Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions...
Transcript of Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions...
![Page 1: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/1.jpg)
YOUR VERY OWN AD AT A FRACTION OF AGENCY
COST
Let us design it for you!Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small fee. Our production services afford you the opportunity to have an ad designed to your specifications without having to go through an agency.
Our team works with thousands of businesses, big and small, to create custom artwork that meets each company’s individual needs. Since 1969 Naylor has designed publications that capture readers’ attention and imagination. Let us do the same for your brand.
naylor.com
![Page 2: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/2.jpg)
*Depending on the project type and requirements, your online ad may be animated (GIF or SWF) with multiple frames. Animation will play for a maximum of 25 seconds, including multiple loops.
For a complete online specifications, please visit www.naylor.com/onlinespecs
Medium Rectangle Banner300 x 250 pixels
Naylor created online ad samples
Medium Skyscraper160 x 600 pixels
Vertical Banner120 x 240 pixels
![Page 3: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/3.jpg)
The Ultimate in California Dreamin’…
From north to south, majestic peaks to sandy
beaches and desert settings, Destination Hotels &
Resorts has California meetings covered. Combined,
the California Collection off ers 300,000 square
feet of fl exible meeting space that showcases
the distinctive landscape of each destination,
like intimate seaside boardrooms and expansive
mountain-view venues. With each stimulating
setting accompanied by award-winning event
services and innovative culinary teams, you’ll fi nd
the hardest part of planning your event is choosing
which inspiring locale will be your backdrop.
Destination Hotels & Resorts California Collection
www.destinationhotels.com
A luxury resort experience in the Coachella Valley, blending the spirituality of the desert with a
Mediterranean environment.
With 33,000 square feet of pure meetings pleasure, discover Lake
Tahoe’s premiere conference destination.
Discover L.A.’s Oceanfront Resort, a meeting destination where you can see,
feel, & experience things diff erently.
Reminiscent of a private estate, this seaside hotel’s mantra “relaxing by day, stylish by
night” encapsulates the experience.
Voted “Best Hotel Venue” by PCMA, this 44-acre island off ers 60,000
square feet of waterfront event space near downtown San Diego.
676828_MIRAMONTE.indd 2-3 1/22/14 2:51 AM
Double-Page Spread Magazine 17" x 11.125" (BLEED INCLUDED, NOT SHOWN)
![Page 4: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/4.jpg)
FrFrFrFrFrFrFFFrFFFFFFFrFrFFromomomomomommomomo nnnnnnnnnnnnororororororororororrrrrorrrthththththththththththttttthttththth ttttttttttttoooooooooo sosososososooooututututututtututttuuttutututth,h,h,hhhh,h,hhh,hhhhhh,hh mmmmmmmmmmmajajajajaaajjesesesesessstitititititiiitiiiiitiiiicc c c c ccc cc pepepepepepppeppp akakakakakkkakkkkks s s s tototototoototo sssssananana dydydydydyyyyyyy bbbbbbbeaeaaaeachchchchchchccchesesesesesese aandndndndnd dddddeseseserereeererert tt t seseseseettttttttt ininininngsgsgsggsggggg ,,,, DeDeDeDeDestststststininininnatatatatatioioioioioooon n n n n HoHoHoHoHotetetetelslslsls &&&&&ReReReReReeReReReReeeResosososososoososososooortrtrtrtrtrtrtrtrtrtrtrtrtrtrtttrrr ssssssss hahahahahaahahahahhhahahas s s s sssssss CCaCaCaCaCaCaCaCCCCCaCalililililililiill fofofofofoofofffof rnrnrnrnnrnrnrrnrnniaiaiaiaiiaia mmmmmmmmmeeeeeeeeeeeetititititititttttitttingngngngngngnggngggs s ss ssss cocococococcoccoccc veveveveeererererereereeeed.d.d.d.dddddddddddd CCCComomoomoomoooooo bibibiineneneeneneneeeed,d,dd, tttheheheheeh CCCCaalallalaaa ifififiiifororoorninininiaaa CoCoCoColllllllllececececectitititit ononononon ooooofffffffferererere ssssss 3033030300,0,0,0,0000000000000000 sqsqsqsqs uauauauauauarererere fefefefefefefefef etetetetetettt ooooooooooof f ff f flflflfllflflflfflflexexexexexexexexxexxibibibibibibbleleleleleleleleeeeeleee mmmmmmmmmmmmmeeeeeeeeeeeeeee tititititititititt ngngnggnggngngngggnggngggg ssssssspapapappppapapppapppp cecececececccccec ttttttthahahahahahahahhhhh tt tt t t shshshshshshhhhhhshowowowowowowwwwwwowwwwcacaccaccaaseseseessssss thththhthhhhe ee e dididididddidisttsttininininini ctctctttivivivvive eeee lalalalalandndndnndscscscsccapapapapapeeeee ofofofoo eeeeacacacach h hhh dededededeststststs ininininini atatatatatioioioioioiii n,n,n,n,n,, lllllllikikikikiii e ee eeeeee ininininininniintititittititititttimamammamamamammmaamateteteteteteeeeee ssssseaeeaeaeeaeeeassisisisisidededededededeee bbbbbbbbbbboaoaoaaaoaoaooooao rdrdrdrdrddrdrorororororooror omomomomomomommmmssssss anananananananannnd d dd dd exexexexxxpapapapap nsnsnsnsnsssiiiivivivivive e e momomomoounununuuu tattattaaininninin-v-vvvvieieiieieewwwww vevevevenununununueseseses.. WiWiWiWiWithhththth eeeeacacacach h h h ststststs imimimimmululululatatatatattinininining g g g seseseses ttttttttininininng g g gggacacacaccacaccccccccacacccccocococococococooompmpmpmpmpmpmpmpmpmppanananannanaanannnnnnnnnnieieieieieieiiiiiiiedd d d dd ddd bybbybybybbybbbyyy aaaaaaaaaaawawawawawawaaw rdrdrdrdrdrdrdrdrrdddrrdrrdrddrdrrd-w-w-wwww-w-wwwwwwwwininininnininni ninininininininininnniingngngngngngngng eeeeeeveveveveveveeevevv ntntntntnn sssssserererervivivivicececeeces ss ananannnd d d d d inininninii nononnnnon vavavaatititiiititiivevevevev ccccculululululinininininararararyy y y y teteteteamamamams,s,s,s,, yyyyououououuu’l’l’l’llllll fififififfifff ndndndndnd ttttheheheheh hahahahahahahahhahahahh rdrdrdrdrdrdrdrdrrdrdrdrrdrr eseseseeseseeseeeeee ttt t tt papapapaappappp rtrtrtrtrtrtrtrrrr oooooooooof f f ff fffff plplplplplplplplppplpp ananananannannnnninininninnnnn ngngngngngngnggnggnngnn yyyyyyyyyyyyoououoououououuouuuo r r r rrr eveveveveeveeeve eneneneneneneneeeeeeee t t t tttt isisisiss cccchohohohohohooooososoossosinininiininining g gg g whwhwhwhhicicicch hh hhhh ininininininspspspspppiririririnininiinnng g g g g lolololoocacacacacalelelelelee wwwwwilililillllll bebebebebe yyyyyouououououuuur r r r r babababaackckckckckkkkdrdrdrdrdropopopop....
The Ultimate in
Dreamin’…California Destination Hotels & Resorts California Collection
www.destinationhotels.com
Paradise Point
Miramonte
yyyyy ppp yyy,,A AA A A AAAA llululululull xuxuxuxuxuxuryryyryryry rrrrrrresesesesesorororororort ttttt exexexexxxxpepepepeeeeriririrririenenenee cecee iin n ththe e CoCoCCCC acacchehhheh lllllla a VaVaVallllleyeyy,blblblbblblleneeneneneee dididididid ngngngngngnggg ttttttttheheheheheheheh sssssspipipipipiipipiipiriririrririrriitututututut alalalaalitititttttitity yyyyyy ofofofofofofff ttttttthehehh ddesesererertt wiww ththh aa
MeMeMeMeMeMMM didididididitetetetetet rrrrrrrrrrrrr annannnnaneaeaeaeaeaeee nnnnnnnnn eneneeneeee viviviroronmnmnmnn enent.t
Miramonte Resort & Spa, Indian Wells, CA wwwwwwwwwwww.ww.w.w.wwww mimimimimmirararararaamomomomomoomoomoooooontntntntntntterererererrresesesesesesorororororro t.t.t.t.t.tt.t cocococococcom mmmmmmm 77777776060666 .3.34141.2.2202000
y ,,VoVoVoteteted d d “B“B“Besesest t t HoHoHotetetel l VeVenunue”e”e” bby yyy PCPCMAMAMA,,thththisisis 44444-4-4-4-acacacrereree iiislsls ananand d dd ofofoffefefersrssrs 660,0,0,0000000 00 sqsquauauau rere ffffeeeeett t ofofof
wawawwaww teteterfrfrfrfrororororontntnt eeeeveveventntnt ssspapapapp cecece nnneaeaeaar r dododownwnwnw totoownwn SSSanann DDDDieiegogoo.
Paradise Point, San Diego, CA wwwww w.w.ww papapaparararadididiid seseses popopooinininint.t.t.cocococ m m m m 88885858585 .5.5.581818181.5.5.5919191000
Resort at Squaw Creek
WWiWiththh 333,3,0000000 0 0 0 sqsqqqsquauauaauauauaaarererererree ffffffeeeeeeeeeeeeeeetttttttofofofofof ppppurure ee ee mememmm etetininininiiininnii gsgsggggg ppplelelleasasururure,eeeeee,, dddddddddisisissisisisscocococcccoveveeveveverrrr LaLaLaLaLLaL kekekekekeke TTTTTTTTahahahahahahhhoeoeoeoeooe’s’s’s’sff ti lll ddddii LL kkkkk TTTTTTT hhhhh ’’’
prprprp emememeemememememmmieiererer cccononnfefefefefefefererererrr ncnccncncee e ee dededededededededd stsstststts inininininiinatatatatatatioioioioioi n.n.n.n.n.n
Resort at Squaw Creek, Lake Tahoe, CA wwwww.w.sqsquauawcwcwcwccrereerererer ekekekkekkekk.c.c.comomomomomomo 555555303030303030.5.5.5.55.58383838333.6.66.666303303030300000000
L’Auberge Del Mar
Terranea
ff ,,,DiDiDiDD scscs ovovererer LL.A.AA.’’’.’’ss s OcOcOcOOceaeae nfnfnffrororontntnt RRRResesesorororrt,t,t,ta aaa mememem etettettininining g g g dedededestststs ininini atata ioioioion n n whwhwhw ererereeee yoyoyoyou u u u cacacac nnn seseses e,e,e, fffeeeeeeel,l,l,l,
& & & exexexe pepeperiririenenenencecece ttthihihiiingngngssss dididiifffffffferererrrenenenene tltltly.y.y.
Terranea Resort, Rancho Palos Verdes, CA wwwwwwwwwww.w.w.ww teteteeterrrrrrrrr anananannneaeaeaeaea.c.c.ccomomomom 333310101010.2.2.226565656565.22.2.281818188100000
fff p ,ReRRR miminin scsccenennt t ofofof aaa ppprir vavv te eeststataa e, tthihh s seseeasaa iddidideehohootet l’’s s mamantn ra “relaaxixingngn by y dadad y,y,y, sstytyylil shshhsh bbbby yy niniighght”t”t
encapsp ulu ateses tthehe eeexpxpperereree iei nce.e
L’Auberge Del Mar, San Diego, CAwwwww.w laubbbergegedelmmarar.c. omomo 888585855 .779393.66.64343434 000
676828_MIRAMONTE.indd 2-3 1/31/14 2:03 AM
Double-Page Spread Magazine 17" x 11.125" (BLEED INCLUDED, NOT SHOWN)
![Page 5: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/5.jpg)
AND TRANSPORT LLC
Worldwide Aircraft Delivery
Jet Test and Transport [email protected]+1(775) 338-5055www.jettestandtransport.com
*ISTAT Members receive 10% discount on our crew-rate for Multi-Aircraft deliveries of 3 Aircraft or more.
Full Turn-Key Service
In-House Delivery Crews
Fuel, Handling, Insurance
Test and Acceptance Profi les
All Transport Category Aircraft Types
737/A320 Factory Delivery Specialists
633733_Jet.indd 1 3/21/13 4:31 PM
Full Page Magazine 8.625" x 11.125" (BLEED INCLUDED, NOT SHOWN)
![Page 6: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/6.jpg)
Serving New York and New Jersey
• Security and Surveillance• Telecom and Data Cabling• Access Control• Audio and Video Automation
I've been really, really impressed with the level of customer service Sector Security has provided to date. Please pass my thanks and congratulations on to your directors. You've made me a loyal customer and I will certainly recommend you to others assuming the product performance is anywhere near as successful as the human support I've received.
Buildings NY Booth #228
877-55-SECTOR (877-557-3286)www.mysectorsecurity.com I [email protected]
677535_Sector.indd 1 1/29/14 1:58 PM
Full Page Magazine 8.625" x 11.125" (BLEED INCLUDED, NOT SHOWN)
![Page 7: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/7.jpg)
License##665588332211##
We are located in Contra Costa County, and provideWWWeCommercial Landscaping Services in the areas oficervicg rv s inSinCo
OOaakkllaanndd,, SSaann JJoossee && SSaann FFrraanncciissccoo..Sa Sa nci SS FFrrass & S nn Fe &ee ann FFFrSaossJJooJon
Professional Horticulture Services
We are llocattedd iin CConttra CCostta CCountty, andd provideWe
Service Area:
LLiicense
de f
de
Website: www.sequoials.com Email: [email protected]
15155551 5
Sequoia Landscape
687979_SEQUOIA.indd 1 4/5/14 11:49 AM
Half Page Horizontal Magazine 7" x 4.583"
![Page 8: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/8.jpg)
You take the requisite time to select just the right paper for a
precise area - your installer should be equally conscientious.
BOOK MARK THIS!DECORADA
We Install Hand PrintsScreen Prints, Digital Prints, Clipso Fabrics
English Wallpapers & Scenic Murals.
DecoRada Wallcovering Installation1376 East 31st Street, Brooklyn, NY 11210
www.decorada.com
917-755-3915 • [email protected]
703242_DecoRada.indd 1 29/07/14 8:26 PM
Quarter Page Vertical Magazine 3.333" x 4.583"
![Page 9: Let us design it for you! - Naylor · Let us design it for you! Naylor Association Solutions provides professional ad assembly and layout services to non-agency clients for a small](https://reader034.fdocuments.in/reader034/viewer/2022052518/5f05da127e708231d4150850/html5/thumbnails/9.jpg)
You’re looking at today’s healthcare
supply chain.
YYYYYYYYYYYooooooooooouuuuuuuuuuu’’’’’’’’’rrrrrrrrrrrreeeeeeeeeeee lllllllllllooooooooooooooooooooooookkkkkkkkkkkiiiiiiiiiinnnnnnnnnnnnggggggggggggaaaaaaaaaaattttttttttt tttttttttttooooooooooooddddddddddddaaaaaaaaaaayyyyyyyyyyy’’’’’’’’’sssssssssssshhhhhhhhhheeeeeeeeeeeeaaaaaaaaaaallllllllllltttttttttthhhhhhhhhhccccccccccccaaaaaaaaaaarrrrrrrrrrrreeeeeeeeeeee
ssssssssssssuuuuuuuuuupppppppppppppppppppppppplllllllllllyyyyyyyyyy cccccccccccchhhhhhhhhhaaaaaaaaaaaiiiiiiiiiinnnnnnnnnnnn........
When you do, you might win a free iPad mini.
Find out how we turn supply chain lemons into lemonade at www.nogpo.com. Then give us your contact information and we’ll enter you in a special drawing for one of 5 new iPad minis.
nogpo.com
683617_NOGPO.indd 1 5/16/14 4:41 PM
Quarter Page Horizontal Magazine 4.583" x 3.333"