dependenttermination sequence in the intergenic region between glySstop codon and the putative lgtA start codon (see Fig. 1).However, if this stem-loop structure (26 bp upstream of theputative lgtA start codon) was functioning as a transcriptional

stop signal, it was unclear what DNA sequence could be pro-moting the expression of the lgt gene cluster.

In order to determine whether the stem-loop was function-ing as a transcription termination signal, we introduced astrong transcriptional stop site 6 bp upstream from the start ofthe stem-loop structure by inserting the � interposon into aBsrGI site and analyzed the effect of its insertion on LOSexpression. The location of the insertion event in each trans-formant was verified by PCR amplification of the appropriateregion and restriction digestion of the PCR products. The dataindicate that all transformants analyzed incorporated the �interposon sequence at the appropriate chromosomal location(data not shown). LOS was purified from 10 individual trans-formants and analyzed by SDS-PAGE, and the bands visual-ized by silver staining the gels. Each of the � interposon-derived mutants exhibited an altered LOS phenotype thatpossessed the same SDS-PAGE profile. A representative of

TABLE 3. Oligonucleotide primers used in this study

Primer Site(s) Source orreference

Anchor GACCACGCGTGAATTCEcoRIGTCGAC This studyCB-4 TATTGCGCGCACCGATGCCGACGA 11CB-5 GCCGGCATCGAGGACGTGGAACCTGA This studyd(T) GACCACGCGTGAATTCEcoRIGTCGAC[T]16V This studyDA-1 CAATCATTGGCCGCCGTAGTGGGGCAGACTTGGCGCA 50DA-5 GCCGTAAACTTTCTCAAGCTCCGCCT This studyDCB13-F GATC GGTACCKpnIGATC AAGCTTHindIIIGGGAGAGTAAATTGCAGCCTT This studyDCB13-R TCGA GGTACCKpnI GATAATTTGATGCCGCCTGAAGGC This studyDCB14-F2 GATC GAATTCEcoRI AGGATAATTTCCAATCCCCGC This studyDCB15-F GATC GAATTCEcoRI AGCGGCCCATCCCGATACGGA This studyDCB15-R TCGA GGATCCBamHI AGCTGATAACGTGGTTTTGCA This studyDCB16-F GATC GGTACCKpnI GATC AAGCTTHindIII GAACAGGATAAATCATGCAAAACC This studyDCB16-R TCGA GGTACCKpnI GGTTTCAATAGCTGCGGTATTTCC This studyDCB17b-F GATC GGTACCKpnI GATC AAGCTTHindIII GTATCGGAAAGGAGAAACGGATTG This studyDCB17b-R TCGA GGTACCKpnI CCGTCAATAAATCTTGCGTAAGAA This studyDCB19b-F GATC GAATTCEcoRI CTCCTTACCGAAGAACTCCCG This studyDCB19b-R ATGC GGATCCBamHI GCCGCAAATACGATGTCCATC This studyGot (�180) GATTCAGACGGCATTCGACA This studyGot 310-R AGGCGGTTCAGCAGGTTCAGGCGG This studyGot 660-R CGGAATTTTGAGCTTGTGCA This studyGot 1020 ACACCGAGCGGGATTGGGCGGAAG This studyGot 1576-R GATC GGATCCBamHI GCCAAGCTGATAACGTGGTTTTGC This studyGot 3240-R TGCGCCATCTTTGAAGCATACA This studyGot 3742-R CAATGGCGGCAAGCACGCTT This studyGot 3869-F GTTCGATCCAGCCTATATCCAC This studyGot 3891-R GTGGATATAGGCTGGATCGAAC This studyGot 3997-R TGGAAGAAGTCTGGTCTTGA This studyGot 4232-R AGCAAATCGGTCAAAGAATAC This studyGot 5803-R AGCCCG GGATCCBamHI GCGAACGCTGCATCGTCC This studyGot F AGCT GAATTCEcoRI CTGCAGGCCGTCGCCGTATTCAAACAACTG This studyJL-9 ACCACGTTATCAGCTTGGCT This studyJL-12 AGCGGCCCATCCCGATAC 50JL-50 CT GAATTCEcoRI GGCCGACATCGCGCTTTTGGGCG 47JL-51 AT GGATCCBamHI GGG GCGATTTTACCTAGCAGATGAA 47LgtDE-F GGAAATACCGCAGCTATTGAATTCEcoRI CGA 50LgtDE-R GCATGATTTATCCTGTTCGAATTCEcoRI AAT 50LgtDfix-F GGA TCGCGANruI GAACCGATGCCGACGATATTGCCT This studyLgtDfix-R GGTTC TCGCGANruI TATATTCTCCACCTCCGCCA CCCGACTTTGCCATTCGTCCAGCCCGAT This studyOmegaABC TCAGAT GGCGCGCCAscI TGTACABsrGI TCGATClaI GGTGA TTGATTGACGAAGCTTTATGC This studyPostLgtE-F GATC GGTACCKpnI AAGCTTHindIII CAGAAATGGACACACTGTCATTCC This studyPostLgtE-R TCGA GGTACCKpnI TGATTTTAATCCCCTATATTTTACAC This studyXylE-BSR-F GATC TGTACABsrGI AGGAGGARBS TGACGTCATGAAC This studyXylE-BSR-R TCGA TGTACABsrGI TCAGGTCAGCACGGTCAT This studyXylE-F GATC GGTACCKpnI AGGAGGARBS TGACGTCATGAAC This studyXylE-R TCGA AAGCTTHindIII TCAGGTCAGCACGGTCAT This study



.org/D

ownloaded from

http://jb.asm.org/

the SDS-PAGE profile of one of these mutants (F62�BsrGI)is shown in Fig. 2, lane 3.

The lgtE gene is the most downstream gene in the lgtABCDElocus, and yet it mediates the first biochemical step in theassembly of a growing LOS molecule. If the lgtABCDE locus isan operon driven by a single promoter, then an � interposoninsertion at the BsrGI site should produce a strain whose LOSphenotype resembles the LOS of strains deleted in lgtE (pro-duces LOS that will be referred to as �LgtE LOS). The datapresented in Fig. 2 indicate that F62�BsrGI produces an LOSthat is larger than the �LgtE LOS chemotype, suggesting thatthis strain possesses LgtE activity.

Western blot analysis of LOS expressed by F62�BsrGI in-dicated that the single band seen in Fig. 2, lane 3, reacted withMAb L1-1-17 (data not shown), an MAb that binds to analternate LOS chemotype in neisserial LOS, one that is pro-duced when LgtA is nonfunctional and LgtC is functional.From the data obtained in the analysis of LOS expressed byF62�BsrGI, we concluded that transcription of lgtA must ini-tiate 5� of the BsrGI. These data also indicate that the potentialrho-dependent termination sequence still allows for the tran-scription of sufficient message such that the amount of LgtApresent in in vitro-grown cells is not limiting. BecauseF62�BsrGI was able to produce an LOS that requires tran-scription of lgtC, we concluded that a promoter must exist 3� ofthe BsrGI site. These data indicate that the overall transcrip-tional organization of the genes contained within this genecluster must be driven from multiple promoters.

In order to localize promoter containing regions, we createda family of isogenic strains of N. gonorrhoeae F62 containingthe � interposon inserted at different points within thelgtABCDE locus and observed the resulting LOS phenotypes.

The plasmids used to make the various gonococcal constructsare described in Table 2. LOS was purified from 10 to 12individual transformants for each construct and visualized af-ter separation on SDS-PAGE gels (data not shown). Each ofthe � interposon mutants exhibited an altered LOS phenotypethat was consistent across all of the individual transformants ofeach mutant that was analyzed, indicating that the change inLOS phenotype did not occur due to phase variation. Weverified that the � interposon had inserted into the correctregion by PCR amplification of the lgtABCDE locus of each ofthese mutants, with subsequent restriction digestion analysis ofthe amplicons. The expected restriction pattern was generatedon an agarose gel from the amplicons generated from each ofthe mutants, indicating that the � interposon had been incor-porated into the correct sites (data not shown).

The data presented in Fig. 2 indicate that all strains contain-ing � interposon insertions within lgtABCDE continued toproduce LOS chemotypes that require LgtE activity, exceptwhen the S interposon was inserted into an engineered EcoRIsite immediately upstream of the lgtE ribosome-binding site(F62�EcoRI; Fig. 2, lane 9). Analysis of these results in detailallowed us to map the location of potential promoters. StrainF62�AscI (lane 4) produced two LOS components: one thatpossesses a mobility consistent with a �LgtB LOS (which cor-responds to an LOS structure made when LgtB is nonfunc-tional) and one that possesses a mobility that corresponded to�LgtE LOS. The LOSs expressed by this strain failed to bindMAbs 1B2, 1-17-L1, and 2-1-L8. That this strain does notproduce L1 LOS suggests that lgtC transcription has beeninhibited. By combining these two results (data shown in Fig. 2,lanes 2 to 4), we could map a promoter region to between theBsrGI and AscI sites.

FIG. 1. Genomic organization of the lgt gene region. This diagram is derived from the DNA sequence of the lgt gene cluster as originallypublished by Gotschlich (20), with the NCBI accession number U14554. The sequence numbers given in the figure correspond to those describedin this accession. The features identified in this figure are indicated as follows: a1, glyS stop codon; a2, lgtC stop codon; b, BsrGI restriction site;c, potential stem-loop structure than could function as a transcriptional terminator; d, putative ribosome-binding site; e1, putative lgtA start codon;and e2, putative lgtD start codon.



.org/D

ownloaded from

http://jb.asm.org/

Simultaneous expression of at least two LOS components isseen in four mutant strains (see Fig. 2, lanes 5 and 7 to 9). Inthese strains, a mixture of the �LgtE LOS and a second LOSchemotype that binds MAb 1B2 (Western blot data are notshown) is produced. Since the � interposon is placed moreproximal to the start codon of lgtE, a proportionally greateramount of �LgtE LOS is produced. In fact, the shift in theproportions between these two LOS components occurs in astepwise fashion, suggesting the presence of multiple promot-ers.

Additional promoter regions were mapped by analyzingchanges in the proportion of the two chemotypes that areproduced. F62�ClaI (Fig. 2, lane 5) produces a roughly 60:40proportion of 1B2 LOS (LOS chemotype made when strainexpresses a functional LgtA, and a nonfunctional LgtC andLgtD) and �LgtE LOS chemotypes, indicating inhibition oflgtD transcription and decreased transcription of lgtE versusthat of the parental strain. Strain F62�NruI (Fig. 2, lane 7)produces a roughly 40:60 proportion of 1B2 LOS and �LgtELOS. Strain F62�EcoRV (Fig. 2, lane 8) expresses less 1B2LOS and more �LgtE LOS than strain F62�NruI. StrainF62�EcoRI mutant (Fig. 2, lane 9) only expresses �LgtE LOS.Altogether, the introduction of the � interposon in successivesites between ClaI and EcoRI results in stepwise increases inthe amount of �LgtE LOS that is produced, suggesting acorresponding decrease in LgtE production. These data sug-gest the existence of promoters between each of the � inter-poson insertion sites, except between AscI and ClaI, and sup-port a model of multiple, weak promoters existing throughoutthe lgtABCDE locus. This further suggests that the cumulativecontribution of each of these promoters defines the nature ofthe LOS that is expressed.

Quantitation of gene expression. In order to quantitate thelevel of gene expression within the lgtABCDE locus, we con-

structed three xylE transcriptional fusions. The xylE gene wasinserted immediately upstream of lgtA [F62LgtA(xylE)], at thebeginning of lgtD [F62LgtC(xylE)], and immediately down-stream of lgtE [F62LgtE(xylE)]. Analysis of the LOS profiles ofthese strains by SDS-PAGE and colony blotting (data notshown) showed that the transformants expressed the expectedwild-type LOS profile when the xylE gene was inserted beforeor after the lgtABCDE locus and the �lgtD LOS when the xylEgene was inserted into lgtD (Fig. 3).

We assayed these xylE fusion strains for catechol-2,3-dioxy-genase (XylE) activity (Table 4). The assays showed a differ-ence in XylE activity among the three strains. XylE activity wassevenfold higher in F62LgtA(xylE) than in F62LgtE(xylE) andF62LgtC(xylE). These data indicate that the different geneswithin the lgtABCDE gene locus can be expressed at differentlevels due to different mRNA concentrations. They furtherindicate that most transcription through this region terminatesbefore it extends through the entire region.

Positional effects of the � interposon insertion on XylEactivity in F62LgtE(xylE). The data presented above suggestthe presence of multiple promoter sequences located within

FIG. 2. Phenotypic analysis of LOS produced by � mutants. (A) lgtABCDE gene locus. Inverted triangles represent � insertion points. Thenames above the triangles refer to the names of the F62 insertion mutants. (B) Silver-stained SDS-PAGE gel of LOS isolated from various mutants.Lanes 1, 6, and 10 are an LOS ladder derived from LOS isolated from F62, F62�lgtA, and F62�lgtE. The four bands show the mobilities of theMAb 1-1-M, 1B2, and L8 reactive LOSs and the �LgtE LOS chemotype. The remaining lanes represent LOS species from strains F62 (lane 2),F62�BsrGI (lane 3), F62�AscI (lane 4), F62�ClaI (lane 5), F62�NruI (lane 7), F62�EcoRV (lane 8), and F62�EcoRI (lane 9).

TABLE 4. XylE activity of selected mutants

Strain XylE activitya

(�U)

F62............................................................................................ 0.2F62LgtA(xylE) ........................................................................ 220F62LgtC(xylE)......................................................................... 31.6F62LgtE(xylE)......................................................................... 32.8F62RfaF(xylE)b ....................................................................... 15,400

a One microunit of XylE activity corresponds to the formation of 1 nmol of2-hydroxymuconic semialdehyde per min at 22°C.

b This strain possesses a xylE insertion at the start of the gonococcal rfaF gene(14).



.org/D

ownloaded from

http://jb.asm.org/

the lgtABCDE locus. In order to quantify the relative contri-bution that these sequences might play in overall gene expres-sion, we introduced the � interposon into various chromo-somal locations in F62LgtE(xylE). Each transformant wasanalyzed by PCR amplification of the region of interest, withsubsequent restriction digestion analysis to verify that the in-sertion had incorporated into the correct chromosomal loca-tion. In addition, the SDS-PAGE profiles of each isogenic pair[i.e., F62LgtE(xylE)::�BsrGI compared to F62�BsrGI] wereidentical, indicating that the interposon incorporation was ex-erting the same phenotypic modulation in each pair of strains.The data presented in Fig. 4 indicate that insertion of the �interposon at the BsrGI site did not result in a change in XylEexpression. This further supports the data presented abovethat indicated that transcription terminates within thelgtABCDE region. Insertions that occurred within the codingsequence reduced but did not eliminate XylE expression com-pared to the isogenic parent strain lacking the interposon in-sertion [F62LgtE(xylE)]. As the insertion site of the � inter-poson neared the lgtE coding sequence, the level oftranscription decreased. Insertion of the � interposon in theengineered EcoRI site allowed for XylE activity, suggestingthat weak promoter sequences were located within the lgtEcoding sequence. Overall, these data suggest that multiple pro-moter sequences must occur within the lgtABCDE coding se-quence.

Identification of transcriptional start sites. Initial attemptsto identify the size of transcripts produced from the lgtABCDEregion by Northern hybridization experiments were unsuccess-ful. However, the XylE expression data described above sug-gest that the reason for this failure is due to the low level ofmRNA that would correspond to this region. Therefore, weused RACE, a more sensitive approach, to identify putativetranscriptional start sites.

RACE products were analyzed on an agarose gel (Fig. 5). Inmost of the lanes, multiple DNA fragments were generated by

the RACE reactions. These fragments represent transcrip-tional start sites (TS) within the lgtDE region or RNA poly-merase pause sites. The sequence of the RACE products wasdetermined, and the upstream DNA sequences were analyzedfor homology to known promoter sequences. Six of the sevensites identified by RACE corresponded to upstream sequencesthat showed between 50 and 79% homology with the consensusgearbox promoter sequence of E. coli (1, 9, 29). The sequenceupstream of the seventh fragment (TS-3626) showed overlap-ping sequences with 58 and 75% homology to the �70 consen-sus of Neisseria spp. and the �28 consensus of E. coli, respec-tively (Fig. 6) (4, 6). In light of the fact that promoters with lesshomology have frequently been shown to have high expressionlevels, these results indicate that the identification of thesesites as promoters is realistic.

Due to the extensive homology between lgtA and lgtD andbetween lgtB and lgtE, we hypothesized that promoters foundin lgtDE may have homologous counterparts in lgtAB. Weexamined the lgtAB sequence for homology within the identi-fied regions. Of the seven promoter sequences identifiedwithin lgtDE, only TS-3626 had an identical counterpart withinlgtAB. Two other sequences showed homology with a two-basemismatch (corresponding to TS-4267 and TS-4493). The re-maining regions had counterparts in which three or more basesmismatched in a manner which gave them less homology to theconsensus promoter sequence.

DISCUSSION

The lgtABCDE gene cluster encodes most of the genesneeded to make the gonococcal -oligosaccharide (20). Ourdata indicate that a complex transcriptional control mechanismis responsible for regulating the expression of lgtABCDE. First,we demonstrate that multiple promoter regions exist through-out this cluster. Second, we show that the lgtABCDE genes aretranscribed at minute levels relative to the transcriptional ex-

FIG. 3. (A) Phenotypic analysis of LOSs produced by xylE fusion strains. The dark triangles represent xylE insertion points within the lgtABCDEgene cluster. (B) Silver-stained SDS-PAGE gel of LOSs isolated from these strains. Lanes 1 and 5 represent an LOS ladder derived from LOS thathas been isolated from strains F62, F62�lgtA, and F62�lgtE. The four bands show the mobility of the MAb 1-1-M, 1B2, and L8 reactive LOSsand the �LgtE LOS chemotype. Lane 2 represents LOS isolated from F62LgtA(xylE), lane 3 represents LOS isolated from F62 lgtC (xylE), andlane 4 represents LOS isolated from F62 lgtE (xylE).



.org/D

ownloaded from

http://jb.asm.org/

FIG. 4. Catechol-2,3-dioxygenase activity of xylE fusion strains. Enzymatic activity was detected biochemically by a spectrophotometricprocedure that detects the appearance of 2-hydroxymuconic semialdehyde. Activity is measured in microunits (nanomoles per minute permilligram). Error bars indicate the standard error between triplicate assays.

FIG. 5. RACE products and associated transcriptional start sites. (A) Diagram showing elements of the 5�-RACE experiment. Vertical arrowsrepresent the locations of putative promoters, named according to the relative position of the transcriptional start sites. Open arrows representputative gearbox promoters, and the closed arrow represents the single putative �70 promoter. Horizontal arrows represent the location of thereverse primers which were used. (B) Agarose gel electrophoresis of RACE products. DNA was resolved on an agarose gel. Lanes 1 and 5, 100-bpladder (New England Biolabs). Major bands, from top to bottom, represent PCR products that initiate at cDNA 5� ends (transcriptional start sites),as follows: lanes 2 and 3, TS-4267, TS-4055, and TS-3939; lane 4, TS-3939; lane 6, TS-4267, TS-4493 and unknown; lane 7, TS-4267; lane 8, TS-4055;lane 9, TS-3626; lane 10, TS-3492 and unknown.



.org/D

ownloaded from

http://jb.asm.org/

pression of lsi-1 (rfaF) glycosyl transferase (see Table 4). Sub-tle differences in the level of transcription appear to modulatethe LOS phenotype in terms of the identity and relativeamounts of each of the chemotypes that are simultaneouslysurface expressed.

The � interposon is a spectinomycin cassette (aadA) flankedby rho-independent transcriptional terminators derived frombacteriophage T4. The introduction of the � interposon ineither orientation results in at least a 1,000-fold reduction intranscription, causing polar mutations (17, 18). This interposoncassette has been used to determine linkage relationships andto map the location of promoters in a number of organisms,including N. gonorrhoeae (12, 17, 37, 42). Using � interposoninsertions within the lgtABCDE region, we were able to gen-erate evidence that supports the presence of multiple promot-ers.

As the � interposon is placed more proximal to lgtE, agreater number of transcripts are terminated at the � inter-poson insertion site and overall transcription of lgtE is reduced,hence also the lower amounts of LgtE. When lgtE is tran-scribed in limiting amounts, not enough LgtE is produced toprocess all of the LOS precursors before they are surfaceexpressed. Using xylE as a reporter gene for measuring lgtEtranscription indicated that the overall level of transcription ofthis gene cluster is quite low. The level of XylE expression at

all insertion points within this region is very low. This can beseen when we compared the level of expression of XylE to thatseen when this gene was linked to another LOS biosyntheticgene, rfaF (14). Expression of this gene is almost 1,000 timesgreater than what is seen for the two lgt (xylE) insertions. Ourdata show that lgtE transcription (Fig. 4) and LgtE activity(Fig. 2) decreases if the � interposon is inserted withinlgtABCDE. The amount of the decrease is more if the � in-terposon is inserted closer to the start codon of lgtE. Thisdecrease in LgtE activity is seen as an increase in the propor-tion of �LgtE LOS between any two � interposon insertionmutants, which occurs between five of the six mutants exam-ined. Therefore, promoter activity originates between eachpair of adjacent � interposon insertion sites (see Fig. 2).

Seven potential transcriptional start sites were identified be-tween the ClaI and EcoRI � interposon insertion sites by usingRACE analysis. Each of these transcriptional start sites con-tained �10 and �35 upstream regions that possessed between50 and 79% homology to consensus E. coli and Neisseria pro-moter sequences (see Fig. 5 and 6). Three of these TS hadhomologous promoter sequences within the lgtAB region. Thelocation of these putative promoters identified by RACE to bewithin lgtDE is consistent with the phenotypes and reportergene activities of the F62 lgtE (xylE) � interposon insertionmutants. The identification of a transcriptional start site within

FIG. 6. Putative promoters identified by sequence homology. Putative transcriptional start sites were examined for potential homology toknown consensus E. coli and Neisseria promoter sequences by calculating the percent identity between sequence upstream of TS and knownconsensus promoter sequences. The spacing between the �10 and �35 sequences was required to be within 3 nucleotides of the consensusspacing; this requirement is not reflected in the homology percentages. Nucleotides in boldface represent putative TS identified by RACE.



.org/D

ownloaded from

http://jb.asm.org/

the lgtE coding sequence (TS-4493) indicates a promoterwhich, without further rationalization, appears to serve nobiological function in this strain. However, the existence of thispromoter within lgtE is logical in terms of evolutionary descentbecause extensive homology exists found between lgtB andlgtE. Any existing promoters are likely to be shared betweenthese two genes. It has been demonstrated that intergenicrecombination occurs between lgt genes, giving rise to recom-binant lgt loci (5, 28). Therefore, the putative promoter up-stream of TS-4493 may have had biological function in thecontext of lgtB transcription.

The identification of six out of seven putative promoterregions as gearbox promoters is consistent with recent studiesand with data from the present study. In N. gonorrhoeae, thegearbox promoter has been implicated in the expression of twovirulence factors, AniA (26) and Tpc (19). Gearbox promotersgenerally express at a strength that is inversely proportional togrowth rate (52), a finding consistent with our observationsthat transcription of lgtE (xylE) increases fourfold between themid-logarithmic and early stationary phase (data not shown).

Most significantly, we demonstrated here that limiting thetranscription of lgtE leads to simultaneous production of twoLOS chemotypes in a balance that is contingent upon the levelof transcription. Assays of the xylE fusion strains allowed us tocorrelate visible proportions of LgtE� and �LgtE LOSs withmeasured levels of transcriptional expression (Fig. 2 and 4). Inaddition, these results show that the lgtABCDE genes are tran-scribed at very low levels, demonstrating that subtle changes intranscription are likely to incur significant phenotypic changes.

The transcriptional fusion data also support an earlier studythat demonstrated that a strain of N. gonorrhoeae FA19 withlgtA frameshifted to the “off” position, continued to producetrace amounts of LgtA� LOS (11). Burch et al. speculated thattranscriptional and/or translational strand slippage was occur-ring at a frequency just high enough to allow for visibleamounts of LgtA� LOS. Transcriptional strand slippage by theRNA polymerase holoenzyme would result in a small amountof in-frame lgtA transcript, whereas translational strand slip-page of out-of-frame mRNA by the ribosomes would allow forthe production of in-frame LgtA protein. Since the presentstudy demonstrates that small changes in the amount of LgtEdramatically impact the nature of the expressed LOS, it isfeasible that a low level of transcriptional or translationalstrand slippage of lgtA mRNA could result in sufficient LgtA toaccount for the LgtA�-LgtA� mixed phenotype of thesestrains.

From our data, we are able to formulate a logical explana-tion for why N. gonorrhoeae F62 normally produces a mixtureof the 1-1-M and 1B2 LOS chemotypes. The LgtD glycosyltransferase facilitates the addition of GalNAc to the terminalGal of the chain, converting the chain from the 1B2chemotype to the 1-1-M chemotype. Our data show that thelgtD gene is transcribed at a level �1,000-fold less than that oflsi-1 (rfaF) (14). The low level of lgtD transcriptional expres-sion is such that a distribution of both LgtD� (1-1-M) andLgtD� (1B2) LOS chemotypes are produced. If transcriptionalexpression of lgtD were to be increased, then we would predicta phenotypic shift toward producing a greater proportion ofthe 1-1-M chemotype.

Control of LOS phenotype by limiting transcription is the

likely mechanism in spontaneous L1-reactive phase variants ofN. gonorrhoeae F62. These variants typically express a mixtureof immunotype L1 (LgtC�) and other (LgtC�) LOS chemo-types (D. C. Stein, unpublished data). The data from thepresent study suggests that in this strain, lgtC is transcribed inamounts such that insufficient LgtC is being produced to cat-alyze all its available substrate. It is also possible that lgtC istranscribed and translated in strains that fail to make the L1LOS but that the enzyme is outcompeted for substrate byLgtA.

Sequence analysis of the lgtABCDE region using the NeuralNetwork algorithm (40) revealed 29 sequences that share sig-nificant homology with the �70 promoter consensus of E. coliand Neisseria spp. Remarkably, the polyguanine regions of thelgtA, lgtC, and lgtD genes were among the highest scorers,suggesting that the polyguanine tracts may affect promoterfunctions. These regions all had clearly identifiable �35 and�10 regions, but the spacing between these regions was toolong to suggest that these sequences were functional in thesegenes. There are other examples of promoter regions spanninghomopolymeric runs in the pathogenic neisseriae. The porAand opc genes of N. meningitidis, respectively, contain apolyguanine and polycytosine run between the �35 and �10consensus s70 sequence (44, 51). Frameshifting in these runsalters the spacing between the �35 and �10 sequences andleads to phase shifting between high, low, and intermediatetranscriptional levels. It is feasible that this same mechanismmay be occurring within the lgtABCDE locus and that thesepromoters are up- or downregulated based upon heritablechanges to their sequence.

Our model is consistent with observations made by research-ers who have shown that LOS expression is modulated by theseenvironmental stimuli: growth rate, pH, aerobic versus anaer-obic conditions, and carbon source (glucose versus lactate ver-sus pyruvate) (16, 30, 33, 35). At present, the genetic mecha-nism that mediates this variation in expression is unknown.Most of these promoters identified by the present study aregearbox promoters, which exhibit expression at levels inverselyproportional to growth rate. Since environmental changes caneither increase or decrease the growth rate, changes in theenvironment would influence the level of expression fromthese promoters. Alternatively, additional epistatic factors mayinteract with these promoters and contribute to LOS expres-sion in response to environmental conditions.

Our cumulative understanding of LOS phase variation in N.gonorrhoeae can be summarized as follows: N. gonorrhoeaeregulates LOS biosynthesis and phase variation via a variety ofdisparate mechanisms. The specific LOS components pro-duced by a particular strain are defined by on-off strand slip-page of homopolymeric tracts within the lgtA, lgtC, lgtD, andlgtG genes (7, 13). Simultaneous production of multiple LOSepitopes is mediated by production of limiting amounts of theLgtA, LgtD, or LgtE. This occurs via transcriptional or trans-lational strand slippage (11), via regulation of transcriptionalexpression (the present study), and via the low kinetic efficien-cies of specific glycosyl transferases (36). In addition, recom-bination between glycosyl transferases is seen in some strainsof Neisseria and these recombinant loci may consequently in-voke one or more of the above mechanisms of phase variation(5, 36).



.org/D

ownloaded from

http://jb.asm.org/

ACKNOWLEDGMENTS

We thank Peijun He and Anne Corriveau for excellent technicalassistance.

This study was supported by a grant from the National Institutes ofHealth to D.C.S. (AI24452) and an F31 fellowship to D.C.B.(AI09636).

REFERENCES

1. Aldea, M., T. Garrido, J. Pla, and M. Vicente. 1990. Division genes inEscherichia coli are expressed coordinately to cell septum requirements bygearbox promoters. EMBO J. 9:3787–3794.

2. Apicella, M. A., M. Ketterer, F. K. Lee, D. Zhou, P. A. Rice, and M. S. Blake.1996. The pathogenesis of gonococcal urethritis in men: confocal and im-munoelectron microscopic analysis of urethral exudates from men infectedwith Neisseria gonorrhoeae. J. Infect. Dis. 173:636–646.

3. Apicella, M. A., M. Shero, G. A. Jarvis, J. M. Griffiss, R. E. Mandrell, andH. Schneider. 1987. Phenotypic variation in epitope expression of the Neis-seria gonorrhoeae lipooligosaccharide. Infect. Immun. 55:1755–1761.

4. Arhin, F. F., F. Moreau, J. W. Coulton, and E. L. Mills. 1998. Sequencing ofporA from clinical isolates of Neisseria meningitidis defines a subtypingscheme and its genetic regulation. Can. J. Microbiol. 44:56–63.

5. Arking, D., Y. Tong, and D. C. Stein. 2001. Analysis of lipooligosaccharidebiosynthesis in the Neisseriaceae. J. Bacteriol. 183:934–941.

6. Arnosti, D. N., and M. J. Chamberlin. 1989. Secondary sigma factor controlstranscription of flagellar and chemotaxis genes in Escherichia coli. Proc. Natl.Acad. Sci. USA 86:830–834.

7. Banerjee, A., R. Wang, S. Uljohn, P. A. Rice, E. C. Gotschlich, and D. C.Stein. 1998. Identification of the gene (lgtG) encoding the lipooligosaccha-ride � chain synthesizing glucosyl transferase from Neisseria gonorrhoeae.Proc. Natl. Acad. Sci. USA 95:10872–10877.

8. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure forscreening recombinant plasmid DNA. Nucleic Acids Res. 7:1513–1523.

9. Bohannon, D. E., N. Connell, J. Keener, A. Tormo, M. Espinosa-Urgel,M. M. Zambrano, and R. Kolter. 1991. Stationary-phase-inducible “gearbox”promoters: differential effects of katF mutations and role of sigma 70. J.Bacteriol. 173:4482–4492.

10. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

11. Burch, C. L., R. J. Danaher, and D. C. Stein. 1997. Antigenic variation inNeisseria gonorrhoeae: production of multiple lipooligosaccharides. J. Bacte-riol. 179:982–986.

12. Carson, S. D., P. E. Klebba, S. M. Newton, and P. F. Sparling. 1999. Ferricenterobactin binding and utilization by Neisseria gonorrhoeae. J. Bacteriol.181:2895–2901.

13. Danaher, R. J., J. C. Levin, D. Arking, C. L. Burch, R. Sandlin, and D. C.Stein. 1995. Genetic basis of Neisseria gonorrhoeae lipooligosaccharide anti-genic variation. J. Bacteriol. 177:7275–7279.

14. Danaher, R. J., E. F. Petricoin III, and D. C. Stein. 1994. Use of xylE fusionsto demonstrate that lsi-1, a Neisseria gonorrhoeae lipooligosaccharide biosyn-thetic gene, and lsi-3 are not transcriptionally linked. J. Bacteriol. 176:3428–3432.

15. de Vries, F. P., A. van Der Ende, J. P. van Putten, and J. Dankert. 1996.Invasion of primary nasopharyngeal epithelial cells by Neisseria meningitidisis controlled by phase variation of multiple surface antigens. Infect. Immun.64:2998–3006.

16. Frangipane, J. V., and R. F. Rest. 1993. Anaerobic growth and cytidine5�-monophospho-N-acetylneuraminic acid act synergistically to induce high-level serum resistance in Neisseria gonorrhoeae. Infect. Immun. 61:1657–1666.

17. Frey, J., and H. M. Krisch. 1985. Omega mutagenesis in gram-negativebacteria: a selectable interposon which is strongly polar in a wide range ofbacterial species. Gene 36:143–150.

18. Frohman, M. A. 1994. On beyond classic RACE (rapid amplification ofcDNA ends). PCR Methods Appl. 4:S40–S58.

19. Fussenegger, M., A. F. Kahrs, D. Facius, and T. F. Meyer. 1996. Tetrapac(tpc), a novel genotype of Neisseria gonorrhoeae affecting epithelial cell in-vasion, natural transformation competence, and cell separation. Mol. Micro-biol. 19:1357–1372.

20. Gotschlich, E. C. 1994. Genetic locus for the biosynthesis of the variableportion of Neisseria gonorrhoeae lipooligosaccharide. J. Exp. Med. 180:2181–2190.

21. Gregg, C. R., M. A. Melly, C. G. Hellerquist, J. G. Coniglio, and Z. A. McGee.1981. Toxic activity of purified lipopolysaccharide of Neisseria gonorhoeae forhuman fallopian tube mucosa. J. Infect. Dis. 143:432–439.

22. Gregg, C. R., M. A. Melly, and Z. A. McGee. 1980. Gonococcal lipopolysac-charide: a toxin for human fallopian tube mucosa. Am. J. Obstet. Gynecol.138:981–984.

23. Griffiss, J. M. 1995. The role of bacterial lipooligosaccharides in the patho-genesis of human disease. Trends Glycosci. Glycotechnol. 7:461–478.

24. Gunn, J. S., and D. C. Stein. 1996. Use of a non-selectable transformationtechnique to construct a multiple restriction modification deficient mutant ofNeisseria gonorrhoeae. Mol. Gen. Genet. 251:509–517.

25. Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneityamong Salmonella lipopolysaccharide chemotypes in silver stained polyacryl-amide gels. J. Bacteriol. 154:269–277.

26. Householder, T. C., W. A. Belli, S. Lissenden, J. A. Cole, and V. L. Clark.1999. cis- and trans-acting elements involved in regulation of aniA, the geneencoding the major anaerobically induced outer membrane protein in Neis-seria gonorrhoeae. J. Bacteriol. 181:541–551.

27. Inoue, H., H. Nojima, and H. Okayama. 1990. High efficiency transformationof Escherichia coli with plasmids. Gene 96:23–28.

28. Jennings, M. P., Y. N. Srikhanta, E. R. Moxon, M. Kramer, J. T. Poolman,B. Kuipers, and P. van der Ley. 1999. The genetic basis of the phase variationrepertoire of lipopolysaccharide immunotypes in Neisseria meningitidis. Mi-crobiol. 145:3013–3021.

29. Lange, R., and R. Hengge-Aronis. 1991. Growth phase-regulated expressionof bolA and morphology of stationary-phase Escherichia coli cells are con-trolled by the novel sigma factor sigma S. J. Bacteriol. 173:4474–4481.

30. McGee, D. J., and R. F. Rest. 1996. Regulation of gonococcal sialyltrans-ferase, lipooligosaccharide, and serum resistance by glucose, pyruvate, andlactate. Infect. Immun. 64:4630–4637.

31. McGee, Z. A., C. M. Clemens, R. L. Jensen, J. J. Klein, L. R. Barley, andG. L. Gorby. 1992. Local induction of tumor necrosis factor as a molecularmechanism of mucosal damage by gonococci. Microb. Pathog. 12:333–341.

32. Merz, A. J., and M. So. 2000. Interactions of pathogenic neisseriae withepithelial cell membranes. Annu. Rev. Cell Dev. Biol. 16:423–457.

33. Morse, S. A., C. S. Mintz, S. K. Sarafian, L. Bartenstein, M. Bertram, andM. A. Apicella. 1983. Effect of dilution rate on lipopolysaccharide and serumresistance of Neisseria gonorrhoeae grown in continuous culture. Infect. Im-mun. 41:74–82.

34. Muhlecker, W., S. Gulati, D. P. McQuillen, S. Ram, P. A. Rice, and V. N.Reinhold. 1999. An essential saccharide binding domain for the mAb 2C7established for Neisseria gonorrhoeae LOS by ES-MS and MSn. Glycobiology9:157–171.

35. Pettit, R. K., E. S. Martin, S. M. Wagner, and V. J. Bertolino. 1995. Phe-notypic modulation of gonococcal lipooligosaccharide in acidic and alkalineculture. Infect. Immun. 63:2773–2775.

36. Piekarowicz, A., and D. C. Stein. 2002. Biochemical properties of Neisseriagonorrhoeae LgtE. J. Bacteriol. 184:6410–6416.

37. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with aselectable DNA fragment. Gene 29:303–313.

38. Pridmore, R. D. 1987. New and versatile cloning vectors with kanamycin-resistance marker. Gene 56:309–312.

39. Ramsey, K. H., H. Schneider, R. A. Kuschner, A. F. Trofa, A. S. Cross, andC. D. Deal. 1994. Inflammatory cytokine response to experimental humaninfection with Neisseria gonorrhoeae. Ann. N. Y. Acad. Sci. 730:322–325.

40. Reese, M. G., F. H. Eeckman, D. Kulp, and D. Haussler. 1997. Improvedsplice site detection in Genie. J. Comput. Biol. 4:311–323.

41. Rodriguez, R. L., and R. C. Tait. 1983. Isolation of chromosomal DNArecombinant DNA techniques: an introduction. Addison-Wesley PublishingCompany, Reading, Mass.

42. Ronpirin, C., A. E. Jerse, and C. N. Cornelissen. 2001. Gonococcal genesencoding transferrin-binding proteins A and B are arranged in a bicistronicoperon but are subject to differential expression. Infect. Immun. 69:6336–6347.

43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

44. Sarkari, J., N. Pandit, E. R. Moxon, and M. Achtman. 1994. Variable ex-pression of the Opc outer membrane protein in Neisseria meningitidis iscaused by size variation of a promoter containing poly-cytidine. Mol. Micro-biol. 13:207–217.

45. Schneider, H., J. M. Griffiss, J. W. Boslego, P. J. Hitchcock, K. O. McJunkin,and M. A. Apicella. 1991. Expression of paragloboside-like lipooligosaccha-ride may be a necessary component of gonococcal pathogenesis in men. J.Exp. Med. 174:1601–1605.

46. Schneider, H., T. L. Hale, W. D. Zollinger, R. C. Seid, C. A. Hammack, andJ. M. Griffiss. 1984. Heterogeneity of molecular size and antigenic expres-sion within lipooligosaccharides of individual strains of Neisseria gonorrhoeaeand Neisseria meningitidis. Infect. Immun. 45:544–549.

47. Song, W., L. Ma, W. Chen, and D. C. Stein. 2000. Role of lipooligosaccharidein opa-independent invasion of Neisseria gonorrhoeae into human epithelialcells. J. Exp. Med. 191:949–959.

48. Stein, D. C. 1992. Plasmids with easily excisable xylE cassettes. Gene 117:157–158.

49. Stein, D. C., J. S. Gunn, and A. Piekarowicz. 1998. Sequence similaritiesbetween the genes encoding the S.NgoI and HaeII restriction/modificationsystems. Biol. Chem. 379:575–579.

50. Tong, Y., B. Reinhold, V. Reinhold, B. Brandt, and D. C. Stein. 2001.Structural and immunochemical characterization of the lipooligosaccharidesexpressed by Neisseria subflava 44. J. Bacteriol. 183:942–950.



.org/D

ownloaded from

http://jb.asm.org/

51. van der Ende, A., C. T. Hopman, S. Zaat, B. B. Essink, B. Berkhout, and J.Dankert. 1995. Variable expression of class 1 outer membrane protein inNeisseria meningitidis is caused by variation in the spacing between the �10and �35 regions of the promoter. J. Bacteriol. 177:2475–2480.

52. Vicente, M., S. R. Kushner, T. Garrido, and M. Aldea. 1991. The role of the“gearbox” in the transcription of essential genes. Mol. Microbiol. 5:2085–2091.

53. Virji, M., K. Makepeace, I. R. Peak, D. J. Ferguson, M. P. Jennings, andE. R. Moxon. 1995. Opc- and pilus-dependent interactions of meningococciwith human endothelial cells: molecular mechanisms and modulation bysurface polysaccharides. Mol. Microbiol. 18:741–754.

54. White, L. A., and D. S. Kellogg, Jr. 1965. Neisseria gonorrhoeae identificationin direct smears by a fluorescent antibody counterstain method. Appl. Mi-crobiol. 13:171–174.

55. Yamasaki, R., D. E. Kerwood, H. Schneider, K. P. Quinn, J. M. Griffiss, andR. E. Mandrell. 1994. The structure of lipooligosaccharide produced byNeisseria gonorrhoeae, strain 15253, isolated from a patient with disseminatedinfection: evidence for a new glycosylation pathway of the gonococcal lipo-oligosaccharide. J. Biol. Chem. 269:30345–30351.

56. Yang, Q. L., and E. C. Gotschlich. 1996. Variation of gonococcal lipooligo-saccharide structures is due to alterations in poly-G tracts in lgtgenes encod-ing glycosyl transferases. J. Exp. Med. 183:323–327.



.org/D

ownloaded from

http://jb.asm.org/

lgtABCDE Gene Cluster, Involved in Lipooligosaccharide ... › content › jb › 186 › 4 ›...

Documents

Transcript of lgtABCDE Gene Cluster, Involved in Lipooligosaccharide ... › content › jb › 186 › 4 ›...