The Role of the Legionella Collagen-Like Protein in Legionella pneumophila Biofilm Formation,

Environmental Dissemination and Pathogenicity

by

Mena Abdel-Nour

A thesis submitted in conformity with the requirements for the degree of Masters of Science

Department of Laboratory Medicine and Pathobiology

University of Toronto

© Copyright Mena Abdel-Nour (2013)

 

The Role of the Legionella Collagen-Like Protein in Legionella pneumophila Biofilm Formation, Environmental Dissemination and

Pathogenicity

Mena Abdel-Nour

Masters of Science

Department of Laboratory Medicine and Pathobiology University of Toronto

2013

Abstract

The Legionella collagen-like protein (Lcl) of Legionella pneumophila is an adhesin involved in

multiple processes during the lifecycle of L. pneumophila. Among these processes is the

sedimentation and auto-aggregation of L. pneumophila. Lcl potentiates the infection of amoeba

species by facilitating contact and adhesion to its host, allowing the pathogen to replicate,

disseminate and persist in the environment. Lcl dependent auto- aggregation requires divalent

cations, suggesting it may occur in the natural habitat of L. pneumophila. In addition to its role in

sedimentation, Lcl mediates biofilm production of L. pneumophila. The Lcl encoding gene,

lpg2644 is polymorphic among clinical isolates, and the number of collagenous repeats is

positively correlated to biofilm production and clinical prevalence. This study underscores the

role of Lcl in human infection by contributing to environmental dissemination and persistence,

thereby increasing the likelihood of encountering human hosts.

ii  

 

Acknowledgments

I would like to acknowledge my supervisor, Dr. Cyril Guyard, for his continuous tutelage in both

matters academic and non-academic, without his direction I would not be the scientist I am

today.

I would also like to thank Dr. Mauricio Terebiznik, Dr. Alex Ensminger and Dr. Roberto Melano

for their continuous support and guidance over the course of my scientific training. They have

been instrumental to my learning process, and I am indebted to the help they have given me.

In addition, I would like to thank Carla Duncan and Dr. Mohammed Adil Khan for their valuable

advice throughout my training.

iii  

 

Table of Contents Abstract........................................................................................................................................................ ii

Acknowledgments ..................................................................................................................................... iii

List of Figures ............................................................................................................................................ vi

List of Appendices ................................................................................................................................... viii

Chapter 1: Introduction ................................................................................................................................1

1.1 Legionella pneumophila and legionellosis. ..................................................................................... 1

1.2 Protozoa and L. pneumophila biofilm formation............................................................................ 4

1.3 Attachment and Physiochemical Determinants of L. pneumophila Biofilm Formation and 

Colonization. .........................................................................................................................................6

1.4 Regulation of L. pneumophila Biofilm Formation ........................................................................... 8

1.5 The Role of Non‐Protozoa Microbial Species in L. pneumophila Biofilm Colonization.................11

1.6 The Resistance of L. pneumophila Containing Biofilms to Biocides..............................................12

1.7 Auto‐aggregation and Biofilm Production. ...................................................................................16

1.8 The Role of Lcl in L. pneumophila Adhesion and Virulence ..........................................................16

1.9 The study.......................................................................................................................................18

Chapter 2: The role of Lcl in L. pneumophila auto‐aggregation and host‐phagocyte interactions ............19

2.1 Introduction ..................................................................................................................................19

2.2 Materials and Methods.................................................................................................................20

2.3 Results ...........................................................................................................................................27

2.4 Discussion......................................................................................................................................55

Chapter 3: The Role of Lcl Collagenous Repeats in L. pneumophila Biofilm Production, Attachment and 

Adhesion. ....................................................................................................................................................59

3.1 Introduction ..................................................................................................................................59

3.2 Materials and Methods.................................................................................................................61

3.3 Results ...........................................................................................................................................69

3.4 Discussion......................................................................................................................................89

4 Conclusion................................................................................................................................................93

References ..................................................................................................................................................94

iv  

 

List of Tables

Table 1. L. pneumophila Strains used in Chapter 2.

Table 2. Table 2. Non-L. pneumophila strains used in Chapter 2.

Table 3. The PCR primers used in Chapter 2.

Table 4. L. pneumophila strains used in Chapter 3.

Table 5. PCR primers used in Chapter 3.

Table 6. Comparison of predicted amino acid sequences in Lcl isoforms.

 

v  

 

List of Figures Figure 1. Monospecies biofilm of the L. pneumophila lab strain Lp02 stained with the membrane permeable DNA dye Syto62. Figure 2. Acanthamoeba castellanii infected with Lp02 expressing green fluorescent protein (GFP). Figure 3. Schematic of the endogenous and environmental factors that influence L. pneumophila (Lp) biofilm production and colonization. Figure 4. L. pneumophila sediments more efficiently than Legionella non- pneumophila strains. Figure 5. Lcl is essential for L. pneumophila auto-aggregation. Figure 6. Divalent cations are required for Lcl dependent auto-aggregation. Figure 7. Surface exposed Lcl is required for L. pneumophila auto-aggregation. Figure 8. Lcl alone is sufficient to induce auto-aggregation and biofilm production Figure 9. Production of Lcl alters E. coli sediment ultrastructure. Figure 10. Lcl mediates the attachment of L. pneumophila to Acanthamoeba castellanii. Figure 11. Lcl dependent auto-aggregation potentiates the internalization of L. pneumophila in A. castellanii. Figure 12. Fucoidan inhibits L. pneumophila sedimentation in a dose dependent manner. Figure 13. Lcl dependent auto-aggregation increases the number of L. pneumophila per infected A. castellanii Figure 14. Polymorphisms in the number of lpg2644 collagenous repeats are positively correlated to biofilm production in clinical isolates. Figure 15. Clinical isolates LU1536, LR1063 and LR0347 contain size polymorphisms in their predicted Lcl sequences. Figure 16. Schematic representation of the different Lcl isoforms in this study. Figure 17. The number of Lcl collagenous repeats are correlated with L. pneumophila biofilm production in an isogenic background. Figure 18. Lcl collagenous repeats impact L. pneumophila-abiotic surface interactions.

vi  

 

Figure 19. Lcl collagenous repeats influence L. pneumophila cell-cell interactions and sedimentation. Figure 20. Lcl collagenous repeats mediate L. pneumophila biofilm structure. Figure 21. The number of Lcl collagenous repeats influences fucoidan binding of L. pneumophila and recombinant Lcl. Figure 22. Lcl collagenous repeats influence L. pneumophila clinical prevalence. Figure 23. Lcl influences L. pneumophila surface hydrophobicity.

vii  

 

List of Appendices Abbreviations

PFA (Paraformaldehyde)

Mip (Macrophage infectivity potentiator)

Hsp60 (Heat shock protein 60)

GFP (Green Fluorescent protein)

Lp (Legionella pneumophila)

PBS (Phospate Buffered Saline)

c-di-GMP (Cyclic Di-Guanosine Monophosphate)

Lcl (Legionella collagen-like protein)

IPTG (Isopropyl β-D-1-thiogalactopyranoside)

CFU (Colony Forming Units)

CLSM (Confocal Laser Scanning Microscopy)

GAG (Glycosaminoglycan)

BYE (Buffered Yeast Extract)

BCYE (Buffered Charcoal Yeast Extract)

ELISA (Enzyme Linked Immunosorbant Assay)

OD (Optical Density)

SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylimade Gel Electrophoresis)

BSA (Bovine Serum Albumen)

WT (Wild-type)

KO (Knock-out)

PCR (Polymerase Chain Reaction)

qPCR (Quantitative PCR)

viii  

 

ix  

ECM (Extracellular Matrix)

MOI (Multiplicity of Infection)

TCA (Trichloroacetic Acid)

LB (Luria Bertani)

SAATs (Self Associating Auto-Transporters)

VBNC (Viable But Non-Culturable)

AHLs (Acylhomoserine Lactones)

AHK (α-Hydroxy Ketones)

Lf (Legionella feeleii)

 

Chapter 1: Introduction

1.1 Legionella pneumophila and legionellosis.

On July 1976 an outbreak of a severe respiratory ailment of unknown origin occurred at the 58th

annual convention of the American Legion in Philadelphia (1). The causative agent was later

identified and named Legionella pneumophila, and the associated disease was termed

legionellosis (2-4). Legionellosis has two different clinical manifestations based on the

symptoms that are elicited. The mild form is known as Pontiac fever and the more severe

condition is called Legionnaires’ disease with a case fatality ranging from 5-80% (5). Although

other species of Legionella have been linked to disease, Legionella pneumophila is responsible

for approximately 91.5% of legionellosis cases and is a significant contributor of community

acquired and hospital acquired pneumonia (5, 6). Furthermore, in the United States and Canada,

the number of reported cases has substantially increased in recent years (7). Most diagnoses of

legionellosis are established with the use of a urine antigen test, however the sensitivity of these

tests has recently been called into question (8, 9).

L. pneumophila is an aquatic pathogen that is ubiquitously found in nature, in both anthropogenic

structures and in environmental waters (10-14). In addition, L. pneumophila is able to produce

monospecies biofilms in vitro (Fig. 1.) that contain a visible extracellular matrix (15, 16).

Widespread persistence of L. pneumophila in the environment is due to the ability of this

organism to occupy a number of different ecological habitats. One of these habitats is

1  

 

multispecies biofilm which L. pneumophila is able to colonize. In naturally occurring

multispecies biofilms, the colonization with L. pneumophila can be influenced by several other

species of microorganisms (17, 18). Of these microorganisms, protozoa are arguably one of the

most important in determining L. pneumophila persistence, as the pathogen uses protozoa to

replicate intracellularly (19). Co-evolution with multiple species of protozoa is believed to result

in the development of mechanisms that allow L. pneumophila to occupy a very broad host range,

and to infect human cells (20-22). Growth of Legionella in biofilms may lead to enhanced

virulence. L. pneumophila isolates from serogroups 1, 10 and 12 that were collected from

biofilms were shown to be more cytotoxic towards amoeba than reference outbreak and

worldwide epidemic strains (23). Moreover, initial data suggests that biofilm-derived Legionella

pneumophila evades the innate immune response in macrophages (24). Importantly, legionellosis

is not transmitted from person to person, therefore insights into the ecology of L. pneumophila

may yield information that can be used to prevent infections, by hindering L. pneumophila

maintenance in biofilms.

 

 

 

 

 

 

2  

 

 

Figure 1. L. pneumophila can produce monospecies biofilms. A three day old monospecies 

biofilm produced by the L. pneumophila lab strain Lp02 grown on a glass chambered coverslip 

and stained with the membrane permeable DNA dye Syto62. Scale bar represents 100μm. 

 

 

 

 

 

 

 

 

3  

 

1.2 Protozoa and L. pneumophila biofilm formation.

Protozoa play a crucial role in the lifecycle of Legionella species as they are the natural

environmental hosts of the bacteria (19, 25-28) .In biofilm communities, amoeba species have

been found associated with L. pneumophila (29). To feed, protozoan species often graze on

bacteria present in multispecies biofilms, a phenomenon that L. pneumophila exploits in order to

replicate intracellularly (Fig. 2.) (30, 31). As a consequence, the presence of protozoa in

anthropogenic water sources has been deemed a risk factor for L. pneumophila outbreaks (30). In

fact the amount of L. pneumophila in biofilms has been shown to be directly correlated with the

biomass of protozoa (32). This is in accordance with in vitro models showing that the presence

of amoeba species promotes the biofilm formation of L. pneumophila on pins of “inverse”

microtiter plates (33). L. pneumophila is also capable of growing off the debris from dead

amoebae, thus amoeba may also encourage the replication of L. pneumophila indirectly (34).

Floating biofilms also contain protozoa in association with L. pneumophila suggesting that L.

pneumophila – protozoa interactions may promote colonization in the absence of available

abiotic surfaces (35, 36). In addition to the role of protozoa as a means of replication, the

intracellular stage of L. pneumophila provides protection from environmental stressors (37, 38)

including biocides used to disinfect water systems (39, 40). Indeed, biofilms produced with L.

pneumophila in the presence of thermotolerant amoebae allow L. pneumophila to persist after

heat treatment (41), demonstrating that amoebae can provide a protective niche for L.

pneumophila (37).

4  

 

Figure 2. L.pneumophila uses protozoa to replicate. Acanthamoeba castellanii infected with Lp02 expressing green fluorescent protein (GFP). Infections were performed with an MOI (multiplicity of infection) of 50. A. castellanii were fixed 2 hours post-inoculation for imaging. Scale bar represents 10μm.

5  

 

1.3 Attachment and Physiochemical Determinants of L. pneumophila Biofilm Formation and Colonization.  

When producing surface associated biofilms, attachment serves as an initial crucial step, whether

it is on biotic or abiotic surfaces. Although L. pneumophila can often be found attached to

various surfaces in the environment, colonization of existing biofilms in addition to attachment

to abiotic substrates is determined by a wide variety of parameters (Fig. 3.) (42). One important

factor that governs the adherence of L. pneumophila in anthropogenic water systems is the

composition of the surface material to which the bacteria are adhering (43). L. pneumophila can

adhere well to several different plastics that are commonly used in plumbing, whereas copper

inhibits the attachment of the bacteria (43-45). It remains unclear, however whether this is due to

differences in surface - L. pneumophila interactions or if it is because different plumbing

materials select for different pioneering species. These pioneering microbial species may

establish initial biofilms that L. pneumophila colonizes afterwards, which may have different

properties, subsequently influencing the colonization of L. pneumophila.

Cations have been implicated in the attachment of bacteria to different substrata, and can

contribute to biofouling (46). Similarly, both calcium and magnesium have been demonstrated to

facilitate the attachment of L. pneumophila to abiotic surfaces (47). Elevated zinc, magnesium

and manganese levels are correlated with increased L. pneumophila contamination and zinc

increases the ability of L. pneumophila to bind to human lung epithelial cells (48-50).

Interestingly as it pertains to the cation dependent attachment of L. pneumophila, an orthologue

of the Pseudomonas fluorescens calcium-dependent cyclic di-GMP (c-di-GMP) regulated

protease LapG was identified in L. pneumophila. LapG regulates biofilm formation of

6  

 

Pseudomonas fluorescens by cleaving the surface adhesin LapA required for biofilm formation

(51, 52) .

In addition to the presence of cations, the availability of carbon has also been shown to

influence the colonization of biofilms with L. pneumophila, with increasing concentrations

favouring L. pneumophila colonization, presumably because it provides nutrients for the bacteria

to replicate (53). Notably, the increase in biofilm production due to carbon has only been

reported at 20°C, suggesting that carbon may only influence biofilm production at certain

temperatures (54). Temperature is also an important determinant for L. pneumophila biofilm

colonization. Studies have shown that heating water above 55°C can reduce the detectable

amount of L. pneumophila in water systems even in the presence of organic carbon sources,

however this may be due to a decrease in other biofilm species which may serve as a platform for

L. pneumophila colonization (55, 56).

Static and flow conditions of water have been demonstrated to be crucial determinants of

biofilm formation and biofilm colonization with L. pneumophila in water systems. Stagnation of

water in distribution systems seems to favour colonization with L. pneumophila (57). Moreover,

Legionnaires’ disease cases have been linked to stagnant water in hospital settings (58). In

accordance with these data, a constant flow in anthropogenic water can decrease the presence of

L. pneumophila through the use of Venturi systems, presumably by preventing the initial

attachment of the bacteria to surfaces (59). But even under turbulent flow conditions, biofilms in

aquatic environments can persist (60,,61) and maintain a population of L. pneumophila (62). To

explain the persistence of L. pneumophila under turbulent flow, it was proposed that the bacteria

can localize to the sediment where it is less affected by turbulence (63, 64), and interestingly

sedimentation has recently been linked to quorum sensing (65, 66).

7  

 

Although there have been exhaustive research efforts in determining the physiochemical

parameters that allow L. pneumophila to colonize and form biofilms, little is known regarding

the L. pneumophila molecular factors that contribute directly to this process. The Legionella

collagen-like protein (Lcl) was initially identified as an adhesin required for infection of

protozoa and macrophages (67). Subsequently Lcl was found to be an important mediator of L.

pneumophila biofilm formation (68). Lcl facilitates biofilm production by promoting attachment

to abiotic substrates as well as cell-cell/cell-matrix interactions (69). In addition to Lcl, type IV

pili was initially implicated in L. pneumophila biofilm colonization based in its role in adherence

to protozoan cells (70). Yet, a site directed type IV pili mutant was shown to colonize biofilms as

well as wild-type bacteria (71). In addition to surface exposed adhesins, the twin arginine

transport (Tat) secretion system has also been implicated in biofilm formation. Deletion of the

tatB and tatC genes resulted in a significant reduction in biofilm formation, however the specific

role that this secretion system plays is unknown (72).

1.4 Regulation of L. pneumophila Biofilm Formation  

For L. pneumophila, as well as for other microorganisms, biofilm formation is an environmental

response that can promote survival. To determine if biofilm production is an appropriate

response, there are several environmental cues which can greatly influence biofilm formation.

One important environmental prompt is iron, which has important roles in the growth of many

organisms, and can influence L. pneumophila replication (73). The addition of lactoferrin, an

iron chelator, can directly kill L. pneumophil demonstrating the importance of iron in L.

pneumophila viability (74). Furthermore, bacterial ferrous iron transport promotes the

intracellular replication of L. pneumophila in protozoa which may influence multispecies biofilm

8  

 

formation and colonization, as adherence factors are often regulated by cell density (75). Iron is

also required for the production of melanin and it is believed that deletion of the lbtA and lbtB

genes which encode iron siderophores prevent growth within aquatic biofilms (73). Interestingly,

although iron is essential for biofilm formation, high iron concentrations can inhibit biofilm

formation, yet to date the reasons for this are unknown (15).

The ability of bacteria to monitor and respond to cell density is known as quorum sensing and it

is a crucial process during biofilm production. Among quorum sensing molecules, α-hydroxy

ketones (AHKs) have been identified in L. pneumophila, and are similar to the AHKs produced

by Vibrio cholera (76, 77). These molecules regulate a wide variety of traits including virulence,

extracellular filament production and sedimentation through the lqs gene cluster which encodes

for the AHK synthase LqsA, the AHK sensor LqsS and the response regulator LqsR (65, 78, 79).

In addition to the products of this gene cluster, an orphan sensor kinase named LqsT regulates

competence, a process that is elevated in biofilm formation (66).

The second-messenger molecule cyclic di-GMP (c-di-GMP) is also an important signalling

factor that allows bacteria to respond to environmental changes (80). L. pneumophila has 22

predicted genes related to c-di-GMP production, degradation and/or recognition (81). One of

these genes, lpg1057, was found to encode an enzyme responsible for the production of cyclic

di-GMP which promotes biofilm formation, and is the only c-di-GMP related gene to date found

to directly influence monospecies biofilm production of L. pneumophila (82). In response to

amino acid starvation, the alarmone guanosine tetraphosphate (ppGpp) can also regulate L.

pneumophila gene expression (83). Although the ppGpp system has only been linked to the

regulation of virulence related traits, this system may indirectly effect environmental biofilm

production by influencing L. pneumophila -amoeba interactions. In addition, sensitivity to ppGpp

9  

 

signalling requires the sigma factor RpoS (84). RpoS in turn influences LqsR expression,

suggesting that virulence related traits regulated by AHKs require multiple environmental signals

(85). In parallel with the ppGpp-RpoS regulation of virulence, downstream is the two component

system Let A/Let S (86). The Let A/Let S system relieves the repression of virulence related

genes by the RNA binding protein CsrA (87). Despite the initially suspected roles of these

transcriptional regulators in surface attachment and biofilm formation, none of the mutants

lacking rpoS, letA or csrA were affected in biofilm formation (33). Of the known L. pneumophila

sigma factors, to date only the flagellar sigma factor FliA has been implicated in the regulation

of biofilm production and deletion of fliA results in a decrease in biofilm formation, however it is

unclear what downstream or upstream factors are involved in this process (33).

Temperature was mentioned above as being an important determinant for biofilm formation (55,

56). In addition, temperature can regulate the properties of the biofilms produced by L.

pneumophila (88). Monospecies biofilms produced in vitro at 37-42°C are composed of cells that

are filamentous and biofilms are mycelial mat-like whereas biofilms produced at 25°C are

thinner and made up of rod shaped cells (88). These findings coincide with other studies

demonstrating that the filamentation of L. pneumophila is regulated by temperature (89).

Filamentous growth occurs in other bacterial species to increase fitness against adverse

environmental conditions (90). In turn, intracellular filamentatous L. pneumophila can produce

progeny more efficiently than short rod forms (91). Furthermore the length of L. pneumophila

cells has been linked to ppGpp signalling (87). In vitro, biofilms produced at 37°C are more

robust than at 25°C (33), and interestingly these biofilms produced at 25°C are more

adherent(88). In addition, the production of the L. pneumophila type II secretion system, and

10  

 

type IV pili are temperature regulated, and may influence attachment at different temperatures

(92).

1.5 The Role of Non-Protozoa Microbial Species in L. pneumophila Biofilm Colonization  

Environmental biofilms that are colonized by L. pneumophila often contain several different

bacterial species (93). These bacterial species may promote the persistence of L. pneumophila in

biofilms, while other species inhibit L. pneumophila’s colonization (Fig. 3.). For example,

Flavobacterum breve and cyanobacterial species can promote L. pneumophila growth and

colonization of biofilms by providing a source of nutrients (94, 95). In vitro, the growth of L.

pneumophila is necrotrophic when heat killed Pseudomonas putida bacteria are given as a

nutrient source, suggesting that in its natural environment L. pneumophila is capable of

replicating without the presence of protozoan species (34). Interestingly, summer seasons which

coincide with legionellosis outbreaks favour the proliferation of L. pneumophila in cooling tower

microbial populations while other Legionella species decrease in number (96). Therefore it is

tempting to speculate that L. pneumophila may influence the growth of other Legionella species.

In fact, L. pneumophila produces a surfactant secreted by the protein TolC which is toxic to other

Legionella species, but has no effect on Pseudomonas aeruginosa, Klebsiella pneumoniae and

Listeria monocytogenes and may play a role in the reduction of growth of other Legionella

species in biofilm communities when L. pneumophila populations increase in number (97).

One of the most studied bacteria that can influence L. pneumophila’s biofilm colonization

ability is P. aeruginosa. Although there is a body of evidence suggesting that L. pneumophila

can coexist in biofilms with P. aeruginosa, these studies were performed with inoculums from

11  

 

natural environmental sources which may contain several different bacterial species (18, 45). In

contrast to these studies, “pure culture” monospecies biofilms with P. aeruginosa were shown to

prevent L. pneumophila colonization (33, 98) .This phenomenon may be mediated by

acylhomoserine lactones (AHLs) produced by P. aeruginosa as these AHLs not only inhibit the

growth of L. pneumophila but also its biofilm production (99). Furthermore, specific AHLs

produced by P. aeruginosa can downregulate Lcl production which is essential for biofilm

formation in L. pneumophila (69). Interestingly, the in vitro inhibition of L. pneumophila

colonization by P. aeruginosa is alleviated if K. pneumoniae is present in the biofilm produced

(98). In fact complex multispecies biofilms that contain both P. aeruginosa and K. pneumoniae

are permissive for L. pneumophila colonization (35). The presence of amoeba seems to also

affect whether P. aeruginosa is antagonistic to L. pneumophila colonization, as biofilms which

contain both Acanthamoeba castellanii and P. aeruginosa increase the uptake of L. pneumophila

within A. castellanii, and the colonization of L. pneumophila in biofilms (100).

1.6 The Resistance of L. pneumophila Containing Biofilms to Biocides

There is a great interest in determining methods for disinfecting L. pneumophila containing

biofilms because of the ongoing threat to human health posed by these organisms in

anthropogenic water sources. Due to the intracellular lifestyle of L. pneumophila within protozoa

however, it is difficult to tease out whether the resistance of L. pneumophila in environmental

biofilms is due to the biofilm structure, its association with amoeba or both. It is evident however

that environmental L. pneumophila found in biofilms are extremely resilient to treatment with

biocides (101). L. pneumophila exposed to environmental stresses such as biocides and/or found

within biofilms can enter a viable but non-culturable (VBNC) state (102). This property makes

12  

 

the accurate assessment of the contamination levels with L. pneumophila cumbersome since it

requires the co-cultering of L. pneumophila with amoeba to lift the VBNC state (103).

Recently, nanoparticles have been suggested to be powerful tools to prevent L. pneumophila

biofilm formation, as nanoparticles such as silver are able to disrupt L. pneumophila -amoebae

interactions and biofilm structure (104, 105). Nanoparticles can also effectively clear L.

pneumophila from mixed species biofilms and appear to be an attractive treatment option for

disinfecting anthropogenic water sources (106, 107). The most common biocides used to control

water-borne pathogens are chlorine derivatives, and chlorine derivatives are more efficacious

than UV for disinfecting L. pneumophila (108, 109). Yet chloramine, one of the most potent

chlorine derivative biocides, does not completely eradicate L. pneumophila from aquatic biofilms

(110, 111).

The location of the biofilm can also play a role in resistance to disinfection strategies. This is

particularly the case for biofilms formed in sediments which provide protection to

L.pneumophila from UV radiation (112). Furthermore, L. pneumophila grown on a solid surface

is more resistant to killing by iodine than bacteria grown in broth, suggesting that there are

metabolic differences between surface associated and planktonic phase bacteria (113). This is

consistent with data suggesting that sessile and planktonic L. pneumophila in biofilms have

different gene expression profiles (15).

13  

 

14  

 

Figure 3. Factors that influence L. pneumophila biofilm formation and colonization. L. pneumophila (denoted by Lp and shown in orange) can invade and replicate within environmental protozoa in the environment, which can be promoted by other microbial species such as P. aeruginosa (top left) and by alterations in gene expression due to environmental cues such as quorum sensing (top right). In addition environmental cues can also influence changes in L. pneumophila cell metabolism that favour biofilm production and colonization, which may occur following replication within protozoa or independently of protozoa infection (middle). Other microbial species such as P. aeruginosa can inhibit L. pneumophila colonization by altering their gene expression (bottom left). This inhibition of L. pneumophila biofilm colonization in turn, can also be influenced by the presence of other microorganisms such as K. pneumoniae which alleviates the inhibition by P. aeruginosa and allows L. pneumophila to be incorperated within biofilms. Physio-chemical parameters such as divalent cations can favour L. pneumophila biofilm colonization while other factors such as the presence of nanoparticles and copper can hinder L. pneumophila colonization.

15  

 

1.7 Auto-aggregation and Biofilm Production.  

During biofilm production, cell-cell interactions are crucial in determining biofilm architecture

(114, 115). These interactions are often mediated by adhesins located on the surface of the

bacteria (116, 117). Cell-cell interactions allow the bacteria to form aggregates, in a process

known as auto-aggregation (118). To analyze auto-aggregation, the sedimentation of bacterial

suspensions can be measured, as bacterial aggregates tend to settle. One family of surface

adhesins that mediate auto-aggregation is the Self Associating Auto-Transporters (SAATs),

which facilitate auto-aggregation through polymerization (119, 120). Auto-aggregation has

phenotypic properties similar to biofilm formation, and frequently the degree of auto-aggregation

is correlated with the degree of biofilm production (121, 122). In fact, there has been no strain

constructed, or identified to date that is deficient in biofilm production but is capable of auto-

aggregation, or vice versa and currently, it is believed that auto-aggregation is an indicator of the

biofilm capabilities of bacterial strains (116, 123).

1.8 The Role of Lcl in L. pneumophila Adhesion and Virulence  

In addition to surviving and disseminating in their natural habitats, environmental pathogenic

bacteria need to adhere and colonize host cells in order to establish infection (124). The ability of

bacteria to anchor themselves to host receptors or matrices is mediated by surface exposed

adhesion proteins. In addition to their roles in adherence to host cells, these proteins often also

mediate biofilm formation. L. pneumophila is able to bind to lung epithelial cells, alveolar

macrophages and extracellular matrices in mammalian cells during infection (125-127). In vitro,

the addition of exogenous heparin inhibits the binding of L. pneumophila to lung epithelial cells

16  

 

(48, 128). In a mouse infection model, pre-incubation of L. pneumophila with heparin decreased

the mortality rate, protected the alveolar–capillary barrier, prevented systemic bacterial

dissemination and stimulated Th1 cytokine production (219). Together, these results show that L.

pneumophila produces GAG-binding adhesins that are essential to the pathogenesis of

Legionella infections.To date there have been several adherence factors identified in L.

pneumophila, including type IV pilus, rtxA, Hsp60, LaiA and mip (129-137). While rtxA, Hsp60

and mip mediate attachment to both macrophages and lung epithelial cells (129-135), LaiA and

type IV pilus are involved in the attachment of L. pneumophila to protoza and macrophages

(136, 137). Yet among the identified L. pneumophila adhesins only Lcl has been demonstrated to

bind to host GAGs (68).

The Legionella collagen like protein or Lcl, was recently identified by heparin affinity

chromatography, demonstrating that L. pneumophila Lcl is a GAG binding protein (67, 68). Lcl

is located on the outer membrane of L. pneumophila, and is exposed to the extracellular milieu

(67, 69). In addition, Lcl also mediates biofilm production and attachment to abiotic surfaces (68,

69). Lcl contains 3 domains, an N-terminal region, a central domain containing tandem

collagenous repeats and a C-terminal domain with no identified function. Both the collagenous

repeat domain and the C-terminal domain were found to be essential for biofilm production,

although their precise roles in this process are unknown (68, 69). Lcl’s collagenous repeat

domain is polymorphic among clinical isolates and initial data suggests that these

polymorphisms confer differences in attachment to host cells (67, 68, 138).

17  

 

1.9 The study

Purpose: The purpose of this study was to investigate the role of Lcl in L. pneumophila ecology

and pathogenicity, and to characterize the role of the Lcl’s collagenous repeats.

Hypothesis: Based on previous studies, it can be hypothesized that Lcl plays an important role in

the environmental survival and persistence of L. pneumophila. This may be achieved by

promoting L. pneumophila-host cell interactions and by promoting multicellular behaviour such

as biofilm production and auto-aggregation. In addition Lcl collagenous repeats may influence

processes mediated by Lcl, as past studies have indicated that the distribution of Lcl collagenous

repeats is not uniform among clinical isolates.

There are 3 goals of this study:

A. Characterize the role of Lcl in L. pneumophila sedimentation and auto-aggregation.

Discussed in Chapter 2.

B. Investigate the role of Lcl in L. pneumophila –amoeba interactions.

Discussed in Chapter 2.

C. Explore the impact of variations in Lcl collagenous repeats on Lcl mediated processes.

Discussed in Chapter 3.

18  

 

Chapter 2: The role of Lcl in L. pneumophila auto-aggregation and host-phagocyte interactions

 

2.1 Introduction  

The ability of bacterial cells to come into contact and form aggregates, or auto-aggregation has

been implicated in environmental and host dissemination, and is relatively common among

Gram-negative pathogens such as Haemophilus influenza (139), Pseudomonas aeruginosa (140)

, Haemophilus cryptic genospecies(141) and enterohaemorrhagic Escherichia coli or EHEC

(142). Auto-aggregation also plays a major role in virulence (143, 144) and this phenomenon has

phenotypic properties similar to biofilms (145, 146). Furthermore, the ability to auto-aggregates

is frequently correlated with the strength of biofilm production (122, 147, 148). Auto-

aggregation may involve surface exposed proteins such as the self associating auto-transporter

(SAAT) family of adhesins (116). SAATs are a versatile group of proteins which are involved in

biofilm production and adherence to human cells in addition to auto-aggregation (117, 119, 149).

Despite the role that auto-aggregation has in pathogenesis, the molecular determinants of inter-

bacterial interactions remain only partially understood.

The Gram-negative pathogen Legionella pneumophila is a major cause of community acquired

pneumonia (5, 6) and has been shown to auto-aggregate (66, 150). Legionellosis is acquired by

inhaling contaminated aerosols (11) and to date there have been no reported cases of human to

human transmission. In the environment, L. pneumophila is localized in the sediments of hot-

water tanks and water distribution systems, which are believed to be sources of the pathogen

19  

 

during outbreaks (14, 64). In natural and in man-made water systems, L. pneumophila can be

isolated from different protozoa (19, 20, 151). This intracellular stage plays a crucial role in L.

pneumophila’s life cyle, since the bacteria utilize protozoan hosts as a mean to replicate and

disseminate in the environment (63). Despite the association that auto-aggregation has with

pathogenesis, there are only few studies to date exploring the molecular determinants, the nature

and the roles of this process in L. pneumophila. The Legionella collagen-like protein (Lcl) is

involved in both biofilm production and adherence to human cells (67-69), two processes which

are characteristic of proteins implicated in auto-aggregation (116, 139). Based on these initial

findings, we hypothesized that the Lcl adhesin may play a role in auto-aggregation. We show

that surface exposed Lcl is essential and sufficient for auto-aggregation and that this process

requires divalent cations. Using amoeba infection models, we reveal that Lcl dependent auto-

aggregation and attachment may represent a key determinant of L. pneumophila’s life cycle and

virulence by promoting contact and adhesion between the pathogen and its natural hosts.

2.2 Materials and Methods  

Chemicals, bacterial strains and growth conditions.

Unless otherwise indicated, all chemicals were purchased from Sigma. All Legionella

pneumophila (Table 1) and other Legionella isolates from other species (Table 2) were cultured

in buffered charcoal-yeast extract (BCYE) agar at 37 °C and 5% CO2 and or with buffered yeast

extract (BYE) broth at 37°C with shaking at 100 rpm (152). Cultures of Lp02 were

supplemented with thymidine when required (153). Escherichia coli strains (Table 2) were

cultured on Luria Bertani (LB) agar at 37°C and 5% CO2 and or with LB broth at 37°C with

shaking at 225rpm.

20  

 

General DNA techniques.

Genomic DNA and plasmid DNA was purified using a QIAamp DNA minikit and a QIA prep

spin miniprep kit (Qiagen) respectively. To quantify DNA, spectrophotometry was used. For

PCR, 10ng was used as a template and PCR reactions were performed with Taq DNA

polymerase as recommended by the manufacturer (Invitrogen). The PCR primers used are found

in Table 3. PCR amplifications for cloning were performed with Platinum Taq DNA polymerase

high fidelity as per the manufacturer (Invitrogen). All clones were verified by sequencing.

Sequencing reactions were performed using a BigDye terminator cycle sequencing kit, version

3.1 and purified with a BigDye X terminator purification kit and run on a 3130xl genetic

analyzer (Applied Biosystems). To generate an E. coli strain expressing lpg2644, primers 3 and 4

were used to PCR amplify lpg2644 from the PCR2.1-lpg2644 vector. The resulting PCR product

was cloned into the PCR2.1 vector and digested with Bsph1 and EcoR1. The digested fragment

was then ligated into an NcoI and EcoR1 digested pTrc plasmid under the regulation of the

leaky-IPTG inducible promoter, trc.

Bacterial sedimentation assays.

Sedimentation assays were performed as previously described with a few modifications (66,

150). L. pneumophila strains were grown for three days and colonies were suspended to an

OD600nm of 1 in deionised water with 10% BYE or deionised water with the addition of the

indicated salts. For sedimentation assays with mixed populations, bacterial suspensions were

adjusted to an OD600nm of 1 and an equal volume of each suspension was added to test tubes and

allowed to settle. To visualize sedimentation in E. coli strains, overnight plate cultures were

21  

 

suspended in deionised water with10% LB to an OD600 of 1 with or without the addition of 1mM

isopropyl β-D-1-thiogalactopyranoside (IPTG). Images were taken immediately after the

indicated time period with all incubations being performed at room temperature. To measure

sedimentation kinetics, sedimentation assays were performed as described above, and the

OD600nm was measured every hour with a spectrophotometer, where a decrease in OD600nm

indicates an increase in sedimentation.

SDS-PAGE and immunoblot analysis.

SDS-PAGE was performed as previously described (154). Immunoblotting was performed

according to the methods of Towbin (155). To detect the presence of specific proteins, cell

lysates were prepared with broth cultures adjusted to an OD600nm of 4.5, centrifuged at 5000 rpm

for 10 minutes, washed twice with PBS and an equal volume of 2X Laemmli loading buffer with

10% 2-mercaptoethanol was added. E. coli cultures were induced with 5 mM IPTG during

exponential phase and after 3 hours cells were centrifuged, washed twice with PBS and mixed

with an equal volume of 2X Laemmli loading buffer with 10% 2-mercaptoethanol. All samples

were then boiled for 15 minutes before running on gel. Bound antibodies (1:20,000 for anti-Lcl

and 1:50, 000 for anti-icdh) were detected with peroxidase-linked anti-rabbit IgG (1:20,000). To

determine if Lcl is secreted during sedimentation, sedimentation assays were performed as

described above, and after 5 hours the suspension was pipetted vigorously to resuspend the

sediment cells. Afterwards 1 ml of suspension was centrifuged for 5 minutes at 13,000rpm and

the cell pellet was resuspended in 100 µl of PBS. The supernatant was then precipitated by

adding 100% Trichloroacetic acid (TCA) to a final concentration of 13% and incubated at -20°C

22  

 

overnight. Samples were then centrifuged for 15 minutes at 4°C and resuspended with an equal

volume of PBS as the cell pellet.

Immunofluorescence assays.

To detect Lcl on the surface of E. coli strains bacteria from plate cultures were washed twice and

resuspended in PBS. The inner membrane impermeable dye FM 4-64 (Molecular probes) was

used to label the cells and afterwards bacteria were incubated with anti-Lcl antibodies (1:50) and

anti-rabbit alexa-flour (Molecular probes) antibodies (1:500), as previously described (Mallegol

et al., 2012).

Biofilm quantification.

All biofilm assays were performed using polystyrene 96-well plates (Costar). E. coli strains were

grown for 16 hours in LB broth and adjusted to a final OD of 0.2 in fresh LB with or without the

addition of 5mM IPTG. 96-well plates were incubated at 37 °C and 5% CO2 for 1 day. Biofilms

were stained with 40 µl of 0.25% crystal violet per well for 15 minutes and washed three times

with 200 µl of sterile deionised water. The crystal violet stain was then solubilised in 95%

ethanol and after 15 minutes, absorbance was read at 600nm. The results of three independent

experiments were pooled with 8 replicates each.

Scanning electron microscopy.

23  

 

E. coli strains were left to sediment in 90% deionised water with 10% LB onto 12mm glass

coverslips (Warner instruments). Afterwards, coverslips were heat fixed, fixed with 4%

paraformaldehyde (PFA) for 30 minutes and scanning electron microscopy was performed as

previously described (91).

Acanthamoeba castellanii infection assays.

Acanthamoeba castellanii was grown in peptone yeast extract glucose (PYG) medium at room

temperature and one day before infection 24-well tissue culture plates were seeded with 1 ml of

A. castellanii suspension adjusted to a cell density of 5x105 cells / ml (156). L. pneumophila

strains grown to stationary phase were added to A. castellanii at an MOI (multiplicity of

infection) of 50 in deionised water and deionised water with 500 µM MgCl2 and allowed 2 hours

to infect. To determine if differences in infection between conditions were due to sedimentation

or initial binding, infections were also performed with centrifugation at 880 Xg for 10 minutes

before allowing 2 hours for infection. Afterwards L. pneumophila internalization was measured

by flow cytometery similar to as previously described (66, 150) with the addition of a 1 hour 100

µg/ml gentamicin treatment to kill extracellular bacteria. All L. pneumophila strains used

contained a plasmid expressing GFP (green fluorescent protein) under a constitutive promoter

and internalization was defined as the acquisition of fluorescence by A. castellanii compared to

the uninfected control. To measure the infection of A. castellanii by microscopy, A. castellanii

were seeded onto 12 mm glass coverslips inside 24-well tissue culture plates and the same

procedure as described above was performed and afterwards cells were fixed with 4% PFA. One

hundred A. castellanii were counted per replicate and infection was presented as percent of total

24  

 

A. castellanii infected. Experiments were performed in triplicate. To determine the effect of

aggregation on infection in the Lp02∆lpg2644 strain, infection assays were performed as

described above in deionised water with or without the addition of anti-L.pneumophila serogroup

1 agglutinating antibodies (1:1000) (91).

Table 1. L. pneumophila Strains used in this study

MR code Species Designation Plasmid Source or reference

23 L. pneumophila Lp02 (153)

52 L. pneumophila Lp02Δlpg2644 (68)

73 L. pneumophila Lp02 pBH6119 pBH6119 (68)

69 L. pneumophila Lp02Δlpg2644 pBH6119

pBH6119 (68)

76 L. pneumophila Lp02 plpg2644 pBH6119 lpg2644 (68)

77 L. pneumophila Lp02Δlpg2644

plpg2644

pBH6119 lpg2644 (68)

133 L. pneumophila Lp02 pRFP pKB288 (pBH6119 mCherry)

This study

134 L. pneumophila Lp02Δlpg2644 pRFP pKB288 (pBH6119 mCherry)

This study

36 L. pneumophila Lp02 pGFP pBH6119 GFP (69)

70 L. pneumophila Lp02 Δlpg2644 pGFP pBH6119 GFP (69)

124 L. pneumophila Lp02Δlpg2644 clpg2644 pGFP (chromosomal insertion of lpg2644)

pBH6119 GFP (69)

L. pneumophila L. pneumophila sg1-9* (68)

L. pneumophila L. pneumophila sg2 (68)

25  

 

L. pneumophila L. pneumophila sg3 (68)

L. pneumophila L. pneumophila sg4 (68)

L. pneumophila L. pneumophila sg5 (68)

L. pneumophila L. pneumophila sg6 (68)

L. pneumophila L. pneumophila sg8 (68)

L. pneumophila L. pneumophila sg10 (68)

L. pneumophila L. pneumophila sg12 (68)

* cross reactive with serogroups 1-9 Table 2. Legionella isolates from species other than pneumophila and E. coli strains used in this study

MR code Species Designation Plasmid Source or reference

40 E. coli (TOP10) E. coli pTrc pTrc This study

79 E. coli (TOP10) E. coli plcl plcl This study

L. erythra LR1359 (68)

L. feeleii LR0568 (68)

L. feeleii Lf pBH6119 This study

L. feeleii Lf plpg2644 This study

L. erythra LR1317 (68)

L. rubrilucens LR1406 (68)

L. maceachernii LR0193 (68)

L. anisa LR0398 (68)

L. bozemanii sg1 LR0651 (68)

L. bozemanii sg2 LR0405 (68)

Table 3. Primers used in this study

Code Primer Amplification target

Sequence 5’ to 3’

26  

 

1 lpg2644 F lpg2644 GAAATAAAGAATGATACATCGA

2 lpg2644 R GCAAAGCGAATTTATGAACA

3 lpg2644 Bsph1 F

TGCGTATCATGATACATCGAAATAAAGTC

4 lpg2644

EcoR1 R

GTTACGAATTCTTAAAAGGCTCTTACAGCAC

 

 

 

2.3 Results Legionella pneumophila auto-aggregates more than a selected panel of non-pneumophila

Legionella species.

Taking in account that auto-aggregation is associated with increased virulence and biofilm

formation in other bacterial species (117, 120), we first sought to determine whether Legionella

species differ in their abilities to form auto-aggregates. The conventional experimental strategy

to evaluate bacterial auto-aggregation is to perform sedimentation assays with bacterial

suspensions (118, 119, 144). To this end, we compared the sedimentation of L. pneumophila

with Legionella isolates from other species using a sedimentation assay adapted from a

previously described method (66, 150). L. pneumophila isolates of serogroups 1 (Lp02), 1-9 (that

cross reacts with serogroups 1-9) and eight Legionella isolates from other species were

suspended in deionised water with 10% BYE (buffered yeast extract) and allowed to settle

(Table1 and 2). After an overnight incubation, the L. pneumophila isolates sedimented while L.

erythra, L. feeleii, L. rubrilucens, L. maceachernii, L. anisa and L. bozemanii strains showed

27  

 

poor sedimentation (Fig. 4A).Considering that these non-pneumophila species are poor biofilm

producers and are rarely diagnosed in legionellosis patients, these data raise potential

correlations between the ability to produce auto-aggregates and the environmental

colonization/persistence of Legionella bacteria (67-69). We next compared the sedimentation of

L. pneumophila isolates from serogroups 1 (Lp02), 1-9, 2, 3, 4, 5, 6, 8, 10, and 12 which were

previously shown to produce Lcl (67-69). All the tested isolates with the exception of L.

pneumophila sg 3 and L. pneumophila sg8 were capable of sedimentation (Fig. 4B). Although

most serogroup are able to auto-aggregate, this suggests that differences in O-antigen decoration

may have an impact of the aggregation of L. pneumophila serogroups with low clinical

prevalence such as sg3 and sg8 compared to sg1 or sg6 (147, 157).

28  

 

Figure 4. L. pneumophila sediments more efficiently than Legionella non- pneumophila strains. (A) Sedimentation assays with Lp02, an L. pneumophila isolate that cross reacts with serogroups 1-9 (L. pneumophila sg1-9), eight isolates from other Legionella species and with (B) L. pneumophila isolates from serogroups 1(Lp02), 1-9, 2, 3, 4, 5, 6, 8, 10 and 12 after overnight static incubation at room temperature in deionised water with 10% BYE. One representative experiment is shown. Experiments were performed in triplicate.

29  

 

Lcl mediates Legionella pneumophila auto-aggregation.

BLAST searches of genomic data from Legionella species available in databases revealed that

genes encoding for homologues of Lcl are present in all sequenced L. pneumophila serogroup 1

strains and in L. pneumophila serogroup 12 strain 570-CO-H (amino-acid sequence identity

between 65% to 85%) while it is absent from L. longbeachae (str. NSW150 and D-4968) and L.

drancourtii genomes (data not shown, Duncan et al., 2011). We also previously reported that

homologues of the L. pneumophila biofilm mediator, Lcl, cannot be detected in species which

are poor biofilm producers such as L. erythra , L. feeleii, L. rubrilucens, L. maceachernii, L.

anisa and L. bozemanii (67-69). On the basis of studies correlating biofilm formation and auto-

aggregation, we next sought to test the hypothesis that the auto-aggregation phenotype observed

with L. pneumophila is mediated by Lcl (encoded by lpg2644). While Lp02 was able to form

auto-aggregates, this was not the case for Lp02Δlpg2644 (Fig. 5A). Complementation of

Lp02Δlpg2644 by transformation with a plasmid expressing lpg2644 (plpg2644) resulted in

recovery of its auto-aggregation properties. Taken together, this result suggests that Lcl is

essential for L. pneumophila auto-aggregation. When to colony forming units (CFU) were

measured before and after sedimentation assays (with vigourous vortexing to break up

aggregates), a similar number of cells were measured suggesting that the sedimentation

phenotype was not due to cell death (data not shown). Importantly the empty vector controls

(Lp02 pBH6119 and Lp02 Δlpg2644 pBH6119) did not have differences in sedimentation

compared to their respective untransformed strains. We next tested whether the kinetics and

degree of L. pneumophila auto-aggregation are influenced by the level of expression of Lcl. The

complemented mutant, Lp02Δlpg2644 plpg2644 and the wild type strain transformed with

30  

 

plpg2644 (Lp02 plpg2644) produced more Lcl than Lp02 and Lp02 pBH6119 as estimated by

anti-Lcl immunoblotting (Fig. 5B). Taking this data in account, we next compared the

sedimentation kinetics of these L. pneumophila strains in relation to their Lcl synthesis. After one

hour, Lp02Δlpg2644 plpg2644 and Lp02 plpg2644, which express higher levels of Lcl had

sedimented more rapidly than Lp02 (Fig. 5C). There were no significant differences in

sedimentation rate or degree between Lp02 plpg2644 and Lp02∆lpg2644 plpg2644, which is

consistent with similar levels of Lcl production. This suggests that the rate and degree of

sedimentation are influenced by the amount of Lcl produced. When we compared the kinetics of

sedimendation of Lp02 grown to stationary phase in BYE broth and stationary phase Lp02

grown on BCYE agar plates, similar sedimentation kinetics were observed (Fig. 5D).

Previously, we reported that Lcl is capable of binding to several glycosaminoglycans (GAGs)

including fucoidan, chondroitin sulfate-A, dextran sulfate and heparin sulphate, whose presence

was shown to inhibit the biofilm formation of L. pneumophila (68). To determine whether the

GAG binding properties of Lcl are required for the auto-aggregation of L. pneumophila,

sedimentation assays were performed with Lp02 in the presence of 0.25 mg/ml of these GAGs.

Fucoidan, chondroitin sulfate-A, dextran sulfate and heparin sulfate all inhibited Lp02

sedimentation. In contrast, the negative controls, mannose (0.25 mg/ml) and BSA (0.25 mg/ml)

did not alter Lp02 auto-aggregation (Fig. 5E). Thus the addition of Lcl ligands are able to

prevent the auto-aggregation of Lp02.

31  

 

Figure 5. Lcl is essential for L. pneumophila auto-aggregation. Sedimentation assays with wild type (Lp02), an lpg2644 knockout (Lp02Δlpg2644), Lp02 and Lp02Δlpg2644 transformed with an empty vector (Lp02 pBH6119 and Lp02Δlpg2644 pBH6119 respectively), the Lp02 over-expressing Lcl (Lp02 plpg2644) and the complemented knockout (Lp02Δlpg2644 plpg2644) measured (A) macroscopically in test tubes and (C) with sedimentation kinetics. (B) Anti-Lcl immunoblot demonstrating different expression levels of Lcl in Lp02, Lp02∆lpg2644, Lp02 pBH6119, Lp02∆lpg2644 pBH6119, Lp02 plpg2644 and Lp02∆lpg2644 plpg2644.(D)Sedimentation assays with Lp02 from plate cultures and stationary broth. (E) Sedimentation assays with Lp02 in the presence of 0.25 mg/ml GAGs. Mannose (0.25 mg/ml) and BSA (0.25 mg/ml) were used as negative controls.

32  

 

Divalent cations are required for Lcl induced auto-aggregation.

Divalent cations are involved in cell-cell interactions of both prokaryotes and eukaryotes (158-

160) . Therefore, we hypothesized that divalent cations may also play a role in Lcl dependent L.

pneumophila auto-aggregation. To test this hypothesis, we assessed the sedimentation of Lp02,

Lp02Δlpg2644 and Lp02Δlpg2644 plpg2644 in deionised water or in 500 µM solutions of either

CaCl2, MgCl2, ZnCl2 or KCl in deionised water. While sedimentation did not occur in deionised

water alone, Lp02 sedimented in assays supplemented with 500 µM CaCl2, MgCl2 and ZnCl2

(Fig. 6A). In contrast, Lp02 did not sediment with the addition of 500 µM KCl indicating that

potassium and chloride ions have no effect on the auto-aggregation of L. pneumophila (Fig. 6A).

Importantly, Lp02Δlpg2644 did not sediment in any conditions (Fig. 6B). The deficiency in

sedimentation of Lp02Δlpg2644 was restored upon complementation with plpg2644 (Fig. 6C).

These data suggest that divalent cations induce L. pneumophila auto-aggregation in an Lcl

dependent manner. Consistent with results obtained with Lp02, sedimentation of Lp02Δlpg2644

plpg2644 did not occur with the addition of 500 µM KCl (Fig. 6C). In addition, Lp02 and

Lp02Δlpg2644 plpg2644 also sedimented in the presence of 500 µM MgSO4, confirming that

divalent cations and not chloride anions are required for the auto-aggregation of L. pneumophila

(data not shown). We next determined whether the concentrations of specific cations have an

impact on the sedimentation kinetics of L. pneumophila. Lp02 colonies were suspended in

deionised water with 500 µM, 100 µM and 50 µM of CaCl2, ZnCl2 or MgCl2 and the OD600nm of

the bacterial suspensions were monitored hourly for eight hours. Lp02 sedimentation appeared to

be dose dependent with the addition of CaCl2, ZnCl2 and MgCl2 (Fig. 6D-F). The addition of up

to 500 µM KCl however did not rescue Lp02 sedimentation suggesting that the lack of

sedimentation in the previous assays was not due to a lower chloride or potassium ion

33  

 

concentration (data not shown). In addition, no significant difference was observed in the degree

and rate of sedimentation between the different cations (Fig. 6D-F). Furthermore, sedimentation

of Lp02 supplemented with CaCl2 and ZnCl2 was inhibited by the addition of a sub lethal

concentration of the metal chelator diethylenetriaminepentaacetic acid (DTPA) (Fig. 6G and H),

confirming that the aggregation of L. pneumophila is dependent on divalent cations. Auto-

aggregation in the presence of MgCl2 however could not be inhibited by the addition of DTPA

(data not shown). This is consistent with the reported low affinity of DTPA to magnesium

compared to Ca2+ and Zn2+ (161).

34  

 

Figure 6. Divalent cations are required for Lcl dependent auto-aggregation. Sedimentation assays with (A) Lp02, (B) Lp02∆lpg2644 and (C) Lp02∆lpg2644 plpg2644 in deionised water (control) and deionised water supplemented with 500 μM CaCl2, ZnCl2 ,MgCl2 and KCl. Sedimentation kinetics of Lp02 with 500 μM, 100 μM and 50 μM (D) CaCl2, (E) ZnCl2 and (F) MgCl2. Sedimentation assays in the presence of (G) 100 μM CaCl2 and (H) 100 μM ZnCl2 with and without 50 μM DPTA, or with 50 μM DPTA only in deionised water.

35  

 

Lcl secreted in the extracellular milieu is not sufficient to induce the aggregation of L. pneumophila Lp02Δlpg2644.

Based on evidences that Lcl is both surface exposed and secreted into the extracellular milieu

using the type II secretion system (67, 69, 162), we next tested whether Lcl is secreted into the

extracellular milieu during sedimentation assays. Anti-Lcl immunoblot assays detected Lcl in the

supernatant fractions (SN) of sedimentation assays with Lp02 and with a mixed suspensions of

Lp02 and Lp02Δlpg2644, while Lcl could not be detected in assays with Lp02Δlpg2644 alone

(Fig. 7A). We next investigated if Lcl secreted by wild type bacteria could be sufficient to

sediment Lp02Δlpg2644 in a mixed population of Lp02Δlpg2644 expressing red fluorescent

protein (Lp02Δlpg2644 pRFP) and Lp02 expressing green fluorescent protein (Lp02 pGFP).

When sedimented cells were visualized by fluorescence microscopy, the vast majority of the

bacteria that were observed were Lp02 expressing GFP with few Lp02Δlpg2644 pRFP,

indicating that Lp02 primarily had sedimented (Fig. 7B). Plasmids were next swapped to ensure

that the observed phenotype was not indirectly linked to the heterologous expression of

respective fluorescent proteins. Sedimentation assays were performed with RFP expressing Lp02

(Lp02 pRFP) and GFP expressing Lp02Δlpg2644 (Lp02Δlpg2644 pGFP). Most of the bacteria

found at the bottom of the test tube were Lp02 pRFP (Fig. 7C), suggesting that the lack of cell-

cell interactions observed between Lp02 and Lp02Δlpg2644 is not an indirect consequence of the

heterologous expression of RFP and GFP. These results were further confirmed by measuring the

proportion of each labelled bacterial cell after sedimentation using fluorescence microscopy.

Among 5 representative microscopy fields, Lp02 accounted for 91-93% of the visualized cells

(Fig. 7D and 7E). In control assays the expression of RFP or GFP did not alter the individual

sedimentation rates of any of the strains used, indicating that neither the expression of GFP nor

RFP effects sedimentation (data not shown). Taken together, these results show that

36  

 

Lp02Δlpg2644 bacteria are not able to aggregate with wild type and suggest that the Lcl secreted

in the extracellular milieu is not sufficient for the incorporation of L. pneumophila into auto-

aggregates.

37  

 

Figure 7. Surface exposed Lcl is required for L. pneumophila auto-aggregation. (A) Anti-Lcl immublots of the supernant (SN) and cell fraction (CF) from sedimentation assays with Lp02 ,Lp02∆lpg2644 and mixed suspensions. Fluorescence microscopy analysis of labelled auto-aggregates after 5 hour static incubations with (B) Lp02 pGFP and Lp02∆ lpg2644 pRFP, and C) Lp02 pRFP and Lp02∆lpg2644 pGFP mixed suspensions in deionised water with 500 μM MgCl2. (D) And (E) represent the respective and relative quantifications of Lp02 and Lp02∆lpg2644 in mixed sedimentation assays from B and C. Scale bar represents 10μm. * indicates statistically significant differences with P<0.001 by two-tailed Student’s t-test.

38  

 

Lcl is sufficient to induce auto-aggregation and to increase biofilm production in E. coli

and L. feeleii.

To determine whether Lcl is sufficient to induce auto-aggregation, we next measured the impact

of heterologous expression of Lcl on the sedimentation of E. coli. The Lcl gene (lpg2644) was

cloned into the plasmid pTrc under the control of the leaky trc -IPTG (isopropyl β-D-1-

thiogalactopyranoside) inducible promoter. This plasmid was then transformed into E. coli TOP

10 to create E. coli plcl (Table 2). As a negative control, the E. coli TOP10 strain was

transformed with the empty pTrc vector to obtain E. coli pTrc (Table 2). In immunoblot assays,

anti-Lcl antibodies reacted with a 50-kDa protein in E. coli plcl lysates and an increased

expression level was observed in the presence of IPTG (Fig. 8A). The cellular localization of Lcl

was examined by live imaging using spinning disk confocal microscopy and live cell anti-Lcl

immuno-fluorescence assays with E. coli plcl. Confocal analysis revealed that Lcl is expressed at

the surface of E. coli plcl cells (antibodies are not outer membrane permeable), albeit not

uniformly distributed (Fig. 8B). This heterogeneous cluster distribution of recombinant Lcl in

E.coli is consistent with its previously reported distribution in L. pneumophila (69).No

fluorescence signal was detected with E. coli pTrc and anti-Lcl antiserum (Fig. 8B). The cellular

distribution of Lcl was further analysed using deconvolved confocal xy planes. Inner membranes

were labelled with the dye FM4-64(163) (Fig. 8B). The scanning of Lcl fluorescence intensities

along cross section of the bacteria and the comparison with the fluorescence intensities for FM 4-

64 confirmed that heterologous Lcl is expressed at the cell surface of E. coli (Fig. 8B).

To determine if surface exposed Lcl is sufficient to mediate bacterial cell-cell interactions, the

auto-aggregation of E. coli plcl and E. coli pTrc colonies were compared in sedimentation

assays. After 5 hour incubation, control strain E. coli pTrc remained in suspension whereas E.

39  

 

coli plcl showed a marked ability to auto-aggregate (Fig. 8C). By differential interference

contrast microscopy (DIC), cells from settled E. coli pTrc appeared to be distributed evenly and

homogenously (Fig. 8D). In contrast, settled E. coli plcl cells were found to cluster (where a

cluster was defined as an area that contains more than 1 cell in close proximity) into large

aggregates, suggesting that heterologous expression of Lcl is sufficient to induce auto-

aggregation and results in sedimentation (Fig. 8D). This finding was further confirmed by

sedimentation kinetic assays where E. coli plcl, started to settle after an hour of incubation while

E. coli pTrc remained in suspension for the 5 hour time course (Fig. 8E). In contrast to the data

obtained with L. pneumophila, increased synthesis of Lcl through IPTG induction did not

significantly affect the sedimentation kinetics or degree of E. coli plcl (Fig. 8C and E).

Importantly, differences in sedimentation between these strains were not due to differences in

cell viability as demonstrated by comparing CFUs of cell suspensions collected pre and post-

sedimentation assays (data not shown).

We know from our previous reports that surface exposed Lcl is essential for the biofilm

production of L. pneumophila (68, 69). Based on the ability of Lcl to induce the auto-aggregation

of E. coli, we next sought to determine whether heterologous expression of lpg2644 could also

be sufficient to influence E. coli biofilm production. In comparison with E. coli pTrc, E. coli plcl

produced significantly more biofilm (Fig. 8F). Moreover, in the presence of IPTG, increased

synthesis of Lcl was correlated with a significantly higher amount of biofilm production of the E.

coli plcl strain (Fig. 8F). The addition of IPTG to E. coli pTrc slightly decreased the biofilm

production of E. coli pTrc, while it also slightly decreased the growth of both E. coli pTrc and E.

coli plcl as measured by absorbance of bacterial suspensions at 600nm, most likely due to the

toxicity of IPTG on growth(164, 165). This decrease in growth however did not

40  

 

significantlyimpact the adherent biomass as detected by crystal violet staining. We then

evaluated whether heterologous expression of lpg2644 could also be sufficient to influence auto-

aggregation in other Legionella species. L. feeleii (Lf) was transformed with plpg2644 to obtain

Lf plpg2644 (Table 2). The synthesis of recombinant Lcl in Lf plpg2644 was confirmed by anti-

Lcl immunoblot analysis (Figure 8G). Similarly to E. coli plcl, L. feelii plpg2644 showed a

marked ability to auto-aggregate in sedimentation assays while Legionella feelii transformed

with the empty plasmid (Lf pBH6119) remained in suspension (Fig. 8G).

41  

 

42  

 

Figure 8. Lcl is sufficient to induce auto-aggregation and biofilm production in E. coli and L. feeleii. (A) Anti-Lcl immunoblot of E. coli containing the empty plasmid (E. coli pTrc) and E. coli transformed with a plasmid containing lpg2644 under the control of a leaky IPTG inducible promoter (E. coli plcl). (B) Anti-Lcl immunofluorescence and FM 4-64 staining of live E. coli pTrc and E. coli plcl (top). The localization of Lcl (green line) was determined by comparing its fluorescence intensity along the white lines with the inner membrane marker FM 4-64 (red line). Sedimentation of E. coli pTrc and E. coli plcl measured by (C) test tube sedimentation assays, (D) DIC of sediment and (E) sedimentation kinetics. (F) Biofilm production of E. coli pTrc and E. coli plcl as measured by crystal violet staining. * indicates statistically significant differences between the indicated conditions and E. coli plcl - IPTG and ** indicates statistically significant differences with E. coli plcl + IPTG (P<0.05) by two-tailed Student’s t-test. (G) Anti-Lcl immunoblot and sedimentation assays with L. feeleii transformed with the empty vector (Lf pBH6119) and with the plpg2644 plasmid (Lf plpg2644). IPTG was added to a final concentration of 1mM when indicated for sedimentation experiments and immunoblotting. For biofilm assays IPTG was added to a final concentration of 5 mM. Scale bars represent 0.6 μm and 10 μm for panels B and D respectively.

43  

 

We next investigated if lpg2644 expression is sufficient to influence the ultrastructure of

bacterial auto-aggregates. To test this hypothesis, E. coli pTrc and E. coli plcl sediments, with

and without IPTG were analysed by scanning electronic microscopy. In the absence of IPTG, E.

coli pTrc showed few cells which appeared to be loosely associated (Fig. 9A) while assays

performed with settled E. coli plcl cells formed large structured clusters (Fig. 9B). Addition of

IPTG to E. coli pTrc resulted in a decrease in the number of sedimented cells (Fig. 9C), which is

consistent with the reported bacteriostatic toxicity of IPTG on E. coli (164, 165). In contrast E.

coli plcl supplemented with IPTG formed thicker and denser aggregates possibly covered by an

extracellular substance (Fig. 9D). While the heterologous over-expression of Lcl does not

increase the sedimentation of E. coli, this structural impact is in agreement with the increased

biofilm formation observed with E. coli plcl upon IPTG induction.

44  

 

Figure 9. Production of Lcl alters E. coli sediment ultrastructure. Electron micrographs of E. coli pTrc and E. coli plcl sediment after overnight static incubation at room temperature without (A and C respectively) and with 1 mM IPTG induction (B and D respectively). One representative electron micrograph is shown,which is representative from 15 different fields.Scale bars represent 5µm.

45  

 

Lcl mediates the attachment of L. pneumophila to Acanthamoeba castellanii.

Once an intracellular pathogen is in contact with a host cell, it next adheres intimately to host

surfaces using adhesins. Lcl is an adhesin that mediates the attachment of L. pneumophila to

human lung epithelial cells (68). We thus hypothesised that it may also mediate the attachment of

Lp02 to A. castellanii. To test this hypothesis independently of the aggregation/sedimentation

phenotype, we performed A. castellanii infection experiments where cell contacts were promoted

by initiating the assay with a mild centrifugation. The infection of A. castellanii with Lp02

pGFP, Lp02Δlpg2644 pGFP and a chromosomally complemented lpg2644 deletion mutant

labelled with GFP (Lp02Δlpg2644clpg2644 pGFP) were measured by flow cytometry as

previously described (66, 150). In these experimental conditions, Lp02 pGFP was found to infect

76-83 % of A. castellanii cells regardless of the presence of MgCl2 (Fig. 10A). This suggests that

magnesium does not influence the infection of L. pneumophila with amoebae once they are in

contact. In contrast, only 5 to 13 % of the A. castellanii cells were infected in assays with

Lp02Δlpg2644 pGFP. Considering the short term incubation of our assays (2 hours), these

results presumably reflect a reduced adhesion of Lp02Δlpg2644 and is consistent with the

reported decreased L. pneumophila infection of A. castellanii in the presence of blocking anti-Lcl

antibodies (67). The infection of A. castellanii with the complemented mutant was significantly

higher than with Lp02∆lpg2644 (P<0.01) and followed the same trend as the wild type strain in

all experimental conditions (Fig. 10A). To confirm that the acquisition of fluorescence by A.

castellanii was in fact due to the internalization of fluorescent L. pneumophila, the number of

infected A. castellanii was next monitored by confocal laser scanning microscopy (CLSM) using

the same experimental strategy. This approach revealed the same trend as our infection assays

46  

 

measured by flow cytometry, suggesting that the Lcl adhesin mediates the attachment of L.

pneumophila to A. castellanii (Fig. 10B). Surprisingly, when centrifuged infection assays were

performed in the presence of fucoidan, the infection of A. castellanii with Lp02 pGFP,

Lp02Δlpg26444 pGFP and Lp02Δlpg2644clpg2644 pGFP remained unchanged (Fig. 10C and D).

These results suggest that fucoidan can specifically inhibit L. pneumophila aggregation while it does not

inhibit the attachment to A. castellanii.

47  

 

Figure 10. Lcl mediates the attachment of L. pneumophila to Acanthamoeba castellanii. Infection of A. castellanii by Lp02 pGFP, Lp02∆lpg2644 pGFP and Lp02∆lpg2644 clpg2644 (chromosomal insertion of gene lpg2644) pGFP after centrifugation in deionized water in the absence or presence of 500µM MgCl2 measured by (A) flow cytometry and (B) fluorescence microscopy. Infection of A. castellanii measured by flow cytometry in the presence of 2.5X10-3 to 2.5X10-5 mg /ml fucoidan in (C) centrifuged conditions in deionized water, (D) centrifuged conditions with the addition of 500µM MgCl2 with Lp02 pGFP (white squares), Lp02∆lpg2644 pGFP (grey circles) and Lp02∆lpg2644 clpg2644 pGFP (black triangles). * indicates statistically significant differences with Lp02∆lpg2644 clpg2644 – MgCl2 by two-tailed Student’s t-test (p<0.01).

48  

 

Lcl dependent auto-aggregation potentiates the infection of Acanthamoeba castellanii by L.

pneumophila.

Amoeba species, such as the L. pneumophila host A. castellanii, are preferentially found attached

to surfaces in aquatic environments where they feed more effectively on their prey (166, 167).

Given that Lcl is a mediator of sedimentation, we hypothesized that this process may also assist

the bacteria in more efficiently encountering and thus invading amoebae. To test this hypothesis,

Lp02 pGFP, Lp02Δlpg2644 pGFP and Lp02Δlpg2644clpg2644 pGFP were left to settle during 2

hours on A. castellanii without initial centrifugation. To evaluate the role of Lcl dependent auto-

aggregation on A. castellanii infection, assays were performed in deionised water and in

deionised water with 500µM MgCl2 which are respectively non-permissive and permissive for

Lcl dependent auto-aggregation. Lp02 pGFP infected significantly 108% (P<0.01) more

amoebae in the presence of 500 µM MgCl2 than in deionised water alone (Fig. 11A). This result

suggests that Lcl dependent auto-aggregation of wild type Lp02 increases the ability of L.

pneumophila to come in contact with A. castellanii. Lp02Δlpg2644 pGFP showed a marked and

significant decrease in internalization in both the absence and presence of magnesium, in

comparison to Lp02 pGFP. Infection assays of A. castellanii with Lp02Δlpg2644clpg2644 pGFP

followed the same trend as with wild type Lp02 (Fig. 11A). This finding was further confirmed

by CLSM analyses suggesting that the Lcl-dependent auto-aggregation potentiates the infection

of A. castellanii by wild type L. pneumophila (Fig. 11B). Taking in account that Lcl also

mediates the attachment of Lp02 to A. castellanii, the reduced infectivity of Lp02Δlpg2644 in

these experiments may reflect a sum of deficiencies in aggregation dependent contact as well as

attachment. To experimentally separate these two processes, we took advantage of the dose

dependent inhibitory effect of soluble GAGs on the Lcl mediated auto-aggregation which does

49  

 

not affect the attachment of Lp02 (Fig. 12). When Lp02 pGFP and Lp02Δlpg2644clpg2644

pGFP were left to auto-aggregate and settle during 2 hours without centrifugation, a dose

dependent inhibition of A. castellanii infection was observed in the presence of fucoidan

concentrations that inhibit the auto-aggregation of Lp02 (Fig. 11C). Consistent with the results

observed in centrifuged infection assays (Fig. 10C and D), fucoidan had no effect on the

infection of A. castellanii in conditions which do not promote auto-aggregation (Fig. 11D). The

infection of A. castellanii with Lp02Δlpg26444 pGFP remained unchanged despite of the

presence of fucoidan (Fig. 11C and D). Bearing in mind that the concentrations of fucoidan used

do not inhibit the attachment of Lp02 to A. castellanii, these data suggest that Lcl dependent

auto-aggregation potentiates the infection of these host cells.

We next asked if aggregation alone could potentiate the host internalization of the adhesion

deficient Lp02Δlpg2644 strain. A. castellanii was challenged with aggregates of Lp02Δlpg2644

pGFP formed in presence of agglutinating anti-L. pneumophila polyclonal antibodies (Fig. 11E).

Compared to a suspension of planktonic bacteria, the infection of A. castellanii with

Lp02Δlpg26444 pGFP aggregates was 8 times greater (Fig. 11F). In control assays, agglutination

of wild type Lp02 did not alter the infection of A. castellanii (data not shown) confirming

previously studies showing that L. pneumophila opsonization does not increase the infection of

A. castellanii (168). Taken together this data suggest that the aggregation of L. pneumophila

potentiates the infection of A. castellanii independently of attachment.

50  

 

Figure 11. Lcl dependent auto-aggregation potentiates the internalization of L. pneumophila in A. castellanii. Infection of A. castellanii by Lp02 pGFP, Lp02∆lpg2644 pGFP and Lp02∆lpg2644 clpg2644 pGFP in non-centrifuged conditions in the absence or presence of 500µM MgCl2 measured by (A) flow cytometry and (B) fluorescence microscopy. Infection of A. castellanii measured by flow cytometry in the presence of 2.5X10-3 to 2.5X10-5 mg /ml fucoidan in (C) non-centrifuged conditions with the addition of 500µM MgCl2 and D) non-centrifuged conditions in deionized water with Lp02 pGFP (white squares), Lp02∆lpg2644 pGFP (grey circles) and Lp02∆lpg2644 clpg2644 pGFP (black triangles). (E) Fluorescence microscopy of Lp02∆lpg2644 pGFP in the absence or presence of anti-Legionella pneumophila serogroup1 (anti-Lp1) agglutinating antibodies (1:1000). (F) Infection of A. castellanii with isolated planktonic Lp02∆lpg2644 pGFP and artificially aggregated Lp02∆lpg2644 pGFP (- and + anti-Lp1 antibodies respectively). Scale bar represents 10μm. * and ** indicates statistically significant differences between the indicated strains (A and B) and compared to assays with 0 mg/ml fucoidan (C)respectively by two-tailed Student’s t-test (p<0.01).

51  

 

Figure 12. Fucoidan inhibits L. pneumophila sedimentation in a dose dependent manner. Sedimentation kinetics of Lp02 in 500µM MgCl2 with the addition of 0, 2.5X10-5, 2.5X10-4 and 2.5X10-3 mg /ml fucoidan.

52  

 

Lcl dependent auto-aggregation increases the number of L. pneumophila per infected A.

castellanii.

In initial CLSM analyses, A. castellanii in non-centrifuged infections with Lp02 pGFP and

Lp02Δlpg2644clpg2644 pGFP appeared to contain higher numbers of intracellular L.

pneumophila when infected with aggregates rather than isolated bacteria (Fig. 13A). Meanwhile,

only individual bacteria were internalized in A. castellanii infected with Lp02Δlpg2644 (Fig.

13A). These initial results led us to speculate that the Lcl-dependent auto-aggregation may also

have an impact on the number of internalized L. pneumophila per infected A. castellanii by

potentiating the contact of host cells with multi-cellular Lp02 aggregates rather than isolated

bacteria. To investigate this, the numbers of internalized L. pneumophila were counted per

infected A. castellanii according to our previously described non-centrifuged experimental

conditions with CLSM. Infection assays performed with Lp02 pGFP and complemented mutant

Lp02 Δlpg2644 clpg2644 showed a greater number of internalized L. pneumophila per A.

castellanii in conditions allowing Lcl dependent auto-aggregation (deionised water with MgCl2)

than in the absence of Lcl dependent auto-aggregation (deionised water alone) (Fig. 13B). In

contrast, in infection assays performed with Lp02Δlpg2644 pGFP, most infected A. castellanii

amoebae contained only individual bacterium regardless of the absence or presence of

magnesium. This is consistent with the inability of this strain to auto-aggregate.

53  

 

Figure 13. Lcl dependent auto-aggregation increases the number of L. pneumophila per infected A. castellanii. A) Visualization of A. castellanii infection by Lp02 pGFP, Lp02∆lpg2644 pGFP and Lp02∆lpg2644 clpg2644 pGFP in non-centrifuged conditions by fluorescence microscopy and B) quantification of the number of bacteria per infected amoeba in non-centrifuged assays. Scale bar represents 10μm.

54  

 

2.4 Discussion

Bacterial biofilms are important determinants in host colonization for several pathogens (118,

169). Although bacterial auto-aggregation is commonly linked to biofilm production (141, 147,

148, 170), a recent study suggests that these two processes may have phenotypic differences

(145). Here, we demonstrate that among nine Legionella species, L. pneumophila is exclusively

capable of auto-aggregation. The other Legionella species used in this study were previously

shown to neither produce a homologue of Lcl nor to contain a detectable lpg2644 gene (68).

Thus the rare occurrence of these Legionella species in legionellosis patients may be explained

by their deficiency in Lcl dependent aggregation, which may lead to a reduced capacity for

contamination of anthropogenic water systems and therefore reduced contact with humans. To

test the role of Lcl in L. pneumophila auto-aggregation we used an lpg2644 isogenic mutant of

Lp02, which revealed that Lcl is essential for auto-aggregation. This is consistent with the

reported role of auto-aggregation in the formation of L. pneumophila biofilms (33).

Amoebae, the natural hosts of L. pneumophila, often reside on surfaces, in stagnant

environmental water where they are also frequently recovered from biofilms with L.

pneumophila (166, 167). Upon phagocytosis, L. pneumophila bacteria are able to replicate in the

environment within the protozoa host (20, 171). The early time points of infection by amoebae

include the following sequence of events: initial contact of the pathogen with the phagocyte,

intimate adherence followed by ingestion (172). Upon initial contact, the intimate adherence of

55  

 

L. pneumophila to the surface of its natural hosts may involve carbohydrate receptors (173). In a

previous study, Lcl was shown to bind to fucoidan, a polymer of fucose (68). Interestingly,

amoeba expresses fucosylated surface proteins (174, 175). Thus Lcl may also serve as an adhesin

for the attachment of L. pneumophila to its environmental hosts. Consistent with this hypothesis,

we show that the deletion of lpg2644 in L. pneumophila greatly reduces the ability of Lp02 to

infect A. castellanii. In addition to the initial binding of A. castellanii, Lcl dependent auto-

aggregation of L. pneumophila also appeared to promote the infection of A. castellanii by

facilitating contact between the pathogen and its host. In fact, the aggregation of Chlamydia

trachomatis and Chlamydia pneumoniae cells mediated by host collagenous lectins was

previously shown to enhance bacterial uptake per phagocyte (176). Interestingly, many cases of

legionellosis are linked to the presence of L. pneumophila in stagnant water (57, 58). Thus the

Lcl adhesin may play a dual-role in the life-cycle of L. pneumophila by promoting conditions

where the bacteria can both settle and also infect amoebae, increasing the ability of L.

pneumophila to replicate and disseminate in the environment. In this study, we show that

heterologous expression of lpg2644 in E. coli leads to auto-aggregation and increased biofilm

production. Microscopy analysis of E. coli plcl auto-aggregates revealed large clusters with

divisions in between. Although these partitions may be due to partial desiccation during imaging

experiments, this phenotype was solely observed with E. coli plcl which suggest that it is directly

correlated with Lcl synthesis. When Lcl was over-expressed, E. coli formed thick aggregates

covered by an extracellular matrix which resembles the typical extracellular polymeric substance

reported in other bacterial biofilms (177, 178). Here, we demonstrate that heterologous

expression of lpg2644 is sufficient to promote cell-cell interactions, and that surface expression

of Lcl is required for L. pneumophila auto-aggregation as suggested by sedimentation assays

56  

 

with a mixed suspension of Lp02 and Lp02Δlpg2644. Taken together, these data suggest that

cell-cell interactions may result from homophilic interactions between surface exposed Lcl

proteins of neighbouring cells. Alternatively, it is possible that Lcl requires unidentified bridging

factors that are conserved among E. coli and L. pneumophila species as in the instance of

Aerobacter aerogenes auto-aggregation (179). The phenomenon of heterologous expression of

proteins inducing auto-aggregation, is similar to what was observed with the Staphylococcus

aureus adhesin, Protein A, where production of Protein A in Lactococcus lactis was sufficient to

induce both auto-aggregation and biofilm production (180).

We observed that auto-aggregation mediated by Lcl requires the presence of divalent cations.

This finding is correlated with the reported ability of calcium and magnesium to increase the

attachment of L. pneumophila to abiotic surfaces (47). It is thus possible that the role of divalent

cations in initial attachment may be directly related to the ability of L. pneumophila to form auto-

aggregates. Divalent cations have previously been shown to affect the auto-aggregation and the

biofilm production of several bacterial species, by acting as a structural element (160, 181-183)

and also by acting as a signalling molecule (177, 184). Interestingly in all the aforementioned

examples there is specificity in the divalent cation which elicits the response. This is not the case

here, since calcium, zinc and magnesium were equally efficient in inducing Lcl dependent L.

pneumophila auto-aggregation. The halophile, Halobacterium salinarum has also been shown to

aggregate in the presence of several different divalent cations (185, 186). Interestingly, both L.

pneumophila and H. salinarum are aquatic organisms, and it is possible that the selective

pressure for the reliance on several different cations, could arise from differences in the

environments where their respective biofilms are being produced. Organisms which produce

biofilms in aquatic environments may have acquired the ability to use several different cations

57  

 

because of the scarcity of these ions in their natural environment. During mammalian infections

however, microorganisms that produce biofilms are in environments where there is an abundance

of different divalent cations. For L. pneumophila, although the production of biofilms or

aggregates in the human host remains unexplored, the presence of zinc is associated with

contamination of water sources with L. pneumophila (187) . Moreover, zinc potentiates L.

pneumophila attachment to human alveolar epithelial cells (48). Altogether, the requirement of

divalent cations for Lcl dependent auto-aggregation, the reported roles of Lcl in attachment to

epithelial cells and GAGs and the role of cations in L. pneumophila adhesion suggest that these

correlated Lcl dependent mechanisms may both contribute to the environmental dissemination

and the host colonization of L. pneumophila.  

 

 

 

 

 

 

 

58  

 

Chapter 3: The Role of Lcl Collagenous Repeats in L. pneumophila Biofilm Production, Attachment and Adhesion.

3.1 Introduction The majority of bacterial pathogens are able to produce multicellular structures known as

biofilms (188). Biofilms have been recognized as a serious concern for human health as they

allow pathogens to persist in living hosts or in their natural environment where they may serve as

a source of infection (169, 189). Furthermore the ability to form biofilms also contributes to

environmental dissemination (118, 190). Bacteria within biofilms possess several advantages that

planktonic bacteria do not, such as increased horizontal gene transfer and increased resistance to

antibiotics or environmental stresses (191, 192). These properties make the eradication of these

structures extremely difficult once established, and can perpetuate spread of pathogens.

The Gram-negative pathogen Legionella pneumophila is a major cause of hospital and

community acquired pneumonia and the major causative agent of legionellosis (5, 6). During

outbreaks, L. pneumophila is often found in water distribution systems and hot-water tanks (14,

58, 64) where it can be a member of multispecies biofilms (44, 96). L. pneumophila is

ubiquitously found in environmental freshwater (63) where it often coexists and replicates within

various protozoa (19). To date, there have been no reported cases of person to person

transmission of the pathogen Infections by L. pneumophila are believed to be due to the

inhalation of aerosolised particles from contaminated environmental sources (11). Despite the

frequent association of L. pneumophila containing biofilms with suspected source of infections,

only few molecular determinants of L. pneumophila biofilm formation have been identified to

date (33, 72, 82). Elucidation of the mechanisms that L. pneumophila uses to promote the

59  

 

colonisation of water systems and possibly host interactions may provide valuable information

for the prevention of legionellosis.

During the process of biofilm production, surface exposed adhesins often mediate the initial

attachment to abiotic surfaces and host cells (193, 194). Additionally, adhesins may also promote

cell-cell interactions, and subsequent development of bacterial biofilms (114, 195). In few cases,

the same adhesin may facilitate both initial adhesion to surfaces as well as inter-bacterial

physical interactions (119, 120). The Legionella collagen-like protein (Lcl) of L. pneumophila,

was recently reported to be an adhesin with such dual functions and is encoded by the gene

lpg2644 (68, 69). Although L. pneumophila produces several different adhesins, to date Lcl

remains the only adhesin indentified to be involved in biofilm formation of this bacteria. The Lcl

protein contains three different structural regions, an N-terminal region with a predicted signal

sequence, a central region containing tandem collagen-like repeats and a C terminal region with

no significant homologies to known proteins. The collagenous repeat domain of Lcl is

polymorphic in clinical isolates and immunogenic in infected patients (68, 138). Lcl also plays a

key role in attachment to lung epithelial cells and A. castellanii (67, 68). Deletion of the

collagen-like domain of recombinant Lcl reduces its ability to bind to host glycosaminoglycans

(GAGs) (68). The biofilm formation of an lpg2644 site directed mutant cannot be restored by

trans-complementation assays in the absence of this domain (69). Initial data also showed that

the over-expression of recombinant polymorphic Lcl proteins in a wild type reference L.

pneumophila strain can influence its adhesion to and invasion within host cells (67). Despite data

indicating that Lcl’s collagenous domain is necessary for biofilm formation and influences the

attachment of L. pneumophila to GAGs, the precise role of Lcl’s collagen like repeats in these

processes remains unknown.

60  

 

In this work, we demonstrate that Lcl’s collagenous repeats are a critical determinant for L.

pneumophila biofilm formation and that the numbers of repeats are positively correlated with the

amount of biofilm produced in clinical isolates, as well as under an isogenic background. These

differences in the degree of biofilm production are due to differences in both initial attachment

and cell-cell interactions, and can influence the structure of the biofilm. Finally, we show that

polymorphisms in Lcl’s collagen-like repeats modulate the binding of L. pneumophila to a

polymer of sulfated fucose suggesting that it may also play a role in host-pathogen interactions in

addition to biofilm formation.

3.2 Materials and Methods Chemicals, bacterial strains and growth conditions.

Unless otherwise indicated, all chemicals were purchased from Sigma. All Legionella

pneumophila isolates (Table 4) were cultured in buffered charcoal-yeast extract (BCYE) agar at

37 °C and 5% CO2 and or with buffered yeast extract (BYE) broth at 37°C with shaking at 100

rpm (152). Cultures of Lp02 were supplemented with thymidine when required (153).

General DNA techniques.

Genomic DNA and plasmid DNA was purified using a QIAamp DNA minikit and a QIA prep

spin miniprep kit (Qiagen) respectively. To quantify DNA, spectrophotometry was used. For

PCR, 10 ng was used as a template and PCR reactions were performed with Taq DNA

polymerase as recommended by the manufacturer (Invitrogen). The PCR primers used are

61  

 

pooled in Table 5. PCR reactions for cloning were performed with Platinum Taq DNA

polymerase high fidelity as per the manufacturer (Invitrogen). All clones were verified by

sequencing. Sequencing reactions were performed using a BigDye terminator cycle sequencing

kit, version 3.1 and purified with a BigDye X terminator purification kit and run on a 3130xl

genetic analyzer (Applied Biosystems). To measure the approximate size of lpg2644 in clinical

isolates primers 1 and 2 were used, and the PCR product was compared to a 2log ladder

(Fermentas). To estimate the number of repeats in lpg2644 from clinical isolates, chromosomal

DNA was amplified with Taq DNA polymerase (Invitrogen) using primers 8 and 9. The PCR

product was then compared against a 100 base pair DNA ladder (Fermentas).

Biofilm quantification.

All biofilm assays were performed using polystyrene 96-well plates (Costar). L. pneumophila

biofilm assays were performed as previously described (68). Strains were grown for 30hrs in

BYE and diluted to an OD of 0.2 in fresh broth and incubated for 2 days. Biofilms were stained

with 40 μl of 0.25% crystal violet per well for 15 minutes and washed three times with 200 μl of

sterile deionised water. The crystal violet stain was then solubilised in 95% ethanol and after 15

minutes absorbance was read at 600nm.

Generation of plpg2644 variants with different repeats.

To determine the role that Lcl collagenous repeats have in various biological processes, lpg2644

was PCR amplified using genomic DNA from clinical isolates using primers 1 and 2 (Table 5).

62  

 

PCR products from clinical isolates LU1536, LR1063 and LR0347 (Table 4) were used to create

lpg2644 inserts containing 18, 13 and 11 repeats respectively. The resulting PCR products and

the vector pBH6119 were then digested with XbaI and SphI to generate compatible ends. The

PCR products were then ligated into the XbaI and SphI digested pBH6119 vector and

transformed into E.coli TOP10 strain (Invitrogen). Transformants were selected by carbenicillin

resistance on LB agar. Single colonies were then picked, cultured in LB broth with 50μg/ ml

carbenicillin for plasmid extraction. After verification the plasmid was then transformed into

Lp02 and Lp02Δlpg2644 (Table 4).

SDS-PAGE and Immunoblot analysis.

SDS-PAGE was performed as previously described (154). Immunoblotting was performed

according to the methods of Towbin (155).To detect the presence of specific Legionella proteins,

cell lysates were prepared with plate cultures adjusted to an OD600nm of 8, centrifuged at 5000

rpm for 10 minutes and washed twice with PBS. Lysates were then mixed with an equal volume

of 2X Laemmli loading buffer with 10% 2-mercaptoethanol, samples were then boiled for 15

minutes before running on gel. Bound anti-Lcl antibodies (1:20,000) were detected with

peroxidase-linked anti-rabbit IgG (1:20,000). Recombinant proteins were detected with anti-His

mouse antibody (1:5000) (Invitrogen) and anti-mouse peroxidase linked IgG (1:2000).

Quantification of Legionella adherence using quantitative PCR.

63  

 

Quantitative PCR was performed as previously described (68).To measure the binding abilities

of L. pneumophila strains to abiotic surfaces, 100 μl of Legionella suspension adjusted to an

OD600nm of 2 in PBS was incubated for 1h at 37°C and 5% CO2 in polystyrene 96-well plates

(Costar). After three washes with PBS, DNA was purified directly from the wells using a

DNeasy 96 blood and tissue kit according to the manufacturer’s instructions (Qiagen). To

measure the percent of attached bacteria, DNA was purified from the initial innoculum that was

not washed, and percent attached was calculated as the amount of DNA purified from the

washed/unwashed wells. Quantitative PCR (qPCR) was performed using primers and a probe to

gyrA (Table 2 codes 5-7). Quantitative PCR was performed with Universal PCR master mix

(Applied Biosystems) using 400nM of each primer and 200nM probe. Amplification and

detection was performed with an ABI Prism 7900 detection system. To quantify adherence of

bacterial strains to fucoidan the same protocol was followed with 96-well heparin binding plates

(BD Biosciences) coated with 5 μgs of fuocidan as per the manufacturer’s recommendations.

Production and purification of His-Tag fusion proteins.

The lpg2644 gene was amplified from LU1536, LR1063 and LR0347genomic DNA using

primers 3 and 4 (Table5). To obtain an lpg2644 gene with 2 repeats, a gene was designed with

two repeats from sequences that were conserved amongst all the isolates used. This sequence

was then synthesized (Genscript) and put into the pUC57 vector flanked with EcoR1 and Xho1

restriction sites and PCR amplified using primers 3 and 4. The PCR products were cloned into

the pBAD-HisB (Invitrogen) vector according to the instructions of the manufacturer and cloned

into the E. coli LMG194 strain. E. coli LMG194 clones were tested for the expression of

64  

 

recombinant proteins after induction with 0.002% to 0.2% L-arabinose at 37°C for 4 h and the

optimal arabinose concentration for maximum expression was obtained and used for purification.

His-tagged fusion proteins were purified under native conditions with a nickel-Sepharose high-

performance chromatography column (HisTrap HP column) according to the instructions of the

manufacturer (GE Healthcare). A recombinant Lcl (rLcl) protein lacking the collagen-like

tandem repeats (Lcl Δrepeats) was obtained from our previous work (68). All purified fusion

proteins were dialyzed in PBS before use.

ELISAs.

To examine the binding of rLcls to fucoidan, Immunlon 2-HB 96-well plates (VWR) were

coated with 5 mg/ml fucoidan as previously described (196). Wells were then blocked for 1h

with 1%BSA-PBS. Recombinant Lcls were diluted in 1% BSA–PBS to a final concentration of

250 nM and diluted 1:10 in 1% BSA–PBS. Afterwards 100 ul was added to each well and

incubated at room temperature for 1 h. Wells were washed with PBS–0.5% Tween 20 and

probed with rabbit anti-His-rLcl diluted 1:5,000 in 1% BSA–PBS, followed by anti-rabbit

antibody conjugated to horseradish peroxidase diluted 1:2,000 in 1% BSA–PBS. Pierce TMB

(3,3′,5,5′-tetramethyl benzidine) ELISA substrate (Fisher Scientific) was used as the substrate for

HRP (horseradish peroxidase), the reactions were stopped after 30 min at room temperature with

2 M sulfuric acid, and the absorbance was determined at 450 nm using a BioTek Powerwave XS

plate reader. All samples were tested in triplicate. To measure the binding of rLcls to abiotic

surfaces, the same protocol as above was performed with uncoated wells and after 1 hour to

allow rLcls to bind, wells were blocked for 1 h with 1%BSA-PBS.

65  

 

Bacterial sedimentation assays.

Sedimentation assays were performed as previously described with a few modifications (150).

To visualize sedimentation, L. pneumophila strains were grown for three days and colonies were

suspended to an OD600nm of 1 in deionised water with 10% BYE. Images were taken immediately

after the indicated time period with all incubations being performed at room temperature. To

measure sedimentation kinetics, sedimentation assays were performed as described above, and

the OD600nm was measured every hour with a spectrophotometer, where a decrease in OD600nm

indicates an increase in sedimentation.

Confocal laser scanning microscopy.

For confocal laser scanning microscopic examination (CLSM) of biofilms, bacterial cultures

(800 µl) were prepared in Lab-TekII chamber slides (Labtek II, VWR, Rochester, USA)

according to the procedure described above. After 3 days of incubation at 37°C and 5% CO2,

400 μl of supernatant was removed and bacteria were labelled with the nucleic acid stain SYTO

62 (Molecular probes) diluted 1:25 for 1 hour at RT. Afterwards 400 μl of supernatant was

removed and 8% PFA was added for 20 min followed by two washes with sterile deionised

water. The plastic wells were removed from the slide and fluoromount (DAKO north America

INC, Carpinteria, USA) was added before placing a coverslip on the gasket and observed by

CLSM using a Nikon Eclipse TE2000EZ inverted microscope, 100 X Plan APO oil immersion

DIC N2 objective. Image acquisition and post-acquisition processing were performed using EZ-

66  

 

C1 Software Ver. 3.50 and the NIS-elements BR Software Ver. 3.0 for Nikon C1 Confocal

Microscopy.

Quantification of Hydrophobicity

The hexadecane method was used as previously described (197). Briefly 5ml of logarithmic

phase culture was pelleted, washed and resuspended in 5 ml of PBS One ml of hexadecane was

added vortexed for 1 min and incubated for 10 min at 30°C. Mixtures were then vortexed for an

additional 1 min and allowed to stand for 2 min for phase separation at room temperature. The

absorbance of the lower aqueous phase was read at OD600nm and compared against the PBS

control. The Hydrophobicity index was calculated as = [1-(A/A0)] x100, where A is the OD600nm

after hexadecane treatment and A0 is the OD600nm before treatment.

Table 4. Legionella pneumophila strains used in this study

Species Designation Plasmid Predicted Lcl size(s)

Source

L. pneumophila Lp02 untransformed 50kDa (153)

L. pneumophila Lp02Δlpg2644 untransformed - (68)

L. pneumophila Lp02 p pBH6119 50kDa (68)

L. pneumophila Lp02Δlpg2644 p pBH6119 - (68)

L. pneumophila Lp02Δlpg2644 plpg2644 18rpts

plpg2644 18rpts 50kDa This study

L. pneumophila Lp02 plpg2644 18rpts plpg2644 18rpts 50kDa This study

L. pneumophila Lp02Δlpg2644 plpg2644 13rpts

plpg2644 13rpts 42kDa This study

67  

 

L. pneumophila Lp02 plpg2644 13rpts plpg2644 13rpts 50,42kDa This study

L. pneumophila Lp02Δlpg2644 plpg2644 11rpts

plpg2644 11rpts 39kDa This study

L. pneumophila Lp02 plpg2644 11rpts plpg2644 11rpts 50, 39kDa This study

L. pneumophila Lp02Δlpg2644 plpg2644 Δrpts

plpg2644 Δrpts 25kDa (69)

L. pneumophila Lp02 plpg2644 Δrpts plpg2644 Δrpts 50, 25kDa (69)

L. pneumophila LU1536 50kDa (68)

L. pneumophila LR1063 42kDa (68)

L. pneumophila LR0347 39kDa (68)

68  

 

Table 5. Primers and probes used in this study

code Primer/ probe

Amplification target

Sequence 5’ to 3’

1 lpg2644 Xba1 F

lpg2644 GGTCATCTAGAGAAATAAAGAATGATACATCGA

2 lpg2644 Sph1 R

GTGAGCGCATGCGCAAAGCGAATTTATGAACA

3 lpg2644 Xho1 F

AGCTCGAGCAATCCGGCCTCGCAAGCC

4 lpg2644

EcoR1 R

CGGAATTCCGGGTTGCGAGAGTTGGCTA

5 gyrA F gyrA GGCGGGCAAGGTGTTATTT

6 gyrA R GCAAGGAGCGGACCACTTT

7 gyrA probe

VIC-CATTTCGTTCGTAACCTG-MGBNFQ

8 Lpms31 L lpg2644 repeats GCAATCCGGCCTCGCAAGCC

9 Lpms31 R CAGGCACACCTTGGCCGTCA

3.3 Results Polymorphisms in the number of lpg2644 collagenous repeats are positively correlated to

biofilm production in clinical isolates.

Biofilm formation of clinical strains LU1536, LR1063 and LR0347 were compared. After two

days, LU1536 produced 90% fold more biofilm than LR1063 (Fig. 14A). The strain LR1063 in

turn, produced approximately twice as much biofilm as the LR0347 strain. In these assays, there

was no significant difference in growth between strains, indicating that differences in biofilm

production were not due to differences in cell proliferation (data not shown). Based on previous

69  

 

studies indicating that Lcl collagenous repeats are polymorphic among clinical isolates (67, 138),

and are essential for the production of L. pneumophila biofilm (69), we next hypothesised that

the differences in biofilm production observed with LU1536, LR1063 and LR0347 could be due

to polymorphisms in the Lcl collagen-like domain. PCR amplification of lpg2644 from clinical

isolates LU1536, LR1063 and LR0347 using flanking primers led to amplicons that were

approximately 1.5kb, 1.3kb and 1.25kb respectively (Fig. 14B). These PCR amplicons were next

Sanger sequenced and their predicted amino-acid sequences were then compared by alignment

(Fig.15). In accordance with previously reported nomenclature by Pourcel et al, a single repeat

was denoted as 5 Gly-Xaa-Yaa tripeptides (15 amino acids total) within the central tandem

collagenous repeat domain (138). Using this designation, the predicted amino acid sequences of

Lcl isoforms from LU1536, LR1063 and LR0347 contained 18, 13 and 11 repeats respectively

(Fig. 16). When the predicted Lcl sequences of LU1536, LR1063 and LR0347 were compared

there was 94.9%, 95% and 99.5% amino acid homology between LU1536 and LR1063 strains,

LU1536 and LR0347 strains and LR1063 and LR0347 strains respectively (Table 6). The

predicted amino acid sequence of Lcl from the L. pneumophila Philadelphia reference strain,

Lp02, was 100% identical to LU1536. Taken together, these results indicate that the sequence

polymorphisms in lpg2644 homologues from clinical isolates LU1536, LR1063 and LR0347 are

mainly due to the number of repeats coding for collagenous amino acid sequences.

70  

 

Figure 14. Polymorphisms in the number of lpg2644 collagenous repeats are positively correlated to biofilm production in clinical isolates. (A) Biofilm production after two days quantified by crystal violet staining and (B) PCR amplification of lpg2644 from clinical strains LU1536, LR1063 and LR0347. * indicates statistically significant differences with p>0.05 by the students

71  

 

Figure 15. Clinical isolates LU1536, LR1063 and LR0347 contain size polymorphisms in their predicted Lcl sequences. Alignment of the predicted Lcl amino acid sequences from LU1536 which contains 18 repeats (first row), LR1063 which contains 13 repeats (second row) and LR0347 (third row).

72  

 

Figure 16. Schematic representation of the different Lcl isoforms in this study. The light grey boxes represent the N-terminal signal peptide, dark grey boxes represent 15 amino acid repeats containing collagenous sequences and the black boxes represent the C-terminal domain.

Table 6. Comparison of predicted amino acid sequences in Lcl isoforms

Sequences being compared Origin of sequence Shared identity

Lcl 18repeats - Lcl 13repeats LU1536-LR1063 95%

Lcl 18repeats - Lcl 11repeats LU1536- LR0347 94.9%

Lcl 13repeats – Lcl 11repeats LR1063-LR0347 99.5%

73  

 

The number of Lcl collagenous repeats are correlated with L. pneumophila biofilm

production in an isogenic background.

To evaluate if the polymorphisms observed in the lpg2644 homologues are sufficient to explain

the differences in L. pneumophila biofilm production of LU1536, LR1063 and LR0347, we

investigated the expression of these lpg2644 homologues in an isogenic background. To test this,

lpg2644 from LU1536 containing 18 repeats, LR1063 containing 13 repeats and LR0347

containing 11 repeats were PCR amplified and cloned into the Legionella expression vector

pBH6119 under the control of the icmR promoter (Table 4, primers 1 and 2). These plasmids

were named plpg2644 18rpts, plpg2644 13rpts and plpg2644 11rpts respectively. These

constructs were then transformed into the lpg2644 knock out strain, Lp02∆lpg2644 (KO), and

the Lp02 wild type (WT) strain (Table1). In addition the KO and WT strains transformed with

the pBH6119 expression vector containing lpg2644 with the repeats deleted (Lp02Δlpg2644

plpg2644 ∆rpts and Lp02 plpg2644 ∆rpts respectively) were taken from a previous study (69).

Lcl expression was assessed using anti-Lcl immunoblotting with cell lysates from transformed

WT and KO strains. In the KO and KO transformed with the empty vector, no proteins reacted

with anti-Lcl antibodies with the exception of a nonspecific band at approximately 42kDa (Fig.

17A and B). The remaining strains produced proteins that reacted with anti-Lcl antibodies that

ranged from 50-25kDa (Fig. 17A and B). These observed bands are consistent with the predicted

sizes of the Lcl variants produced by these strains (Table 4). In some cases, other bands were

observed with different molecular masses than expected, these bands presumably reflect the

degradation or the maturation of Lcl proteins, as they were absent from the lpg2644 knockout

strain.

74  

 

When biofilm production was quantified with the transformed Lp02Δlpg2644 strains, there was a

positive correlation between biofilm production and the number of lpg2644 repeats (r2 =0.9110 /

r=0.9544) when comparing Lp02 Δlpg2644 transformed with plpg2644 18, 13, 11 and ∆rpts

(Fig. 17C). As previously reported, transformation of Lp02Δlpg2644 with plpg2644 ∆rpts did

not restore biofilm production (69). This suggests that the number of lpg2644 repeats positively

influences L. pneumophila biofilm formation. WT strains over-expressing the various Lcl

isoforms had a positive correlation between the number of lpg2644 repeats in the transformed

plasmid and the amount of biofilm produced (r2 =0.8499 / r=0.9219), albeit to a slightly lesser

degree than observed with the transformed knockout strains (Fig. 17D). Wild type Lp02

transformed with plpg2644 ∆rpts showed a marked decrease in biofilm production as previously

reported (69) (Fig. 17D). Taken together, these data suggest that lpg2644 isoforms exert a

dominant negative effect on biofilm formation when expressed in a wild type background.

Importantly, the empty vector controls (Lp02Δlpg2644 pBH6119 and Lp02 pBH6119) did not

show significant differences in biofilm formation in comparison to their respective

untransformed strains. Additionally, there were no significant differences in growth between the

strains used, demonstrating that differences in biofilm production were not due to variations in

growth (data not shown).

75  

 

Figure 17. The number of Lcl collagenous repeats are correlated with L. pneumophila biofilm production in an isogenic background. Anti-Lcl immunoblot with cell lysate from (A) Lp02Δlpg2644 (KO) transformed strains and (B) Lp02 (WT) transformed strains. Adherent biomass of two day old biofilms quantified by crystal violet staining with (C) Lp02Δlpg2644 transformed strains and (D) Lp02 transformed strains.*,** and *** indicates statistically significant differences with Lp02Δlpg2644 plpg2644 11rpts, Lp02 plpg2644 11rpts and the indicated strains respectively with p<0.05by the students t-test.

76  

 

Lcl collagenous repeats impact L. pneumophila-abiotic surface interactions.

Previously, we demonstrated that deletion of lpg2644 in Lp02 resulted in a significant decrease

in attachment to abiotic surfaces, which is a crucial step during biofilm formation (69). Based on

this finding, we assessed if differences in biofilm production correlated to polymorphisms in Lcl

could be explained by variations in initial attachment. Attachment to polystyrene of

Lp02Δlpg2644 and Lp02 strains expressing polymorphic Lcls was measured by qPCR as

previously described (69). In accordance with past reports, the attachment of Lp02 Δlpg2644 to

polystyrene was reduced by 56% compared to the wild type Lp02 strains (P≤0.01, Fig. 18A). In

contrast, Lp02Δlpg2644 strains expressing different Lcl variants had a positive correlation

between the number of repeats in the Lcl polymorphism expressed, and attachment to

polystyrene (r2 =0.9851 / r=0.9925). Lp02Δlpg2644 plpg2644 Δrpts, had a similar low

attachment to polystyrene as the lpg2644 knockout strain (Fig. 18A). This suggests that that the

collagenous repeat domain of Lcl is important for attachment to abiotic surfaces. Lp02Δlpg2644

plpg2644 11rpts and Lp02Δlpg2644 plpg2644 13rpts demonstrated significantly less attachment

to polystyrene than WT (Fig. 18A). This suggests that the number of Lcl repeats positively

influences the attachment of L. pneumophila to abiotic surfaces. WT strains over-expressing

polymorphic Lcls showed no significant differences in attachment to polystyrene compared to

Lp02, and had a significantly greater attachment to polystyrene than KO (Fig. 18B). This is in

striking contrast to the results obtained with biofilm production, where a dominant negative

effect was observed when Lcl isoforms were expressed in Lp02 (Fig. 17D). This suggests that

there is no dominant negative effect on attachment of L. pneumophila to abiotic surfaces when

Lcl isoforms containing less repeats are overexpressed in Lp02.

77  

 

Figure 18. Lcl collagenous repeats impact L. pneumophila-abiotic surface interactions. Attachment of Lp02Δlpg2644 transformed strains (A) and Lp02 transformed strains (B) to polystyrene measured by qPCR. (C) Coomassie stained gel and anti-His immunoblot of purified recombinant Lcl (rLcl) proteins with 18, 13, 11, 2 and Δrepeats. (D) Binding of purified rLcl proteins to polystyrene estimated by ELISA. * and ** denotes statistically significant differences with the untransformed WT strain and the indicated strains respectively with P<0.01 by the students t-test.

78  

 

We next sought to test if differences in initial attachment of the various complemented

Lp02Δlpg2644 strains could be explained by differences in Lcl-polystyrene binding. Purified

recombinant His tagged –Lcl (rLcl) isoforms containing 18, 13,11,2 and Δ repeats were

incubated in the wells of a 96-well plate. Following incubation, binding of rLcl protein to the

wells was estimated by ELISA using anti-His antibodies. To ensure that equal amounts of

protein were used in binding assays, recombinant proteins were analysed by coomassie staining

and anti-His immunoblotting (Fig. 18C). Interestingly, there were no significant differences in

binding to polystyrene between any of the rLcl variants tested (Fig. 18D). This suggests that

although Lcl collagenous repeats influence initial attachment, this may be due to other

mechanisms than direct interactions between Lcl and abiotic surfaces.

Lcl collagenous repeats influence L. pneumophila cell-cell interactions and sedimentation.

We previously reported that Lcl promotes cell-cell interactions during biofilm formation and

mediates auto-aggregation of L. pneumophila in sedimentation assays (69). Thus, we

hypothesised that the collagenous repeats of Lcl could be essential in these processes and that

polymorphisms in this domain could also influence the degree of cell-cell interactions between L.

pneumophila bacteria. These interactions were assessed by performing sedimentation assays with

bacterial suspensions (118-120). As expected, deletion of lpg2644 prevented the sedimentation

of Lp02Δlpg2644 (Fig. 19A). Complementation assays of Lp02Δlpg2644 with plpg2644

containing 18, 13 and 11 repeats could restore its sedimentation while transformation with

plpg2644 ∆rpts could not (Fig. 19A). This suggests that the repeat domain of Lcl is essential for

the cell-cell interactions mediated by Lcl. All wild type strains expressing recombinant Lcl

79  

 

isoforms with the exception of Lp02 plpg2644 Δrpts were able to sediment (Fig. 19B). Lp02

plpg2644 Δrpts in contrast appeared to have a small subset of cells which sedimented with the

majority of the bacteria remaining in suspension. This dominant negative effect may be similar

to the dominant negative effect observed while measuring the biofilm production of this strain.

Quantification of the rate and degree of sedimentation revealed no significant differences

between the transformed KO strains (Fig. 19C), with the exception of Lp02Δlpg2644 plpg2644

∆rpts which did not sediment, confirming that the repeat domain of Lcl is essential for

sedimentation. Similarly, the Lp02 strains over-expressing Lcl isoforms showed no differences

in degree or rate of sedimentation with the exception of Lp02 plpg2644 Δrpts (Fig. 19D).

Surprisingly, Lp02 plpg2644 Δrpts had no significant decrease in OD600nm throughout the time

course of kinetic analyses while a cluster of sedimented cells could be observed Figure 19B. The

discrepancy between these 2 different assays may be explained the incubation time (overnight vs

5 hours). All strains over-expressing a recombinant Lcl variant with collagenous repeats,

sedimented faster and to a greater degree than the wild type regardless of the number of

collagen-like repeats. This is in agreement with past studies demonstrating that over-expression

of Lcl increases the sedimentation of L. pneumophila.

80  

 

Figure 19. Lcl collagenous repeats influence L. pneumophila cell-cell interactions and sedimentation. Auto-aggregation of Lp02∆lpg2644 transformed strains and Lp02 transformed strains visualized by tube sedimentation assays after overnight incubation at room temperature (A and B respectively) and sedimentation kinetics (C and D respectively).

81  

 

Lcl collagenous repeats are crucial for L. pneumophila biofilm structure.

Based upon data suggesting that the Lcl collagen-like domain is involved in cell-cell interactions

and initial attachment, and the importance of these processes in biofilm production and

architecture (114, 115, 198), we next investigated the influence of the number of Lcl repeats on

biofilm structure. To visualize biofilms, bacteria were labelled with the membrane permeable

nucleic acid stain SYTO 62 and analyzed by CLSM. Biofilms produced by Lp02 were confluent

and approximately 75µm thick (Fig. 20A). In contrast, assays with Lp02Δlpg2644 showed small

sparsely appearing clusters of cells, consistent with the lack of biofilm produced by this strain.

Complementation of Lp02Δlpg2644 with plasmids coding for lpg2644 with 18 and 13 repeats

resulted in biofilms that were between 70-80µm thick (Fig. 20B). Lp02Δlpg2644 plpg2644

11rpts in comparison, produced significantly (P<0.05) thinner biofilms of approximately 55µm

in thickness. This suggests that the number of Lcl collagenous repeats can influence the

thickness and possibly the robustness of L. pneumophila biofilms. The morphology and thickness

of Lp02Δlpg2644 plpg2644 ∆rpts was not significantly different from the KO, confirming that

the repeat domain of Lcl is essential for biofilm production (Fig. 20B).

82  

 

Figure 20. Lcl collagenous are crucial for L. pneumophila biofilm structure. (A) 3-D reconstruction of 0.45 μm Z-stacks of biofilms and (B) quantification of biofilm thickness of 3 day old biofilms formed on glass chambered coverslips produced by Lp02 and Lp02∆lpg2644 transformed strains stained with Syto 62. * and ** indicates statistically significant differences between the indicated strains and untransformed Lp02 respectively. Images were aquired with a 100X objective.Scale bars represent 100μm.

83  

 

Polymorphisms in Lcl collagenous repeats influence the binding of recombinant Lcl to

fucoidan and the attachment of L. pneumophila to fucoidan.

Binding to fucosylated surface receptors is necessary for efficient infection of the respiratory

pathogen Pseudomonas aeruginosa (199, 200). Notably, Lcl has been shown to bind to fucoidan,

a polymer of fucose, and is involved in the binding of L. pneumophila to lung epithelial cells and

Acanthamoeba castellanii (67, 68). We next investigated the impact of Lcl collagenous repeats

on the attachment of L. pneumophila to fucoidan. Deletion of lpg2644 resulted in an 80%

decrease in fucoidan binding, consistent with previously reported data (Fig. 21A) (69). Although

there were no significant differences in attachment between the Lp02 wildtype strain and the KO

complemented with lpg2644 containing 18, and 13 repeats (Fig. 21A), there was a correlation

between the number of Lcl repeats and fucoidan attachment of the transformed KO strains (r2

=0.9096 / r=0.9573). Lp02∆lpg2644 plpg2644 11rpts was able to attach to fucoidan greater than

KO, however this strain had significantly less attachment than Lp02 (18 repeats). Furthermore

Lp02Δlpg2644 plpg2644 ∆rpts, showed a similar low attachment to fucoidan as the KO strain,

indicating that the repeat domain of Lcl is important for fucoidan binding. Over-expression of

the different lpg2644 variants in a WT genetic background led to a correlation between the

number of lpg2644 repeats in the transformed plasmid and attachment to fucoidan(r2 =0.7604 /

r=0.8720) with Lp02 plpg2644 11rpts attaching significantly less than WT but greater than KO

(Fig. 21B). This suggests that the number of Lcl collagenous repeats exerts a dominant negative

effect on fucoidan binding.

84  

 

Using ELISAs, we next measured the effect of the number of Lcl collagenous repeats on the

binding of rLcl protein to fucoidan. Lcl variants harbouring 18 and 13 repeats, had 3-5fold

greater affinity (P<0.05) to fucoidan than the Lcl variant containing 11, 2 and Δrepeats (Fig.

21C). Furthermore Lcl variants with 11, 2 and zero repeats had no significant differences in

fucoidan binding between each other. Interestingly, rLcl containing 13 repeats had

approximately 33% greater affinity to fucoidan than rLcl 18repeats (Fig. 21C). This is in contrast

with the affinity of L. pneumophila strains expressing these variants, where there were no

observable differences in fucoidan binding.

85  

 

Figure 21. The number of Lcl collagenous repeats influences fucoidan binding of L. pneumophila and recombinant Lcl. Fucoidan binding of (A) the lpg2644 knockout (KO) transformed strains and (B) wild type (WT) transformed strains measured by qPCR. C) Binding of rLcl variants to fucoidan coated wells measured by ELISA. The ELISA results are shown with the OD450nm from the antibody alone control subtracted from each condition. * and ** indicates statistically significant differences between the untransformed wild-type and the indicated strains respectively with p<0.05 by the students t-test.

86  

 

Lcl collagenous repeats influence L. pneumophila clinical prevalence.

Being able to produce greater amounts of biofilm may allow L. pneumophila to persist in

anthropogenic structures where they can infect humans. Furthermore, increased affinity to host

cell receptors containing fucose may increase the virulence of L. pneumophila by increasing the

ability to attach and thus invade host cells. Based on the potential role of Lcl collagenous repeats

in these processes, we next examined the prevalence of clinical strains containing an lpg2644

gene with 18, 13 and 11 repeats. After PCR amplifying 282 L. pneumophila clinical isolates,

isolates with 18, 13 and 11 lpg2644 repeats comprised 6.8% (19 isolates), 2.1% (6 isolates) and

1.8% (5 isolates) of the total strains respectively. This suggests that the number of lpg2644

repeats may influence the clinical prevalence of L. pneumophila (Fig. 22).

87  

 

Figure 22. Lcl collagenous repeats influence L. pneumophila clinical prevalence. Clinical prevalence of French L. pneumophila clinical isolates containing lpg2644 genes with 18,13 and 11 repeats

 

 

 

 

 

 

 

 

 

88  

 

3.4 Discussion Prokaryotic collagen-like proteins are a versatile group of microbial factors that are produced by

several pathogenic bacteria (201-204). These proteins participate in a wide variety of processes

during host infection (205-209), and recently have been implicated in biofilm production (197).

Here, we demonstrate that, in L. pneumophila, polymorphisms in Lcl’s collagenous repeat

domain are directly correlated with the degree and thickness of biofilms produced. In the

environment, the production of biofilm provides a protective niche to L. pneumophila against

stresses (37, 38). Thus L. pneumophila strains that have evolved to produce more biofilms are

likely to persist and colonize their environment more efficiently which may increase the

likelihood of the bacterium to come into contact with human hosts. Consistent with this notion,

in this study we show that clinical strains synthesizing Lcl with 11 and 13 repeats produce less

biofilm and are less clinically prevalent than isolates containing lpg2644 genes with 18 repeats.

Based on these data it is possible that Lcl’s collagenous repeats may be used as a biomarker for

strains that are prevalent in the environment, and therefore giving an indicator of the potential

risk that these isolates pose towards humans.

For pathogenic bacteria, the successful establishment of an infection depends on an arsenal of

molecules that facilitates tissue colonization and adherence to host cells and extracellular matrix

(ECM) components (126). Bacterial adhesion is essential to escape mechanical clearance and to

establish the focal point of an infection from which dissemination will occur (211). The ability of

bacteria to bind to matrices or specific host receptors is mediated by surface adhesin proteins.

Polymorphisms in the tandem repeats of these adhesins can both positively or negatively alter

host cell adhesion (141, 210). In the present study, L. pneumophila isolates synthezing Lcl

89  

 

variants that poorly bind fucoidan (lpg2644 11 repeats) are not commonly isolated from humans.

Interestingly, the estimated affinity of rLcl proteins for fucoidan was non-linear with respect to

the number of repeats. This suggests that polymorphisms in the collagenous repeat domain

interfere with the GAG binding site(s) of Lcl. In other adhesins, the number of repeats was

implicated in cell surface positioning and presentation of ligand binding domains (211, 212). It

can also influence the functional specificity of adhesins (213). In previous work, the over-

expression of Lcl proteins with 19 repeats in a wild type strain was shown to specifically

increase the binding of L. pneumophila to macrophages while over-expression of a Lcl protein

with 14 repeats only increased the binding to epithelial cells (67), suggesting that Lcl may bind

multiple host receptors. As there is no human to human spread of L. pneumophila and the natural

environment constitutes the main selective pressure for these intracellular bacteria, we speculate

that the polymorphisms in Lcl may also mediate the attachment of L. pneumophila to different

natural host receptors.

During biofilm formation, the initial attachment of L. pneumophila to abiotic surfaces is

mediated by Lcl (69). Here we determined that polymorphisms in Lcl’s collagenous repeats can

influence the degree of attachment of L. pneumophila to abiotic surfaces. This finding may

explain the correlation between the number of Lcl repeats and biofilm production when variants

are expressed in an Lp02Δ lpg2644 isogenic background. In fact binding to abiotic surfaces is

correlated with the biofilm formation abilities of other drinking water-isolated bacteria (214).

These differences in L. pneumophila however are not due to direct Lcl-abiotic surface

interactions as binding of purified rLcl isoforms to polystyrene was low regardless of the number

of collagenous repeats. Interestingly, during biofilm production, binding to components of the

extracellular matrix is believed to facilitate stronger attachment to abiotic surfaces (215-217)

90  

 

Therefore it is possible that Lcl acts as an intermediate during abiotic surface binding, by

interacting with other factors that facilitate adhesion. Alternatively, Lcl may alter the surface

properties of L. pneumophila therefore potentiating the attachment of the bacteria to surfaces. In

fact, surface hydrophobicity is known to be crucial during biofilm formation, as this can increase

the strength of bacteria-surface interactions (214, 217). Yet paradoxically, deletion of lpg2644

results in an increase in surface hydrophobicity (Fig. 23), suggesting that Lcl may have the

opposite effect.

In this study we show that over-expression of Lcl isoforms containing different numbers of

repeats in the wild type Lp02 strain results in dominant negative effects in biofilm production

and fucoidan binding, while sedimentation and abiotic attachment are unchanged. Although the

decrease in biofilm production of the Lp02 plpg2644Δrpts strain may be explained by a decrease

in cell-cell interactions, based on the poor sedimentation of this strain, the cause of the dominant

negative effect observed with wild-type strains over-expressing Lcl with 11 and 13 repeats

remains unclear. It suggests that recombinant Lcl variants interact with the endogenous Lcl using

their conserved C-terminal or N-terninal domains. Similarly, the Group A Streptococcus

adhesion and biofilm mediator Scl-1 has a “lollipop-like” structure where the collagen-like

domain comprises the stalks that are capable of interacting with one another, while other

peptides make up the head region that is capable of binding (209, 218). Although the structure of

Lcl is unknown, it is possible that Lcl may have a similar shape, therefore allowing Lcl’s

collagenous repeats to influence other domains.

91  

 

Figure 23. Lcl influences L. pneumophila surface hydrophobicity. Surface hydrophobicity of Lp02 and Lp02Δ lpg2644 measured by the hexadecane binding method.

92  

 

4 Conclusion  

In this study, we demonstrate that the surface exposed adhesin, Lcl, can contribute to the

virulence of L. pneumophila in several ways. Lcl is capable of mediating multicellular behaviour

to induce formation of auto-aggregates. Lcl also is a key player in the initial attachment of L.

pneumophila to natural host cells such as A. castellanii. Furthermore the ability to form auto-

aggregates increases the infectivity of protozoa by promoting contacts between the bacteria and

host cells. The collagenous domain of Lcl is highly polymorphic among clinical isolates and

these polymorphisms can influence biofilm formation. Lcl repeat polymorphisms also influences

the attachment to fucoidan, suggesting that this region may also mediate the attachment of L.

pneumophila to host cells. The Lcl variants which allow the production of more robust biofilms

and have higher affinity for fucoidan is also more common among prevalent clinical isolates.

Taken together this demonstrates that Lcl is a crucial factor involved in both the lifecycle and the

virulence of this pathogen.

These findings may help us to improve our understanding of the environmental factors governing

the ecology of L. pneumophila. In the long term, these findings may lead to the design of

alternative disinfection strategies that could more efficiently prevent colonization of man-made

water systems by L. pneumophila.

93  

 

References  

1. Sanford, J. P. 1979. Legionnaires' disease: one person's perspective. Ann. Intern. Med. 90:699-703.

2. Fraser, D. W., T. R. Tsai, W. Orenstein, W. E. Parkin, H. J. Beecham, R. G. Sharrar, J. Harris, G. F. Mallison, S. M. Martin, J. E. McDade, C. C. Shepard, and P. S. Brachman. 1977. Legionnaires' disease: description of an epidemic of pneumonia. N. Engl. J. Med. 297:1189-1197. doi: 10.1056/NEJM197712012972201.

3. McDade, J. E., C. C. Shepard, D. W. Fraser, T. R. Tsai, M. A. Redus, and W. R. Dowdle. 1977. Legionnaires' disease: isolation of a bacterium and demonstration of its role in other respiratory disease. N. Engl. J. Med. 297:1197-1203. doi: 10.1056/NEJM197712012972202.

4. Chandler, F. W., M. D. Hicklin, and J. A. Blackmon. 1977. Demonstration of the agent of Legionnaires' disease in tissue. N. Engl. J. Med. 297:1218-1220. doi: 10.1056/NEJM197712012972206.

5. Yu, V. L., J. F. Plouffe, M. C. Pastoris, J. E. Stout, M. Schousboe, A. Widmer, J. Summersgill, T. File, C. M. Heath, D. L. Paterson, and A. Chereshsky. 2002. Distribution of Legionella Species and Serogroups Isolated by Culture in Patients with Sporadic Community-Acquired Legionellosis: An International Collaborative Survey. J. Infect. Dis. 186:127-128.

6. Carratalà, J., N. Fernández-Sabé, L. Ortega, X. Castellsagué, B. Rosón, J. Dorca, A. Fernández-Agüera, R. Verdaguer, J. Martínez, F. Manresa, and F. Gudiol. 2005. Outpatient care compared with hospitalization for community-acquired pneumonia: a randomized trial in low-risk patients. Ann. Intern. Med. 142:165.

7. Neil, K., and R. Berkelman. 2008. Increasing incidence of legionellosis in the United States, 1990-2005: changing epidemiologic trends. Clin. Infect. Dis. 47:591-599. doi: 10.1086/590557; 10.1086/590557.

8. Svarrer, C. W., C. Luck, P. L. Elverdal, and S. A. Uldum. 2012. Immunochromatic kits Xpect Legionella and BinaxNOW Legionella for detection of Legionella pneumophila urinary antigen have low sensitivities for the diagnosis of Legionnaires' disease. J. Med. Microbiol. 61:213-217. doi: 10.1099/jmm.0.035014-0; 10.1099/jmm.0.035014-0.

9. Berdal, B. P., C. E. Farshy, and J. C. Feeley. 1979. Detection of Legionella pneumonophila antigen in urine by enzyme-linked immunospecific assay. J. Clin. Microbiol. 9:575-578.

10. Bentham, R. H., and C. R. Broadbent. 1993. A model for autumn outbreaks of Legionnaires' disease associated with cooling towers, linked to system operation and size. Epidemiol. Infect. 111:287-295.

94  

 

11. Fields, B. S., R. F. Benson, and R. E. Besser. 2002. Legionella and Legionnaires' Disease: 25 Years of Investigation. Clin. Microbiol. Rev. 15:506-526.

12. Feazel, L. M., L. K. Baumgartner, K. L. Peterson, D. N. Frank, J. Kirk Harris, and N. R. Pace. 2009. Opportunistic pathogens enriched in showerhead biofilms. Proc. Natl. Acad. Sci. U. S. A. 106:16393-16398.

13. McEvoy, M., N. Batchelor, G. Hamilton, A. MacDonald, M. Faiers, A. Sills, J. Lee, and T. Harrison. 2000. A cluster of cases of legionnaires' disease associated with exposure to a spa pool on display. Commun. Dis. Public Health. 3:43.

14. Wadowsky, R. M., R. B. Yee, L. Mezmar, E. J. Wing, and J. N. Dowling. 1982. Hot water systems as sources of Legionella pneumophila in hospital and nonhospital plumbing fixtures. Appl. Environ. Microbiol. 43:1104-1110.

15. Hindre, T., H. Bruggemann, C. Buchrieser, and Y. Hechard. 2008. Transcriptional profiling of Legionella pneumophila biofilm cells and the influence of iron on biofilm formation. Microbiology. 154:30-41.

16. Pécastaings, S., M. Bergé, K. M. Dubourg, and C. Roques. 2010. Sessile Legionella pneumophila is able to grow on surfaces and generate structured monospecies biofilms. Biofouling. 26:809.

17. Kwon, S., E. Moon, T. Kim, S. Hong, and H. Park. 2009. Pyrosequencing Demonstrated Complex Microbial Communities in a Membrane Filtration System for a Drinking Water Treatment Plant. Microbes and Environments. 26:1103150283-155.

18. Murga, R., T. S. Forster, E. Brown, J. M. Pruckler, B. S. Fields, and R. M. Donlan. 2001. Role of biofilms in the survival of Legionella pneumophila in a model potable-water system. Microbiology. 147:3121.

19. Rowbotham, T. J. 1981. Pontiac Fever, Amoebae and Legionellae. The Lancet. 317:40-41.

20. Molmeret, M., M. Horn, M. Wagner, M. Santic, and Y. Abu Kwaik. 2005. Amoebae as training grounds for intracellular bacterial pathogens. Appl. Environ. Microbiol. 71:20-28.

21. Steinert, M., U. Hentschel, and J. Hacker. 2002. Legionella pneumophila: an aquatic microbe goes astray. FEMS Microbiol. Rev. 26:149-162.

22. Yan, L., R. L. Cerny, and J. D. Cirillo. 2004. Evidence that hsp90 is involved in the altered interactions of Acanthamoeba castellanii variants with bacteria. Eukaryotic Cell. 3:567-578.

23. Chaabna, Z., Françoise Forey, M. Reyrolle, S. Jarraud, Danièle Atlan, D. Fontvieille, and C. Gilbert. 2013. Molecular diversity and high virulence of Legionella pneumophila strains isolated from biofilms developed within a warm spring of a thermal spa. BMC Microbiology. 13:17-17.

95  

 

24. Abu Khweek, A., N. S. Fernandez Davila, K. Caution, A. Akhter, B. A. Abdulrahman, M. Tazi, H. Hassan, L. A. Novotny, L. O. Bakaletz, and A. O. Amer. 2013. Biofilm-derived Legionella pneumophila evades the innate immune response in macrophages. Front. Cell. Infect. Microbiol. 3:18. doi: 10.3389/fcimb.2013.00018; 10.3389/fcimb.2013.00018.

25. Barker, J., P. A. Lambert, and M. R. Brown. 1993. Influence of intra-amoebic and other growth conditions on the surface properties of Legionella pneumophila. Infect. Immun. 61:3503-3510.

26. Newsome, A. L., M. B. Farone, S. G. Berk, and J. H. Gunderson. 2001. Free living amoebae as opportunistic hosts for intracellular bacterial parasites. J. Eukaryot. Microbiol. Suppl:13S-14s.

27. Rowbotham, T. J. 1983. Isolation of Legionella pneumophila from clinical specimens via amoebae, and the interaction of those and other isolates with amoebae. J. Clin. Pathol. 36:978-986.

28. Skinner, A. R., C. M. Anand, A. Malic, and J. B. Kurtz. 1983. Acanthamoebae and environmental spread of Legionella pneumophila. Lancet. 2:289-290.

29. Taylor, M., K. Ross, and R. Bentham. 2009. Legionella, Protozoa, and Biofilms: Interactions within Complex Microbial Systems. Microb. Ecol. 58:538-547.

30. Valster, R. M., B. A. Wullings, and d. K. van. 2010. Detection of protozoan hosts for Legionella pneumophila in engineered water systems by using a biofilm batch test. Appl. Environ. Microbiol. 76:7144-7153.

31. Valster, R. M., B. A. Wullings, d. B. van, and d. K. van. 2011. Relationships between free-living protozoa, cultivable Legionella spp., and water quality characteristics in three drinking water supplies in the Caribbean. Appl. Environ. Microbiol. 77:7321.

32. Liu, R., Z. Yu, H. Guo, M. Liu, H. Zhang, and M. Yang. 2012. Pyrosequencing analysis of eukaryotic and bacterial communities in faucet biofilms. Sci. Total Environ. 435-436:124-131.

33. Mampel, J., T. Spirig, S. S. Weber, J. A. J. Haagensen, S. Molin, and H. Hilbi. 2006. Planktonic Replication Is Essential for Biofilm Formation by Legionella pneumophila in a Complex Medium under Static and Dynamic Flow Conditions. Appl. Environ. Microbiol. 72:2885-2895.

34. Temmerman, R., H. Vervaeren, B. Noseda, N. Boon, and W. Verstraete. 2006. Necrotrophic growth of Legionella pneumophila. Appl. Environ. Microbiol. 72:4323-4328.

35. Declerck, P., J. Behets, V. van Hoef, and F. Ollevier. 2007. Replication of Legionella pneumophila in floating biofilms. Curr. Microbiol. 55:435-440.

96  

 

36. Hsu, B., C. Huang, J. Chen, N. Chen, and J. Huang. 2011. Comparison of potentially pathogenic free-living amoeba hosts by Legionella spp. in substrate-associated biofilms and floating biofilms from spring environments. Water Res. 45:5171-5183.

37. Atlas, R. M. 1999. Legionella: from environmental habitats to disease pathology, detection and control. Environ. Microbiol. 1:283.

38. Hoffman, P. S. 1997. Invasion of eukaryotic cells by Legionella pneumophila: A common strategy for all hosts? The Canadian Journal of Infectious Diseases. 8:139.

39. Donlan, R. M., T. Forster, R. Murga, E. Brown, C. Lucas, J. Carpenter, and B. Fields. 2005. Legionella pneumophila associated with the protozoan Hartmannella vermiformis in a model multi-species biofilm has reduced susceptibility to disinfectants. Biofouling. 21:1-7.

40. Thomas, V., T. Bouchez, V. Nicolas, S. Robert, J. F. Loret, and Y. Lévi. 2004. Amoebae in domestic water systems: resistance to disinfection treatments and implication in Legionella persistence. J. Appl. Microbiol. 97:950-963.

41. Storey, M. V., J. Winiecka-Krusnell, N. J. Ashbolt, and T. Stenström. 2004. The efficacy of heat and chlorine treatment against thermotolerant Acanthamoebae and Legionellae. Scand. J. Infect. Dis. 36:656-656.

42. Wright, J. B., I. Ruseska, M. A. Athar, S. Corbett, and J. W. Costerton. 1989. Legionella pneumophila Grows Adherent to Surfaces in vitro and in Situ. Infection Control and Hospital Epidemiology. 10:408-415.

43. Rogers, J., A. B. Dowsett, P. J. Dennis, J. V. Lee, and C. W. Keevil. 1994. Influence of Plumbing Materials on Biofilm Formation and Growth of Legionella pneumophila in Potable Water Systems. Appl. Environ. Microbiol. 60:1842-1851.

44. Rogers, J., A. B. Dowsett, P. J. Dennis, J. V. Lee, and C. W. Keevil. 1994. Influence of temperature and plumbing material selection on biofilm formation and growth of Legionella pneumophila in a model potable water system containing complex microbial flora. Appl. Environ. Microbiol. 60:1585-1592.

45. Moritz, M. M., H. Flemming, and J. Wingender. 2010. Integration of Pseudomonas aeruginosa and Legionella pneumophila in drinking water biofilms grown on domestic plumbing materials. Int. J. Hyg. Environ. Health. 213:190-197.

46. Geesey, G. G., B. Wigglesworth-Cooksey, and K. E. Cooksey. 2000. Influence of calcium and other cations on surface adhesion of bacteria and diatoms: A review. Biofouling. 15:195-205.

47. Koubar, M., M. H. Rodier, and J. Frere. 2013. Involvement of Minerals in Adherence of Legionella pneumophila to Surfaces. Curr. Microbiol. . doi: 10.1007/s00284-012-0295-0.

97  

 

48. Yaradou, D. F., D. Raze, C. Ginevra, F. Ader, A. Doléans-Jordheim, F. Vandenesch, F. D. Menozzi, J. Etienne, and S. Jarraud. 2007. Zinc-dependent cytoadherence of Legionella pneumophila to human alveolar epithelial cells in vitro. Microb. Pathog. 43:234-242.

49. Bargellini, A., I. Marchesi, E. Righi, A. Ferrari, S. Cencetti, P. Borella, and S. Rovesti. 2011. Parameters predictive of Legionella contamination in hot water systems: Association with trace elements and heterotrophic plate counts. Water Res. 45:2315-2321.

50. Borella, P., M. T. Montagna, V. Romano-Spica, S. Stampi, G. Stancanelli, M. Triassi, I. Marchesi, A. Bargellini, R. Neglia, N. Paglionico, G. Spilotros, U. Moscato, G. Casati, P. P. Legnani, R. Sacchetti, C. Ossi, M. Moro, and G. Ribera. 2003. Relationship between mineral content of domestic hot water and microbial contamination. Journal of Trace Elements in Medicine and Biology : Organ of the Society for Minerals and Trace Elements (GMS). 17 Suppl 1:37.

51. Boyd, C. D., D. Chatterjee, H. Sondermann, and G. O'Toole A. 2012. LapG, required for modulating biofilm formation by Pseudomonas fluorescens Pf0-1, is a calcium-dependent protease. J. Bacteriol. 194:4406.

52. Chatterjee, D., C. D. Boyd, G. O'Toole A., and H. Sondermann. 2012. Structural characterization of a conserved, calcium-dependent periplasmic protease from Legionella pneumophila. J. Bacteriol. 194:4415.

53. Gião, ,M.S., S. A. Wilks, N. F. Azevedo, M. J. Vieira, and C. W. Keevil. 2009. Comparison between standard culture and peptide nucleic acid 16S rRNA hybridization quantification to study the influence of physico-chemical parameters on Legionella pneumophila survival in drinking water biofilms. Biofouling. 25:343.

54. Pang, C. M., and W. Liu. 2006. Biological filtration limits carbon availability and affects downstream biofilm formation and community structure. Appl. Environ. Microbiol. 72:5702-5712.

55. van, d. K., H. R. Veenendaal, and W. J. H. Scheffer. 2005. Biofilm formation and multiplication of Legionella in a model warm water system with pipes of copper, stainless steel and cross-linked polyethylene. Water Res. 39:2789-2798.

56. Martinelli, F., A. Caruso, L. Moschini, A. Turano, C. Scarcella, and F. Speziani. 2000. A comparison of Legionella pneumophila occurrence in hot water tanks and instantaneous devices in domestic, nosocomial, and community environments. Curr. Microbiol. 41:374-376.

57. Ciesielski, C. A., M. J. Blaser, and W. L. Wang. 1984. Role of stagnation and obstruction of water flow in isolation of Legionella pneumophila from hospital plumbing. Appl. Environ. Microbiol. 48:984-987.

98  

 

58. Fisher-Hoch, S., C. L. Bartlett, J. O. Tobin, M. B. Gillett, A. M. Nelson, J. E. Pritchard, M. G. Smith, R. A. Swann, J. M. Talbot, and J. A. Thomas. 1981. Investigation and control of an outbreaks of legionnaires' disease in a district general hospital. Lancet. 1:932.

59. Makin, T., and M. Pride. 2010. Venturi system could be major breakthrough. Health Estate. 64:27-33.

60. Storey, M. V., J. Långmark, N. J. Ashbolt, and Stenström T.A. 2004. The fate of legionellae within distribution pipe biofilms: measurement of their persistence, inactivation and detachment. Water Science and Technology : A Journal of the International Association on Water Pollution Research. 49:269.

61. Lehtola, M. J., E. Torvinen, J. Kusnetsov, T. Pitkanen, L. Maunula, C. von Bonsdorff, P. J. Martikainen, S. A. Wilks, C. W. Keevil, and I. T. Miettinen. 2007. Survival of Mycobacterium avium, Legionella pneumophila, Escherichia coli, and Caliciviruses in Drinking Water-Associated Biofilms Grown under High-Shear Turbulent Flow. Appl. Environ. Microbiol. 73:2854-2859.

62. Liu, Z., Y. E. Lin, J. E. Stout, C. C. Hwang, R. D. Vidic, and V. L. Yu. 2006. Effect of flow regimes on the presence of Legionella within the biofilm of a model plumbing system. J. Appl. Microbiol. 101:437-442.

63. Fliermans, C. B., W. B. Cherry, L. H. Orrison, S. J. Smith, D. L. Tison, and D. H. Pope. 1981. Ecological distribution of Legionella pneumophila. Appl. Environ. Microbiol. 41:9-16.

64. Stout, J. E., V. L. Yu, and M. G. Best. 1985. Ecology of Legionella pneumophila within water distribution systems. Appl. Environ. Microbiol. 49:221-228.

65. Tiaden, A., T. Spirig, T. Sahr, M. A. Walti, K. Boucke, C. Buchrieser, and H. Hilbi. 2010. The autoinducer synthase LqsA and putative sensor kinase LqsS regulate phagocyte interactions, extracellular filaments and a genomic island of Legionella pneumophila. Environ. Microbiol. 12:1243.

66.Kessler, A., U. Schell, T. Sahr, A. Tiaden, C. Harrison, C. Buchrieser, and H. Hilbi. 2013. The Legionella pneumophila orphan sensor kinase LqsT regulates competence and pathogen-host interactions as a component of the LAI-1 circuit. Environ. Microbiol. 15:646-662.

67. Vandersmissen, L., E. De Buck, V. Saels, D. A. Coil, and J. Anné. 2010. A Legionella pneumophila collagen-like protein encoded by a gene with a variable number of tandem repeats is involved in the adherence and invasion of host cells. FEMS Microbiol. Lett. 306:168.

68. Duncan, C., A. Prashar, J. So, P. Tang, D. E. Low, M. Terebiznik, and C. Guyard. 2011. Lcl of Legionella pneumophila is an immunogenic GAG binding adhesin that promotes interactions with lung epithelial cells and plays a crucial role in biofilm formation. Infect. Immun. 6:2168-2181.

99  

 

69. Mallegol, J., C. Duncan, A. Prashar, J. So, D. E. Low, M. Terebeznik, and C. Guyard. 2012. Essential Roles and Regulation of the Legionella pneumophila Collagen-Like Adhesin during Biofilm Formation. PloS One. 7:46462.

70. Stone, B. J., and Y. A. Kwaik. 1998. Expression of Multiple Pili by Legionella pneumophila: Identification and Characterization of a Type IV Pilin Gene and Its Role in Adherence to Mammalian and Protozoan Cells. Infect. Immun. 66:1768-1775.

71. Lucas, C. E., E. Brown, and B. S. Fields. 2006. Type IV pili and type II secretion play a limited role in Legionella pneumophila biofilm colonization and retention. Microbiology. 152:3569-3573.

72. De Buck, E., L. Maes, E. Meyen, L. Van Mellaert, N. Geukens, J. Anné, and E. Lammertyn. 2005. Legionella pneumophila Philadelphia-1 tatB and tatC affect intracellular replication and biofilm formation. Biochem. Biophys. Res. Commun. 331:1413-1420.

73. Cianciotto, N. P. 2007. Iron Acquisition by Legionella pneumophila. Biometals. 20:323-331.

74. Orsi, N. 2004. The antimicrobial activity of lactoferrin: Current status and perspectives. Biometals. 17:189-196.

75. Robey, M., and N. P. Cianciotto. 2002. Legionella pneumophila feoAB Promotes Ferrous Iron Uptake and Intracellular Infection. Infect. Immun. 70:5659-5669.

76. Tiaden, A., and H. Hilbi. 2012. α-Hydroxyketone synthesis and sensing by Legionella and Vibrio. Sensors (Basel, Switzerland). 12:2899-2919.

77. Spirig, T., A. Tiaden, P. Kiefer, C. Buchrieser, J. A. Vorholt, and H. Hilbi. 2008. The Legionella autoinducer synthase LqsA produces an alpha-hydroxyketone signaling molecule. The Journal of Biological Chemistry. 283:18113.

78. Tiaden, A., T. Spirig, and H. Hilbi. 2010. Bacterial gene regulation by alpha-hydroxyketone signaling. Trends Microbiol. 18:288.

79. Tiaden, A., T. Spirig, P. Carranza, H. Brüggemann, K. Riedel, L. Eberl, C. Buchrieser, and H. Hilbi. 2008. Synergistic contribution of the Legionella pneumophila lqs genes to pathogen-host interactions. J. Bacteriol. 190:7532-7547.

80. McDonough, K. A., and A. Rodriguez. 2011. The myriad roles of cyclic AMP in microbial pathogens: from signal to sword. Nat. Rev. Microbiol. 10:27-38. doi: 10.1038/nrmicro2688; 10.1038/nrmicro2688.

81. Levi, A., M. Folcher, U. Jenal, and H. A. Shuman. 2011. Cyclic diguanylate signaling proteins control intracellular growth of Legionella pneumophila. MBio. 2:e00316-e00316-10.

100  

 

82. Carlson, H. K., R. E. Vance, and M. A. Marletta. 2010. H-NOX regulation of c-di-GMP metabolism and biofilm formation in Legionella pneumophila. Mol. Microbiol. 77:930.

83. Hammer, B.K., and M. S. Swanson. 1999. Co-ordination of Legionella pneumophila virulence with entry into stationary phase by ppGpp. Mol. Microbiol. 33: 721-731.

84. Bachman, M. A., and M. S. Swanson. 2001. RpoS co-operates with other factors to induce Legionella pneumophila virulence in the stationary phase. Mol. Microbiol. 40:1201-1214.

85. Tiaden, A., T. Spirig, S. S. Weber, H. Brüggemann, R. Bosshard, C. Buchrieser, and H. Hilbi. 2007. The Legionella pneumophila response regulator LqsR promotes host cell interactions as an element of the virulence regulatory network controlled by RpoS and LetA. Cell. Microbiol. 9:2903-2903.

86. Hammer, B. K., E. S. Tateda, and M. S. Swanson. 2002. A two-component regulator induces the transmission phenotype of stationary-phase Legionella pneumophila Mol. Microbiol. 44:107-118.

87. Molofsky, A. B., and M. S. Swanson. 2003. Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication. Mol. Microbiol. 50:445-461.

88. Piao, Z., C. C. Sze, O. Barysheva, K. Iida, and S. Yoshida. 2006. Temperature-Regulated Formation of Mycelial Mat-Like Biofilms by Legionella pneumophila. Appl. Environ. Microbiol. 72:1613-1622.

89. Konishi, T., T. Yamashiro, M. Koide, and A. Nishizono. 2006. Influence of Temperature on Growth of Legionella pneumophila Biofilm Determined by Precise Temperature Gradient Incubator. Journal of Bioscience and Bioengineering. 101:478-484.

90. Justice, S. S., D. A. Hunstad, L. Cegelski, and S. J. Hultgren. 2008. Morphological plasticity as a bacterial survival strategy. Nature Reviews.Microbiology. 6:162-168.

91. Prashar, A., S. Bhatia, Z. Tabatabaeiyazdi, C. Duncan, R. Garduño A., P. Tang, D. E. Low, C. Guyard, and M. R. Terebiznik. 2012. Mechanism of invasion of lung epithelial cells by filamentous Legionella pneumophila. Cell. Microbiol. 14:1632-1655.

92. Liles, M. R., V. K. Viswanathan, and N. P. Cianciotto. 1998. Identification and Temperature Regulation of Legionella pneumophila Genes Involved in Type IV Pilus Biogenesis and Type II Protein Secretion. Infect. Immun. 66:1776-1782.

93. Messi, P., I. Anacarso, A. Bargellini, M. Bondi, I. Marchesi, S. de Niederhäusern, and P. Borella. 2011. Ecological behaviour of three serogroups of Legionella pneumophila within a model plumbing system. Biofouling. 27:165.

101  

 

94. Tison, D. L., D. H. Pope, W. B. Cherry, and C. B. Fliermans. 1980. Growth of Legionella pneumophila in association with blue-green algae (cyanobacteria). Appl. Environ. Microbiol. 39:456-459.

95. Wadowsky, R. M., and R. B. Yee. 1983. Satellite growth of Legionella pneumophila with an environmental isolate of Flavobacterium breve. Appl. Environ. Microbiol. 46:1447-1449.

96. Wéry, N., V. Bru-Adan, C. Minervini, J. Delgénes, L. Garrelly, and J. Godon. 2008. Dynamics of Legionella spp. and bacterial populations during the proliferation of L. pneumophila in a cooling tower facility. Appl. Environ. Microbiol. 74:3030-3037.

97. Stewart, C. R., D. M. Burnside, and N. P. Cianciotto. 2011. The surfactant of Legionella pneumophila Is secreted in a TolC-dependent manner and is antagonistic toward other Legionella species. J. Bacteriol. 193:5971.

98. Stewart, C. R., V. Muthye, and N. P. Cianciotto. 2012. Legionella pneumophila persists within biofilms formed by Klebsiella pneumoniae, Flavobacterium sp., and Pseudomonas fluorescens under dynamic flow conditions. PloS One. 7:e50560.

99. Kimura, S., K. Tateda, Y. Ishii, M. Horikawa, S. Miyairi, N. Gotoh, M. Ishiguro, and K. Yamaguchi. 2009. Pseudomonas aeruginosa Las quorum sensing autoinducer suppresses growth and biofilm production in Legionella species. Microbiology. 155:1934.

100. Declerck, P., J. Behets, Y. Delaedt, A. Margineanu, E. Lammertyn, and F. Ollevier. 2005. Impact of Non-Legionella Bacteria on the Uptake and Intracellular Replication of Legionella pneumophila in Acanthamoeba castellanii and Naegleria lovaniensis. Microb. Ecol. 50:536-549.

101. Emtiazi, F., T. Schwartz, S. M. Marten, P. Krolla-Sidenstein, and U. Obst. 2004. Investigation of natural biofilms formed during the production of drinking water from surface water embankment filtration. Water Res. 38:1197-1206.

102. Gião, ,M.S., S. Wilks, N. F. Azevedo, M. J. Vieira, and C. W. Keevil. 2009. Incorporation of natural uncultivable Legionella pneumophila into potable water biofilms provides a protective niche against chlorination stress. Biofouling. 25:345.

103. Alleron, L., N. Merlet, C. Lacombe, and J. Frère. 2008. Long-term survival of Legionella pneumophila in the viable but nonculturable state after monochloramine treatment. Curr. Microbiol. 57:497-502.

104. Raftery, T. D., H. Lindler, and T. L. McNealy. 2013. Altered Host Cell–Bacteria Interaction due to Nanoparticle Interaction with a Bacterial Biofilm. Microb. Ecol. 65:496-503.

105. Stojak, A. R., T. Raftery, S. J. Klaine, and T. L. McNealy. 2011. Morphological responses of Legionella pneumophila biofilm to nanoparticle exposure. Nanotoxicology. 5:730.

102  

 

106. Rogers, J., A. B. Dowsett, and C. W. Keevil. 1995. A paint incorporating silver to control mixed biofilms containing Legionella pneumophila. J. Ind. Microbiol. 15:377.

107. Liu, Z., J. E. Stout, M. Boldin, J. Rugh, W. F. Diven, and V. L. Yu. 1998. Intermittent Use of Copper-Silver Ionization for Legionella Control in Water Distribution Systems: A Potential Option in Buildings Housing Individuals at Low Risk of Infection. Clinical Infectious Diseases. 26:138-140.

108. Schwartz, T., S. Hoffmann, and U. Obst. 2003. Formation of natural biofilms during chlorine dioxide and u.v. disinfection in a public drinking water distribution system. J. Appl. Microbiol. 95:591-601.

109. Walker, J. T., C. W. Mackerness, D. Mallon, T. Makin, T. Williets, and C. W. Keevil. 1995. Control of Legionella pneumophila in a hospital water system by chlorine dioxide. J. Ind. Microbiol. 15:384.

110. Pryor, M., S. Springthorpe, S. Riffard, T. Brooks, Y. Huo, G. Davis, and S. A. Sattar. 2004. Investigation of opportunistic pathogens in municipal drinking water under different supply and treatment regimes. Water Science and Technology : A Journal of the International Association on Water Pollution Research. 50:83.

111. Williams, M. M., and E. Braun-Howland. 2003. Growth of Escherichia coli in model distribution system biofilms exposed to hypochlorous acid or monochloramine. Appl. Environ. Microbiol. 69:5463-5471.

112. Kusnetsov, J. M., P. J. Keskitalo, H. E. Ahonen, A. I. Tulkki, I. T. Miettinen, and P. J. Martikainen. 1994. Growth of Legionella and other heterotrophic bacteria in a circulating cooling water system exposed to ultraviolet irradiation. J. Appl. Microbiol. 77:461-466.

113. Cargill, K. L., B. H. Pyle, R. L. Sauer, and G. A. McFeters. 1992. Effects of culture conditions and biofilm formation on the iodine susceptibility of Legionella pneumophila. Can. J. Microbiol. 38:423.

114. Martinez-Gil, M., F. Yousef-Coronado, and M. Espinosa-Urgel. 2010. LapF, the second largest Pseudomonas putida protein, contributes to plant root colonization and determines biofilm architecture. Mol. Microbiol. 77:549-561. doi: 10.1111/j.1365-2958.2010.07249.x; 10.1111/j.1365-2958.2010.07249.x.

115. Danese, P. N., L. A. Pratt, S. L. Dove, and R. Kolter. 2000. The outer membrane protein, antigen 43, mediates cell-to-cell interactions within Escherichia coli biofilms. Mol. Microbiol. 37:424-432.

116. Klemm, P., R. M. Vejborg, and O. Sherlock. 2006. Self-associating autotransporters, SAATs: Functional and structural similarities. International Journal of Medical Microbiology. 296:187-195.

103  

 

117. Klemm, P., L. Hjerrild, M. Gjermansen, and M. A. Schembri. 2004. Structure-function analysis of the self-recognizing Antigen 43 autotransporter protein from Escherichia coli. Mol Microbiol. 51: 283-296

118. Travier, L., S. Guadagnini, E. Gouin, A. Dufour, V. Chenal-Francisque, P. Cossart, J. C. Olivo-Marin, J. M. Ghigo, O. Disson, and M. Lecuit. 2013. ActA Promotes Listeria monocytogenes Aggregation, Intestinal Colonization and Carriage. PLoS Pathog. 9:e1003131. doi: 10.1371/journal.ppat.1003131; 10.1371/journal.ppat.1003131.

119. Côté, J., and M. Mourez. 2011. Structure-function analysis of the TibA self-associating autotransporter reveals a modular organization. Infect. Immun. 79:1826-1832.

120. Charbonneau, M., and M. Mourez. 2007. Functional organization of the autotransporter adhesin involved in diffuse adherence. J. Bacteriol. 189:9020-9029.

121. Alhede, M., K. N. Kragh, K. Qvortrup, M. Allesen-Holm, M. van Gennip, L. D. Christensen, P. Ø. Jensen, A. K. Nielsen, M. Parsek, D. Wozniak, S. Molin, T. Tolker-Nielsen, N. Høiby, M. Givskov, and T. Bjarnsholt. 2011. Phenotypes of non-attached Pseudomonas aeruginosa aggregates resemble surface attached biofilm. PloS One. 6:e27943.

122. Sorroche, F. G., M. B. Spesia, A. Zorreguieta, and W. Giordano. 2012. A positive correlation between bacterial autoaggregation and biofilm formation in native Sinorhizobium meliloti isolates from Argentina. Appl. Environ. Microbiol. 78:4092.

123. Spahich, N., R. Kenjale, and G. Waksman. 2011. Crystal structure of the Haemophilus influenzae Hap adhesin reveals an intercellular oligomerization mechanism for bacterial aggregation. EMBO J. 30:3864-3874.

124. Pizarro-Cerda, J., and P. Cossart. 2006. Bacterial adhesion and entry into host cells. Cell. 124:715-727. doi: 10.1016/j.cell.2006.02.012.

125. Cianciotto, N. P., J. K. Stamos, and D. W. Kamp. 1995. Infectivity of Legionella pneumophila mip mutant for alveolar epithelial cells. Curr. Microbiol. 30:247-250.

126. Payne, N. R., and M. A. Horwitz. 1987. Phagocytosis of Legionella pneumophila is mediated by human monocyte complement receptors. J. Exp. Med. 166:1377-1389.

127. Wagner, C., A. S. Khan, T. Kamphausen, B. Schmausser, C. Unal, U. Lorenz, G. Fischer, J. Hacker, and M. Steinert. 2007. Collagen binding protein Mip enables Legionella pneumophila to transmigrate through a barrier of NCI-H292 lung epithelial cells and extracellular matrix. Cell. Microbiol. 9:450-462. doi: 10.1111/j.1462-5822.2006.00802.x.

128. Thomas, R., and T. Brooks. 2004. Common oligosaccharide moieties inhibit the adherence of typical and atypical respiratory pathogens. J. Med. Microbiol. 53:833-840.

104  

 

129. Cirillo, S. L., L. E. Bermudez, S. H. El-Etr, G. E. Duhamel, and J. D. Cirillo. 2001. Legionella pneumophila entry gene rtxA is involved in virulence. Infect. Immun. 69:508-517. doi: 10.1128/IAI.69.1.508-517.2001.

130. Cirillo, S. L., J. Lum, and J. D. Cirillo. 2000. Identification of novel loci involved in entry by Legionella pneumophila. Microbiology. 146 ( Pt 6):1345-1359.

131. Cirillo, S. L., L. Yan, M. Littman, M. M. Samrakandi, and J. D. Cirillo. 2002. Role of the Legionella pneumophila rtxA gene in amoebae. Microbiology. 148:1667-1677.

132. Garduno, R. A., E. Garduno, and P. S. Hoffman. 1998. Surface-associated hsp60 chaperonin of Legionella pneumophila mediates invasion in a HeLa cell model. Infect. Immun. 66:4602-4610.

133. Fernandez, R. C., S. M. Logan, S. H. Lee, and P. S. Hoffman. 1996. Elevated levels of Legionella pneumophila stress protein Hsp60 early in infection of human monocytes and L929 cells correlate with virulence. Infect. Immun. 64:1968-1976.

134. Helbig, J. H., B. Konig, H. Knospe, B. Bubert, C. Yu, C. P. Luck, A. Riboldi-Tunnicliffe, R. Hilgenfeld, E. Jacobs, J. Hacker, and G. Fischer. 2003. The PPIase active site of Legionella pneumophila Mip protein is involved in the infection of eukaryotic host cells. Biol. Chem. 384:125-137. doi: 10.1515/BC.2003.013.

135. Wagner, C., A. S. Khan, T. Kamphausen, B. Schmausser, C. Unal, U. Lorenz, G. Fischer, J. Hacker, and M. Steinert. 2007. Collagen binding protein Mip enables Legionella pneumophila to transmigrate through a barrier of NCI-H292 lung epithelial cells and extracellular matrix. Cell. Microbiol. 9:450-462. doi: 10.1111/j.1462-5822.2006.00802.x.

136. Stone, B. J., and Y. Abu Kwaik. 1998. Expression of multiple pili by Legionella pneumophila: identification and characterization of a type IV pilin gene and its role in adherence to mammalian and protozoan cells. Infect. Immun. 66:1768-1775.

137. Chang, B., F. Kura, J. Amemura-Maekawa, N. Koizumi, and H. Watanabe. 2005. Identification of a novel adhesion molecule involved in the virulence of Legionella pneumophila. Infect. Immun. 73:4272-4280. doi: 10.1128/IAI.73.7.4272-4280.2005.

138. Pourcel, C., P. Visca, B. Afshar, S. D'Arezzo, G. Vergnaud, and N. K. Fry. 2007. Identification of variable-number tandem-repeat (VNTR) sequences in Legionella pneumophila and development of an optimized multiple-locus VNTR analysis typing scheme. J. Clin. Microbiol. 45:1190-1199.

139. Hendrixson, D. R., and J. St. Geme W. 1998. The Haemophilus influenzae Hap Serine Protease Promotes Adherence and Microcolony Formation, Potentiated by a Soluble Host Protein. Mol. Cell. 2:841-850.

105  

 

140. Borlee, B. R., A. D. Goldman, K. Murakami, R. Samudrala, D. J. Wozniak, and M. R. Parsek. 2010. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. Mol. Microbiol. 75:827-842.

141. Sheets, A. J., and St Geme, 3rd, Joseph,W. 2011. Adhesive activity of the haemophilus cryptic genospecies cha autotransporter is modulated by variation in tandem Peptide repeats. J. Bacteriol. 193:329-339.

142. Torres, A. G., N. T. Perna, V. Burland, A. Ruknudin, F. R. Blattner, and J. B. Kaper. 2002. Characterization of Cah, a calcium-binding and heat-extractable autotransporter protein of enterohaemorrhagic Escherichia coli. Mol. Microbiol. 45:951-966.

143. Mikaty, G., M. Soyer, E. Mairey, N. Henry, D. Dyer, K. T. Forest, P. Morand, S. Guadagnini, M. C. Prévost, X. Nassif, and G. Duménil. 2009. Extracellular bacterial pathogen induces host cell surface reorganization to resist shear stress. PLoS Pathogens. 5:e1000314.

144. Hélaine, S., E. Carbonnelle, L. Prouvensier, J. Beretti, X. Nassif, and V. Pelicic. 2005. PilX, a pilus-associated protein essential for bacterial aggregation, is a key to pilus-facilitated attachment of Neisseria meningitidis to human cells. Mol. Microbiol. 55:65-77.

145. Alhede, M., K. N. Kragh, K. Qvortrup, M. Allesen-Holm, M. van Gennip, L. D. Christensen, P. O. Jensen, A. K. Nielsen, M. Parsek, D. Wozniak, S. Molin, T. Tolker-Nielsen, N. Hoiby, M. Givskov, and T. Bjarnsholt. 2011. Phenotypes of non-attached Pseudomonas aeruginosa aggregates resemble surface attached biofilm. PLoS One. 6:e27943. doi: 10.1371/journal.pone.0027943; 10.1371/journal.pone.0027943.

146. Kaplan, J. B., E. A. Izano, P. Gopal, M. T. Karwacki, S. Kim, J. L. Bose, K. W. Bayles, and A. R. Horswill. 2012. Low levels of β-lactam antibiotics induce extracellular DNA release and biofilm formation in Staphylococcus aureus. MBio. 3:e00198.

147. Nakao, R., M. Ramstedt, S. N. Wai, and B. E. Uhlin. 2012. Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis. PloS One. 7:e51241.

148. Yamaguchi, M., K. Sato, H. Yukitake, Y. Noiri, S. Ebisu, and K. Nakayama. 2010. A Porphyromonas gingivalis mutant defective in a putative glycosyltransferase exhibits defective biosynthesis of the polysaccharide portions of lipopolysaccharide, decreased gingipain activities, strong autoaggregation, and increased biofilm formation. Infect. Immun. 78:3801-3812.

149. Sherlock, O., R. M. Vejborg, and P. Klemm. 2005. The TibA adhesin/invasin from enterotoxigenic Escherichia coli is self recognizing and induces bacterial aggregation and biofilm formation. Infect. Immun. 73:1954-1963. doi: 10.1128/IAI.73.4.1954-1963.2005.

150. Tiaden, A., T. Spirig, T. Sahr, M. Wälti A., K. Boucke, C. Buchrieser, and H. Hilbi. 2010. The autoinducer synthase LqsA and putative sensor kinase LqsS regulate phagocyte interactions, extracellular filaments and a genomic island of Legionella pneumophila. Environ. Microbiol. 12:1243.

106  

 

151. Berk, S. G., G. Faulkner, E. Garduno, M. C. Joy, M. Ortiz-Jimenez, and R. A. Garduno. 2008. Packaging of Live Legionella pneumophila into Pellets Expelled by Tetrahymena spp. Does Not Require Bacterial Replication and Depends on a Dot/Icm-Mediated Survival Mechanism. Appl. Environ. Microbiol. 74:2187-2199.

152. Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed, D. C. Mackel, and W. B. Baine. 1979. Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila. J. Clin. Microbiol. 10:437-441.

153. Berger, K. H., and R. R. Isberg. 1993. Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila. Mol. Microbiol. 7:7-19.

154. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680-685.

155. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A. 76:4350-4354.

156. Lebeau, I., E. Lammertyn, E. De Buck, L. Maes, N. Geukens, L. Van Mellaert, and J. Anné. 2004. Novel transcriptional regulators of Legionella pneumophila that affect replication in Acanthamoeba castellanii. Arch. Microbiol. 181:362-370.

157. Khan, M. A., N. Knox, A. Prashar, D. Alexander, M. Abdel-Nour, C. Duncan, P. Tang, H. Amatullah, C. C. Dos Santos, N. Tijet, D. E. Low, C. Pourcel, G. Van Domselaar, M. Terebiznik, A. W. Ensminger, and C. Guyard. 2013. Comparative Genomics Reveal That Host-Innate Immune Responses Influence the Clinical Prevalence of Serogroups. PLoS One. 8:e67298. doi: 10.1371/journal.pone.0067298.

158. Duan, Y., E. Fisher, D. Malamud, E. Golub, and D. R. Demuth. 1994. Calcium-binding properties of SSP-5, the Streptococcus gordonii M5 receptor for salivary agglutinin. Infect. Immun. 62:5220-5226.

159. Sigurdson, S. L., and J. Lwebuga-Mukasa. 1994. Divalent cation-dependent regulation of rat alveolar epithelial cell adhesion and spreading. Exp. Cell Res. 213:71-79.

160. Conrady, D. G., C. C. Brescia, K. Horii, A. A. Weiss, J. Hassett, and A. B. Herr. 2008. A Zinc-Dependent Adhesion Module Is Responsible for Intercellular Adhesion in Staphylococcal Biofilms. Proc. Natl. Acad. Sci. U. S. A. 105:19456-19461.

161. Anderegg, G., F. Arnaud-Neu, R. Delgado, J. Felcman, and K. Popov. 2006. Critical Evaluation of Stability Constants of Metal Complexes of Complexones for Biomedical and Environmental Applications. ChemInform. 37:.

162. DebRoy, S., J. Dao, M. Soderberg, O. Rossier, and N. P. Cianciotto. 2006. Legionella pneumophila type II secretome reveals unique exoproteins and a chitinase that promotes bacterial

107  

 

persistence in the lung. Proc. Natl. Acad. Sci. U. S. A. 103:19146-19151. doi: 10.1073/pnas.0608279103.

163. Fishov, I., and C. L. Woldringh. 1999. Visualization of membrane domains in Escherichia coli. Mol. Microbiol. 32:1166-1172.

164. Chen, G., C. L. Patten, and H. E. Schellhorn. 2003. Controlled expression of an rpoS antisense RNA can inhibit RpoS function in Escherichia coli. Antimicrob. Agents Chemother. 47:3485-3493.

165. Huang, C. T., S. W. Peretti, and J. D. Bryers. 1993. Plasmid retention and gene expression in suspended and biofilm cultures of recombinant Escherichia coli DH5alpha(pMJR1750). Biotechnol. Bioeng. 41:211-220. doi: 10.1002/bit.260410207.

166. Init, I., Y. L. Lau, A. Arin Fadzlun, A. I. Foead, R. S. Neilson, and V. Nissapatorn. 2010. Detection of free living amoebae, Acanthamoeba and Naegleria, in swimming pools, Malaysia. Tropical Biomedicine. 27:566.

167. Pickup, Z. L., R. Pickup, and J. D. Parry. 2007. A comparison of the growth and starvation responses of Acanthamoeba castellanii and Hartmannella vermiformis in the presence of suspended and attached Escherichia coli K12. FEMS Microbiol. Ecol. 59:556-563.

168. Bracha, R., D. Kobiler, and D. Mirelman. 1982. Attachment and ingestion of bacteria by trophozoites of Entamoeba histolytica. Infect. Immun. 36:396-406.

169. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial Biofilms: A Common Cause of Persistent Infections. Science. 284:1318-1322.

170. Haaber, J., M. T. Cohn, D. Frees, T. J. Andersen, and H. Ingmer. 2012. Planktonic aggregates of Staphylococcus aureus protect against common antibiotics. PLoS One. 7:e41075. doi: 10.1371/journal.pone.0041075; 10.1371/journal.pone.0041075.

171. Abu Kwaik, Y., L. Y. Gao, B. J. Stone, C. Venkataraman, and O. S. Harb. 1998. Invasion of protozoa by Legionella pneumophila and its role in bacterial ecology and pathogenesis. Appl. Environ. Microbiol. 64:3127-3133.

172. Molofsky, A. B., L. M. Shetron-Rama, and M. S. Swanson. 2005. Components of the Legionella pneumophila flagellar regulon contribute to multiple virulence traits, including lysosome avoidance and macrophage death. Infect. Immun. 73:5720-5734. doi: 10.1128/IAI.73.9.5720-5734.2005.

173. Declerck, P., J. Behets, B. De Keersmaecker, and F. Ollevier. 2007. Receptor-mediated uptake of Legionella pneumophila by Acanthamoeba castellanii and Naegleria lovaniensis. J. Appl. Microbiol. 103:2697-2703. doi: 10.1111/j.1365-2672.2007.03530.x.

108  

 

174. Feasley, C. L., J. M. Johnson, C. M. West, and C. P. Chia. 2010. Glycopeptidome of a heavily N-glycosylated cell surface glycoprotein of Dictyostelium implicated in cell adhesion. Journal of Proteome Research. 9:3495.

175. Schiller, B., A. Hykollari, J. Voglmeir, G. Pöltl, K. Hummel, E. Razzazi-Fazeli, R. Geyer, and I. B. H. Wilson. 2009. Development of Dictyostelium discoideum is associated with alteration of fucosylated N-glycan structures. Biochem. J. 423:41.

176. Oberley, R. E., K. A. Ault, T. L. Neff, K. R. Khubchandani, E. C. Crouch, and J. M. Snyder. 2004. Surfactant proteins A and D enhance the phagocytosis of Chlamydia into THP-1 cells. AJP - Lung Cellular and Molecular Physiology. 287:L296-L306.

177. Mulcahy, H., and S. Lewenza. 2011. Magnesium limitation is an environmental trigger of the Pseudomonas aeruginosa biofilm lifestyle. PloS One. 6:e23307.

178. Das, T., P. K. Sharma, H. J. Busscher, H. van der Mei C., and B. P. Krom. 2010. Role of extracellular DNA in initial bacterial adhesion and surface aggregation. Appl. Environ. Microbiol. 76:3405-3408.

179. Harris, R. H., and R. Mitchell. 1973. The Role of Polymers in Microbial Aggregation. Annual Reviews in Microbiology. 27:27-50.

180. Merino, N., A. Toledo-Arana, M. Vergara-Irigaray, J. Valle, C. Solano, E. Calvo, J. A. Lopez, T. J. Foster, J. R. Penades, and I. Lasa. 2009. Protein A-Mediated Multicellular Behavior in Staphylococcus aureus. The Journal of Bacteriology. 191:832-843.

181. Kierek, K., and P. I. Watnick. 2003. The Vibrio cholerae O139 O-antigen polysaccharide is essential for Ca2+-dependent biofilm development in sea water. Proc. Natl. Acad. Sci. U. S. A. 100:14357-14362.

182. Kierek, K., and P. I. Watnick. 2003. Environmental Determinants of Vibrio cholerae Biofilm Development. Appl. Environ. Microbiol. 69:5079-5088.

183. Martínez-Gil, M., D. Romero, R. Kolter, and M. Espinosa-Urgel. 2012. Calcium Causes Multimerization of the Large Adhesin LapF and Modulates Biofilm Formation by Pseudomonas putida. J. Bacteriol. 194:6782-6789.

184. McLean, J. S., G. E. Pinchuk, O. V. Geydebrekht, C. L. Bilskis, B. A. Zakrajsek, E. A. Hill, D. A. Saffarini, M. F. Romine, Y. A. Gorby, J. K. Fredrickson, and A. S. Beliaev. 2008. Oxygen-dependent autoaggregation in Shewanella oneidensis MR-1. Environ. Microbiol. 10:1861-1876.

185. Kawakami, Y., N. Hayashi, M. Ema, and M. Nakayama. 2007. Effects of divalent cations on Halobacterium salinarum cell aggregation. J. Biosci. Bioeng. 104:42-46. doi: 10.1263/jbb.104.42.

109  

 

186. Kawakami, Y., T. Ito, M. Kamekura, and M. Nakayama. 2005. Ca(2+)-dependent cell aggregation of halophilic archaeon, Halobacterium salinarum. J. Biosci. Bioeng. 100:681-684. doi: 10.1263/jbb.100.681.

187. Serrano-Suárez, A., J. Dellundé, H. Salvadó, S. Cervero-Aragó, J. Méndez, O. Canals, S. Blanco, A. Arcas, and R. Araujo. 2013. Microbial and physicochemical parameters associated with Legionella contamination in hot water recirculation systems. Environmental Science and Pollution Research. 1-11. doi: 10.1007/s11356-013-1557-5.

188. Hall-Stoodley, L., J. W. Costerton, and P. Stoodley. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat. Rev. Microbiol. 2:95-108. doi: 10.1038/nrmicro821.

189. Hall-Stoodley, L., and P. Stoodley. 2005. Biofilm formation and dispersal and the transmission of human pathogens. Trends Microbiol. 13:7-10. doi: 10.1016/j.tim.2004.11.004.

190. Colvin, K. M., V. D. Gordon, K. Murakami, B. R. Borlee, D. J. Wozniak, G. C. L. Wong, and M. R. Parsek. 2011. The Pel Polysaccharide Can Serve a Structural and Protective Role in the Biofilm Matrix of Pseudomonas aeruginosa. PLoS Pathogens. 7:e1001264.

191. Nguyen, K. T., K. Piastro, T. A. Gray, and K. M. Derbyshire. 2010. Mycobacterial biofilms facilitate horizontal DNA transfer between strains of Mycobacterium smegmatis. J. Bacteriol. 192:5134-5142. doi: 10.1128/JB.00650-10; 10.1128/JB.00650-10.

192. Drenkard, E., and F. M. Ausubel. 2002. Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation. Nature. 416:740-743. doi: 10.1038/416740a.

193. Giltner, C. L., E. J. van Schaik, G. F. Audette, D. Kao, R. S. Hodges, D. J. Hassett, and R. T. Irvin. 2006. The Pseudomonas aeruginosa type IV pilin receptor binding domain functions as an adhesin for both biotic and abiotic surfaces. Mol. Microbiol. 59:1083-1096. doi: 10.1111/j.1365-2958.2005.05002.x.

194. Heilmann, C., O. Schweitzer, C. Gerke, N. Vanittanakom, D. Mack, and F. Gotz. 1996. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol. Microbiol. 20:1083-1091.

195. Wigglesworth-Cooksey, B., and K. E. Cooksey. 2005. Use of fluorophore-conjugated lectins to study cell-cell interactions in model marine biofilms. Appl. Environ. Microbiol. 71:428-435. doi: 10.1128/AEM.71.1.428-435.2005.

196. Parveen, N., and J. M. Leong. 2000. Identification of a candidate glycosaminoglycan-binding adhesin of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:1220-1234.

197. Oliver-Kozup, H., M. Elliott, B. A. Bachert, K. H. Martin, S. D. Reid, D. Schwegler-Berry, B. J. Green, and S. Lukomski. 2011. The streptococcal collagen-like protein-1 (Scl1) is

110  

 

a significant determinant for biofilm formation by group A Streptococcus. BMC Microbiology. 11:262-262.

198. Thormann, K. M., R. M. Saville, S. Shukla, D. A. Pelletier, and A. M. Spormann. 2004. Initial Phases of biofilm formation in Shewanella oneidensis MR-1. J. Bacteriol. 186:8096-8104. doi: 10.1128/JB.186.23.8096-8104.2004.

199. Adam, E. C., B. S. Mitchell, D. U. Schumacher, G. Grant, and U. Schumacher. 1997. Pseudomonas aeruginosa II lectin stops human ciliary beating: therapeutic implications of fucose. American Journal of Respiratory and Critical Care Medicine. 155:2102.

200. Bucior, I., J. F. Pielage, and J. N. Engel. 2012. Pseudomonas aeruginosa pili and flagella mediate distinct binding and signaling events at the apical and basolateral surface of airway epithelium. PLoS Pathogens. 8:e1002616.

201. Ghosh, N., T. J. McKillop, T. A. Jowitt, M. Howard, H. Davies, D. F. Holmes, I. S. Roberts, and J. Bella. 2012. Collagen-like proteins in pathogenic E. coli strains. PloS One. 7:e37872.

202. Mouton, L., E. Traunecker, K. McElroy, L. Du Pasquier, and D. Ebert. 2009. Identification of a polymorphic collagen-like protein in the crustacean bacteria Pasteuria ramosa. Res. Microbiol. 160:792-799.

203. Rasmussen, M., A. Edén, L. Björck, I. Division II, o. M. Faculty, C. S. Department of, I. Sektion II, Avdelningen för infektionsmedicin (BMC), L. universitet, Medicin, I. M. Division of, L. University, and k. v. Institutionen för. 2000. SclA, a novel collagen-like surface protein of Streptococcus pyogenes. Infect. Immun. 68:6370-6377.

204. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2002. A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol. Microbiol. 45:169-178.

205. Chen, S., Y. Tsai, C. Wu, S. Liao, L. Wu, C. Chang, Y. Liu, and P. Tsai. 2010. Streptococcal collagen-like surface protein 1 promotes adhesion to the respiratory epithelial cell. BMC Microbiology. 10:320-320.

206. Humtsoe, J. O., J. K. Kim, Y. Xu, D. R. Keene, M. Höök, S. Lukomski, and K. K. Wary. 2005. A streptococcal collagen-like protein interacts with the alpha2beta1 integrin and induces intracellular signaling. The Journal of Biological Chemistry. 280:13848.

207. Caswell, C. C., M. Barczyk, D. R. Keene, E. Lukomska, D. E. Gullberg, and S. Lukomski. 2008. Identification of the first prokaryotic collagen sequence motif that mediates binding to human collagen receptors, integrins alpha2beta1 and alpha11beta1. The Journal of Biological Chemistry. 283:36168.

208. Reuter, M., C. C. Caswell, S. Lukomski, and P. F. Zipfel. 2010. Binding of the human complement regulators CFHR1 and factor H by streptococcal collagen-like protein 1 (Scl1) via

111  

 

their conserved C termini allows control of the complement cascade at multiple levels. The Journal of Biological Chemistry. 285:38473-38485.

209. Reuter, M., S. Hälbich, C. C. Caswell, S. Lukomski, and P. F. Zipfel. 2009. The streptococcal-collagen-like protein (Scl) of S. pyogenes M6 and M55, binds Factor H and CFHR-1 via the C-terminus. Mol. Immunol. 46:2862-2863.

210. Levdansky, E., O. Kashi, H. Sharon, Y. Shadkchan, and N. Osherov. 2010. The Aspergillus fumigatus cspA gene encoding a repeat-rich cell wall protein is important for normal conidial cell wall architecture and interaction with host cells. Eukaryotic Cell. 9:1403-1415.

211. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2003. Polymorphism in the Collagen-Like Region of the Bacillus anthracis BclA Protein Leads to Variation in Exosporium Filament Length. The Journal of Bacteriology. 185:1555-1563.

212. Hartford, O., P. Francois, P. Vaudaux, and T. J. Foster. 1997. The dipeptide repeat region of the fibrinogen-binding protein (clumping factor) is required for functional expression of the fibrinogen-binding domain on the Staphylococcus aureus cell surface. Mol. Microbiol. 25:1065-1076.

213. Oh, S., G. Cheng, J. A. Nuessen, R. Jajko, K. M. Yeater, X. Zhao, C. Pujol, D. R. Soll, and L. L. Hoyer. 2005. Functional specificity of Candida albicans Als3p proteins and clade specificity of ALS3 alleles discriminated by the number of copies of the tandem repeat sequence in the central domain. Microbiology. 151:673-681.

214. Simoes, L. C., M. Simoes, and M. J. Vieira. 2010. Adhesion and biofilm formation on polystyrene by drinking water-isolated bacteria. Antonie Van Leeuwenhoek. 98:317-329. doi: 10.1007/s10482-010-9444-2; 10.1007/s10482-010-9444-2.

215. Rogers, J. D., R. J. Palmer Jr, P. E. Kolenbrander, and F. A. Scannapieco. 2001. Role of Streptococcus gordonii amylase-binding protein A in adhesion to hydroxyapatite, starch metabolism, and biofilm formation. Infect. Immun. 69:7046-7056. doi: 10.1128/IAI.69.11.7046-7056.2001.

216. Das, T., P. K. Sharma, H. J. Busscher, H. C. van der Mei, and B. P. Krom. 2010. Role of extracellular DNA in initial bacterial adhesion and surface aggregation. Appl. Environ. Microbiol. 76:3405-3408. doi: 10.1128/AEM.03119-09; 10.1128/AEM.03119-09.

217. Donlan, R. M. 2002. Biofilms: microbial life on surfaces. Emerg. Infect. Dis. 8:881-890. doi: 10.3201/eid0809.020063.

218. Xu, Y., D. R. Keene, J. M. Bujnicki, M. Höök, and S. Lukomski. 2002. Streptococcal Scl1 and Scl2 proteins form collagen-like triple helices. The Journal of Biological Chemistry. 277:27312-27318.

112  

 

113  

219. Ader, F., R. Le Berre, R. Fackeure, D. Raze, F. D. Menozzi, N. Viget, K. Faure, E. Kipnis, B. Guery, S. Jarraud, J. Etienne, and C. Chidiac. 2008. In vivo effect of adhesion inhibitor heparin on Legionella pneumophila pathogenesis in a murine pneumonia model. Intensive Care Med. 34:1511-1519. doi: 10.1007/s00134-008-1063-2; 10.1007/s00134-008-1063-2.